ID: 976473077

View in Genome Browser
Species Human (GRCh38)
Location 4:85452232-85452254
Sequence TGTCTGCATCCACTGTCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976473077_976473080 -5 Left 976473077 4:85452232-85452254 CCTTTGGACAGTGGATGCAGACA No data
Right 976473080 4:85452250-85452272 AGACAGCTGAGCAAAGGGCCTGG No data
976473077_976473079 -10 Left 976473077 4:85452232-85452254 CCTTTGGACAGTGGATGCAGACA No data
Right 976473079 4:85452245-85452267 GATGCAGACAGCTGAGCAAAGGG No data
976473077_976473081 -4 Left 976473077 4:85452232-85452254 CCTTTGGACAGTGGATGCAGACA No data
Right 976473081 4:85452251-85452273 GACAGCTGAGCAAAGGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976473077 Original CRISPR TGTCTGCATCCACTGTCCAA AGG (reversed) Intergenic
No off target data available for this crispr