ID: 976475212

View in Genome Browser
Species Human (GRCh38)
Location 4:85475388-85475410
Sequence ACTGGGCTGCTCCGCAGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976475212_976475216 8 Left 976475212 4:85475388-85475410 CCCGCGCTGCGGAGCAGCCCAGT 0: 1
1: 0
2: 0
3: 8
4: 131
Right 976475216 4:85475419-85475441 TTCAACACTTCCCCTTGTTGTGG 0: 1
1: 0
2: 1
3: 7
4: 143
976475212_976475218 18 Left 976475212 4:85475388-85475410 CCCGCGCTGCGGAGCAGCCCAGT 0: 1
1: 0
2: 0
3: 8
4: 131
Right 976475218 4:85475429-85475451 CCCCTTGTTGTGGAAAGTAAAGG 0: 1
1: 0
2: 0
3: 16
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976475212 Original CRISPR ACTGGGCTGCTCCGCAGCGC GGG (reversed) Exonic
900190177 1:1349822-1349844 CCTGGGGTTCTCCGCAGGGCAGG + Intergenic
900432088 1:2607250-2607272 TCTTGGCAGCTCTGCAGCGCAGG + Intronic
900975440 1:6013464-6013486 ACAGGGCTCCTCCCCAGCCCTGG - Intronic
908615689 1:65919773-65919795 ACTGGGCTACTCATCAGCCCTGG - Intronic
912980712 1:114369057-114369079 ACAGGGATGCTCCACAGGGCAGG + Intergenic
915307463 1:154988799-154988821 ACTGGCCTGCTCCACAGCGTTGG - Exonic
922152335 1:223017107-223017129 ACTGGGCAGATCTGCAGGGCTGG - Intergenic
922794905 1:228335170-228335192 GCTGTGCTGCTGCGCAGAGCTGG - Exonic
922815493 1:228446241-228446263 ACTGGGGGGCGCCGCAGTGCAGG - Intergenic
1063363709 10:5477194-5477216 ACTGGGGTGCTCAGCTGCGGAGG - Intergenic
1064297673 10:14092920-14092942 ACTGGACTGCTCCGCATTCCTGG - Intronic
1069156269 10:65034673-65034695 ACTGGGCAGCTCCTCTGTGCAGG - Intergenic
1070675385 10:78408304-78408326 ACTGGGCTGCGGCAGAGCGCAGG - Intergenic
1071579409 10:86756328-86756350 TCGGGGCTGCTCCTCCGCGCGGG - Intergenic
1072680035 10:97499409-97499431 AGGGGGCCGCTCCCCAGCGCCGG + Intronic
1072689328 10:97561233-97561255 ACAGGGATGCTCCACAGGGCAGG + Intronic
1073446161 10:103581828-103581850 ACTGGGCTGATAGGCAGCTCAGG + Intronic
1077253541 11:1571185-1571207 CCTGGTCTGCTCCGCATCCCAGG + Intronic
1077927987 11:6701019-6701041 ACTGGGCTGCTTAGAAGTGCAGG - Intergenic
1082797358 11:57387791-57387813 ACTGGGCTGCTCACCAGCCCTGG - Exonic
1085098616 11:73781313-73781335 ACTGGGCTGCTTAGCATCTCAGG - Intergenic
1086332068 11:85764046-85764068 GCTGGGCTGCTCCGCTTCTCAGG + Intronic
1086666644 11:89491529-89491551 ACCAGTCTGCTCCGCCGCGCCGG + Intronic
1086973759 11:93110327-93110349 ACAGGGATGCTCCACAGGGCAGG + Intergenic
1091814854 12:3429881-3429903 ACAGGGATGCTCCACAGGGCAGG + Intronic
1092223212 12:6729527-6729549 GCTGGGCTGGTCCGCAGAGGTGG + Intronic
1096465775 12:51847294-51847316 ACTGGGCGGCTCCACAGGGGAGG + Intergenic
1096495527 12:52037359-52037381 CCTGAGCTGCTCTGCACCGCAGG - Intronic
