ID: 976473575

View in Genome Browser
Species Human (GRCh38)
Location 4:85456929-85456951
Sequence ATGTAGTATTTTTATCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976473574_976473575 -5 Left 976473574 4:85456911-85456933 CCTCATTTTATTAATTTCATGTA No data
Right 976473575 4:85456929-85456951 ATGTAGTATTTTTATCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976473575 Original CRISPR ATGTAGTATTTTTATCTGCT TGG Intergenic
No off target data available for this crispr