ID: 976478719

View in Genome Browser
Species Human (GRCh38)
Location 4:85514143-85514165
Sequence TAGAATAGAAAGATGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 365}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976478719_976478722 -5 Left 976478719 4:85514143-85514165 CCAGACTCCATCTTTCTATTCTA 0: 1
1: 0
2: 1
3: 34
4: 365
Right 976478722 4:85514161-85514183 TTCTAAGGATTATTCACCTAAGG 0: 2
1: 0
2: 0
3: 14
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976478719 Original CRISPR TAGAATAGAAAGATGGAGTC TGG (reversed) Intronic
900489698 1:2941645-2941667 TACAATTGGAAGATGGATTCGGG - Intergenic
900679393 1:3908040-3908062 TTGAAAAGAAGGATGGAGCCAGG - Intergenic
901499363 1:9642069-9642091 TAGAACAGAAAGACAGTGTCAGG - Intergenic
904321820 1:29702647-29702669 TAGAGTAGAAAGATGACTTCAGG + Intergenic
905432567 1:37935201-37935223 AAAAAAAAAAAGATGGAGTCTGG + Intronic
905541245 1:38762174-38762196 TATAAGAGAAAGAGGGAGGCAGG - Intergenic
908413695 1:63891691-63891713 TAGAACAGAAAGATGGAAGATGG + Intronic
908902232 1:68968887-68968909 TAGAAAAGACAGCTGGAGTTAGG - Intergenic
909114978 1:71522175-71522197 TAAAATACAATGGTGGAGTCAGG - Intronic
909588033 1:77313023-77313045 TACAATAGAAAGAAGAAGTCTGG - Intronic
910616846 1:89207540-89207562 TAGAAGAAAAAGATGGATACTGG + Intergenic
911186114 1:94906577-94906599 TAGCAAAGATAGATGGAGCCAGG - Intronic
911764944 1:101662876-101662898 TAGAGTGGAAAGAAAGAGTCAGG + Intergenic
912167310 1:107056728-107056750 AAGAAAAGAAAGCTTGAGTCGGG + Exonic
915950154 1:160184818-160184840 TAGACCAGGAAGATGGATTCTGG - Intronic
916002315 1:160628828-160628850 TACAATAACAAGATGGAGCCAGG + Intronic
916708006 1:167373395-167373417 TACAATAGTAAGAGGGAGTTGGG + Intronic
920493362 1:206436608-206436630 AAGAATAGAAAAATGTACTCAGG - Intronic
920854344 1:209651215-209651237 TAGAGGAGGAAGCTGGAGTCTGG - Exonic
921983877 1:221287193-221287215 TAGTAAAGAAGGATGGAGCCAGG - Intergenic
923785204 1:237060091-237060113 TAAAATAGAAAAATGTAGACTGG - Intronic
923910568 1:238437535-238437557 TATATTATAAATATGGAGTCTGG + Intergenic
924359432 1:243221322-243221344 TAGAAAATAAAGATGGAGCTGGG - Intronic
924468816 1:244321586-244321608 TTAAATAGAAAGATTGAGGCCGG - Intergenic
1063154566 10:3367020-3367042 AAGAATAGAAACAGTGAGTCAGG + Intergenic
1064366769 10:14715657-14715679 TAGAACAGAAAGGTGGAGGAAGG + Intronic
1064376346 10:14799966-14799988 TAGAGGAGAAAGAAGGAGGCAGG + Intergenic
1064609626 10:17084841-17084863 CAGAATAGCAAGATGTAGCCAGG + Intronic
1069073137 10:64010712-64010734 TAGAATAGAGGGAGGGGGTCAGG - Intergenic
1069112236 10:64462306-64462328 TAGGATAGAAGAATGGAGGCAGG - Intergenic
1070500406 10:77067237-77067259 TAGAATAAAAAGGAGGAGTAAGG + Intronic
1071032712 10:81204226-81204248 CACAAGAGAAAGATGGAGGCCGG - Intergenic