1100368973 12:93947681-93947703 ACTGAGCAGCTCTGCAGCACAGG + Intergenic
1106483435 13:30153939-30153961 ACCAGGCTGCTCCCCACCGCCGG + Intergenic
1113654019 13:112057065-112057087 ACCGGCCAGCTCCGCAGCCCCGG - Intergenic
1113654206 13:112057938-112057960 AGCGGGCGGCTCCGCGGCGCTGG - Intergenic
1114319628 14:21536670-21536692 GCGGGGCTTCTCCCCAGCGCAGG + Intronic
1114635147 14:24183049-24183071 ACAGGGGTGCTCCGCAGCTGTGG - Exonic
1116329286 14:43576356-43576378 ACTGTGCTGCACAGCAGAGCAGG - Intergenic
1117072680 14:52069954-52069976 CCTGAGCTGCTCCGCAGGACTGG + Intergenic
1118817544 14:69323761-69323783 CCTGGTCTGCTCTGCAGGGCAGG + Intronic
1122575208 14:102737641-102737663 TCTGGGCTCCTCTGCAGCCCTGG + Intergenic
1126709733 15:51443065-51443087 ACTGAGCTGCTCTGGAGCTCAGG + Intergenic
1130085512 15:80775645-80775667 ACTGGCCTCCTCCGCAGCAGAGG + Intergenic
1130411896 15:83654432-83654454 ACTGGGGTGCTCCTCACTGCTGG + Intronic
1132517194 16:371324-371346 ACTGGGGTGCTCTGCTGCTCTGG - Exonic
1134622875 16:15702899-15702921 ACTGGGCCGCTCAGCAGGGAGGG - Intronic
1136991053 16:35151639-35151661 ACTGGGCTGCTCAGCACTGCTGG + Intergenic
1137896471 16:52217952-52217974 ACTGGGCTGTTCAGCACCACTGG - Intergenic
1144241011 17:13311602-13311624 GCTGGGCTGGTCCTCAGCTCTGG + Intergenic
1144494255 17:15736765-15736787 ACTGGGCTGCCCAGCACTGCTGG - Intronic
1144631200 17:16873369-16873391 ACTGGGCTCCTCTGCACCCCGGG - Intergenic
1144639798 17:16931062-16931084 ACTGGGCTGCTCAGCGCTGCTGG + Intronic
1144906008 17:18639911-18639933 ACTGGGCTGCCCAGCACTGCTGG + Intronic
1145865513 17:28238748-28238770 ACAGGGATGCTCCACAGGGCAGG + Intergenic
1147852983 17:43456775-43456797 ACTGGGCTCCTCAGCACCTCTGG - Intergenic
1151717797 17:75840305-75840327 ACTGGTCCTCTCGGCAGCGCAGG + Exonic
1151729915 17:75904985-75905007 TGAGGCCTGCTCCGCAGCGCGGG - Exonic
1152362027 17:79837231-79837253 ACTGGGCTGTTTGGCAGGGCAGG - Intronic
1152453381 17:80397852-80397874 ACAGGGATGCTCCACAGGGCAGG - Exonic
1154496404 18:14964235-14964257 ACTTGGCTGCACAGCATCGCAGG - Intergenic
1157764122 18:50284778-50284800 ACTGCCCTCTTCCGCAGCGCGGG + Exonic
1161064411 19:2230571-2230593 ACAGGCCTGCCCCGCATCGCAGG - Exonic
1163319453 19:16565070-16565092 ACTGGCCTCCTCCTCACCGCAGG + Intronic
1164131036 19:22362026-22362048 ACAGGGATGCTCCACAGGGCAGG + Intergenic
1164217638 19:23163729-23163751 ACAGGGATGCTCCACAGGGCAGG + Intergenic
1165073423 19:33268409-33268431 TGTGGGATTCTCCGCAGCGCTGG - Intergenic
1165266588 19:34666814-34666836 CCTGGGCTGCGCTGCAGCCCTGG + Intronic
1165295838 19:34925407-34925429 ATCGGGCTGCTCCGCAGCACCGG + Intergenic
