ID: 976473072

View in Genome Browser
Species Human (GRCh38)
Location 4:85452207-85452229
Sequence AGTCATTCAACTATCTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976473072_976473079 15 Left 976473072 4:85452207-85452229 CCCTGACAGATAGTTGAATGACT No data
Right 976473079 4:85452245-85452267 GATGCAGACAGCTGAGCAAAGGG No data
976473072_976473078 14 Left 976473072 4:85452207-85452229 CCCTGACAGATAGTTGAATGACT No data
Right 976473078 4:85452244-85452266 GGATGCAGACAGCTGAGCAAAGG No data
976473072_976473080 20 Left 976473072 4:85452207-85452229 CCCTGACAGATAGTTGAATGACT No data
Right 976473080 4:85452250-85452272 AGACAGCTGAGCAAAGGGCCTGG No data
976473072_976473081 21 Left 976473072 4:85452207-85452229 CCCTGACAGATAGTTGAATGACT No data
Right 976473081 4:85452251-85452273 GACAGCTGAGCAAAGGGCCTGGG No data
976473072_976473075 -7 Left 976473072 4:85452207-85452229 CCCTGACAGATAGTTGAATGACT No data
Right 976473075 4:85452223-85452245 AATGACTGCCCTTTGGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976473072 Original CRISPR AGTCATTCAACTATCTGTCA GGG (reversed) Intergenic
No off target data available for this crispr