ID: 976473075

View in Genome Browser
Species Human (GRCh38)
Location 4:85452223-85452245
Sequence AATGACTGCCCTTTGGACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976473073_976473075 -8 Left 976473073 4:85452208-85452230 CCTGACAGATAGTTGAATGACTG No data
Right 976473075 4:85452223-85452245 AATGACTGCCCTTTGGACAGTGG No data
976473072_976473075 -7 Left 976473072 4:85452207-85452229 CCCTGACAGATAGTTGAATGACT No data
Right 976473075 4:85452223-85452245 AATGACTGCCCTTTGGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976473075 Original CRISPR AATGACTGCCCTTTGGACAG TGG Intergenic
No off target data available for this crispr