1167502861 19:49857307-49857329 ACTGGGCGGCTCTGCAGGGCTGG + Intronic
926695148 2:15765859-15765881 CCAGGGCTGCTCTGCAGAGCTGG - Intergenic
927504409 2:23603729-23603751 CCTGGCCTGCTCCCCAGGGCTGG - Intronic
927714295 2:25342131-25342153 CCGGGCCGGCTCCGCAGCGCCGG - Intronic
930517850 2:52431344-52431366 ACAGGGATGCTCTGCAGGGCAGG - Intergenic
932770814 2:74499809-74499831 ACGGGGCTGCTCCGCGCTGCGGG + Intronic
933936116 2:87205079-87205101 ACAGGGATGCTCCGCAGGGCAGG + Intergenic
934668631 2:96192450-96192472 ACTCGGATGCTCCACAGCACTGG + Exonic
936357033 2:111760750-111760772 ACAGGGATGCTCCGCAGGGCAGG - Intergenic
941442165 2:165552070-165552092 ACTGGCCTGCTCAGCAGCCTGGG - Intronic
948596060 2:239080484-239080506 AATGGGATGCTGAGCAGCGCAGG - Intronic
948792716 2:240387561-240387583 TCTGGGCTGCTCCACTGCACTGG + Intergenic
949014777 2:241702780-241702802 AGCAGGCTGCTCGGCAGCGCTGG - Intronic
1170622082 20:18004712-18004734 CCTGGGAAGCTTCGCAGCGCAGG - Intronic
1171407025 20:24918350-24918372 CCTAGCCTGCTCCGCAGCGGCGG - Intergenic
1172601276 20:36185192-36185214 ACTGGGCTCCTACGCTGTGCAGG + Exonic
1174092179 20:48058318-48058340 ACTTGGCTGCTGAGCAGGGCTGG + Intergenic
1174109313 20:48187179-48187201 CCTGGGCTGCACTGCAGCCCGGG + Intergenic
1174185609 20:48703832-48703854 GCTGGGCTTCTCAGCAGGGCTGG - Intronic
1174402232 20:50282285-50282307 ACTGCAGTGCTCAGCAGCGCCGG - Intergenic
1175286235 20:57838790-57838812 ACTGGGCCGCTCTCCAGCCCAGG + Intergenic
1179600811 21:42476209-42476231 ACTGGGCTGCTCCCCTGGCCAGG - Intronic
1179873251 21:44254395-44254417 ACTGTGATGCCCCGCAGCGGAGG - Intronic
1179909505 21:44440609-44440631 ATTGGGCTGCTCCGCCTTGCAGG + Intronic
1180014625 21:45074334-45074356 GCTGGGCGGCTCCGGAGCGTGGG - Intronic
1180152687 21:45959729-45959751 ACTGGGATGCTCCACAGCAATGG + Intergenic
1183532916 22:38373845-38373867 ACTGGGCTGTTTCGCAGGGTAGG + Intronic
953031491 3:39182865-39182887 ACTGGGCTGCTCTCCAGCTCTGG + Intergenic
954385087 3:50239878-50239900 CAGGGGCTGCTCCGCAGCCCTGG + Intronic
954750855 3:52812841-52812863 ACAGGCCTGCTCCTCAGCACAGG + Intergenic
961406521 3:126683582-126683604 TCTGGGCTGCTCCAGAGCTCAGG + Intergenic
962740821 3:138361608-138361630 ACTGTTCTGCTCCGCTGCTCAGG - Intronic
964523044 3:157587455-157587477 ACAGGGATGCTCCACAGGGCAGG + Intronic
966592113 3:181695351-181695373 CGTGGGCTGCTCCGAGGCGCAGG - Intergenic
968817279 4:2828635-2828657 ACTGGGCTGCAGCTCAGGGCTGG - Intronic
968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG + Exonic
974949992 4:68576123-68576145 ACAGGGATGCTCCACAGGGCAGG + Intronic
