ID: 976473081

View in Genome Browser
Species Human (GRCh38)
Location 4:85452251-85452273
Sequence GACAGCTGAGCAAAGGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976473073_976473081 20 Left 976473073 4:85452208-85452230 CCTGACAGATAGTTGAATGACTG No data
Right 976473081 4:85452251-85452273 GACAGCTGAGCAAAGGGCCTGGG No data
976473076_976473081 -3 Left 976473076 4:85452231-85452253 CCCTTTGGACAGTGGATGCAGAC No data
Right 976473081 4:85452251-85452273 GACAGCTGAGCAAAGGGCCTGGG No data
976473077_976473081 -4 Left 976473077 4:85452232-85452254 CCTTTGGACAGTGGATGCAGACA No data
Right 976473081 4:85452251-85452273 GACAGCTGAGCAAAGGGCCTGGG No data
976473072_976473081 21 Left 976473072 4:85452207-85452229 CCCTGACAGATAGTTGAATGACT No data
Right 976473081 4:85452251-85452273 GACAGCTGAGCAAAGGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976473081 Original CRISPR GACAGCTGAGCAAAGGGCCT GGG Intergenic
No off target data available for this crispr