975116762 4:70688692-70688714 ACTTAGCTGCTCCGCGCCGCCGG - Exonic
976475212 4:85475388-85475410 ACTGGGCTGCTCCGCAGCGCGGG - Exonic
977043941 4:92045967-92045989 ACAGGGATGCTCCACAGGGCAGG + Intergenic
986787229 5:11125521-11125543 ACAGGGCAGCTGCTCAGCGCCGG + Intronic
993320108 5:86460664-86460686 ACAGGGATGCTCTGCAGGGCAGG - Intergenic
998114581 5:139526417-139526439 ACAGGGATGCTCCACAGGGCAGG - Intronic
1003415649 6:5905618-5905640 ACTGCTCTGCGCCGCAGCACTGG + Intergenic
1003646126 6:7914179-7914201 CCTGGGCTTCTCAGCAGCGTTGG + Intronic
1004541132 6:16551202-16551224 ACTGGCCTCCTTCACAGCGCTGG - Intronic
1012939519 6:105402671-105402693 GCGGGGCTCCTCTGCAGCGCTGG - Intronic
1013163808 6:107571450-107571472 ACTGGGCTTCTCCTCAGCCAAGG - Intronic
1017206059 6:151805576-151805598 GCTGGGCTACTGCACAGCGCTGG - Intronic
1019777513 7:2921402-2921424 GCTGTGCTGCTGCGCAGCTCCGG + Intronic
1020003476 7:4768846-4768868 ACTGGGCTGTTTCTCAGGGCAGG - Exonic
1027053795 7:75036448-75036470 CCTTGGCTGCTCTGCAGGGCAGG + Intronic
1029666139 7:101996421-101996443 ACAGGGCTGCACAGCAGGGCCGG - Intronic
1031219433 7:118945885-118945907 GCTGGGTAGCTCCGCAGCCCGGG - Intergenic
1033892106 7:146025955-146025977 ACTAGGCTGCTCAGCATGGCTGG + Intergenic
1034283505 7:149869437-149869459 ACTGGGCCGCTCCTCTGAGCTGG - Intergenic
1034480968 7:151320415-151320437 ACTGCGCTGCTCCCCTGCTCAGG - Intergenic
1034490065 7:151388440-151388462 AGAGGGCTGCCCTGCAGCGCAGG + Intronic
1034540876 7:151757121-151757143 AGTGGGGTGCTCCTCAGCCCCGG + Intronic
1035448083 7:158956655-158956677 ACAGGGCTGCTCCACAGATCTGG - Intronic
1035794813 8:2345378-2345400 GCTGGGATGCTCCACACCGCTGG - Intergenic
1037003842 8:13752231-13752253 AATGGGCTGCCCAGCAGCGAAGG - Intergenic
1038244006 8:25837317-25837339 ACTGAGCTGGGCCGCAGAGCTGG + Intergenic
1038947437 8:32376617-32376639 ACAGGCCTGCTCCTCAGGGCAGG - Intronic
1039493571 8:37965295-37965317 GCTGGGCTGCTCCGGGCCGCAGG + Exonic
1047751603 8:127885134-127885156 CCTGGGCTGCTTCCCAGGGCTGG + Intergenic
1049171885 8:141166754-141166776 ACTGGGCTCCTTCACAGCTCCGG - Intronic
1052358593 9:27529752-27529774 AGGGGGCTGCTCCGGAGCGACGG - Exonic
1056296319 9:85196556-85196578 ACTTGGCTGCTCCGAGGAGCAGG - Intergenic
1058910381 9:109515396-109515418 ACTGGGCTACTGCTGAGCGCAGG + Intergenic
1061191648 9:129085848-129085870 AGTGGGCTCCTCCGGAACGCTGG - Intronic
1190315600 X:49148557-49148579 GCAGGGATGCTCCGCAGGGCAGG + Intergenic
1190426479 X:50338165-50338187 ACAGGGATGCTCCACAGGGCAGG + Intronic
1200746857 Y:6910852-6910874 ACGCGGCTGCTCCGGTGCGCCGG + Exonic
1201372722 Y:13282838-13282860 GCAGGGATGCTCCGCAGGGCAGG - Intronic