1071100766 10:82034902-82034924 AAGTATAGAAAGATGGTGCCAGG - Intronic
1071384956 10:85110495-85110517 AAGAATATAAAGATGGTGTTAGG + Intergenic
1071515997 10:86298351-86298373 GAAAATAGAACCATGGAGTCTGG + Intronic
1071905288 10:90166841-90166863 TAAAATAGTAAAATGGAGTTAGG - Intergenic
1073027384 10:100497913-100497935 TAGAGTAGAAAGAGAGAGGCAGG + Intronic
1073681479 10:105708755-105708777 TAGAATTGCAAGATGCAGGCTGG - Intergenic
1073919273 10:108440563-108440585 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1074053844 10:109904278-109904300 TAGAATATCAAGCTGGAATCGGG - Intronic
1074212038 10:111344141-111344163 TAGAAGAAAAAGATGGAGGAAGG - Intergenic
1074495968 10:113980479-113980501 TAGAACAGAGAGGTGGAGACAGG - Intergenic
1075620477 10:123924168-123924190 TAGAACACACAGTTGGAGTCTGG - Intronic
1076137027 10:128052209-128052231 GAGAAAAGAAAGATGGGGTTGGG - Intronic
1077236732 11:1485520-1485542 ATGAAGAGAAAGATGGAGCCGGG + Intronic
1077942001 11:6852560-6852582 AAGAGTAGAAAGAGGGAGACTGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078936780 11:15958373-15958395 TTGAATTGAAAGCTGCAGTCTGG + Intergenic
1079158095 11:17967633-17967655 GAGAAAAGCAAGAAGGAGTCAGG + Intronic
1079570968 11:21942866-21942888 TAGAAGTGAAAGCTGGTGTCTGG + Intergenic
1079608957 11:22406596-22406618 TAGAAGAGAAAGAGGGAGGAGGG - Intergenic
1080057841 11:27925689-27925711 TAGGATAAAAAGATGGAGGAAGG + Intergenic
1080982146 11:37421249-37421271 TAGAATGTAAAGATCAAGTCAGG + Intergenic
1081153351 11:39659369-39659391 TAGAATAGAGATATGGAGGGTGG + Intergenic
1082911652 11:58383258-58383280 TAAATTAAAAAGGTGGAGTCAGG + Intergenic
1085243539 11:75078356-75078378 TAGGATAAAAAGCTGGAGTCAGG - Intergenic
1085493921 11:76949782-76949804 TTGAATAGAAAGAGGTAGGCAGG - Intronic
1085511918 11:77092678-77092700 TAGAAAATAAAAATGGAGGCTGG + Intronic
1086283757 11:85221351-85221373 TAGAAAAGAAAGTTTGAGGCCGG - Intronic
1086347231 11:85909401-85909423 TAAAATAGAAAGAGGTAGGCTGG - Intronic
1086991092 11:93304235-93304257 AAGAAAAGAAAGAAGCAGTCTGG - Intergenic
1087982403 11:104632169-104632191 TAGAAGAAAAAGGTGGAGTAAGG + Intergenic
1088378598 11:109168885-109168907 TCGAATAGAAAGGAGGAGTGGGG - Intergenic
1088884397 11:113995630-113995652 TATAAAGGAAAGATGGAGTTAGG - Intergenic
1089684942 11:120140785-120140807 GAGGATAGAAAGATGGATGCTGG + Intronic
1090030179 11:123199535-123199557 AAGAATAGAAAGATGGATGGAGG - Intergenic
1090070246 11:123538079-123538101 AAGAATAGAAAGAGGGAGACAGG - Intronic
1090357742 11:126151246-126151268 CAGAACAGAAAGATGAAGTTTGG - Intergenic
1091193218 11:133711603-133711625 TGGATTAGAAAGCTGGAGTCAGG - Intergenic
1092192078 12:6528528-6528550 TAGAGTTGAAAGCTGGAGTGGGG - Intronic
1094265476 12:28554528-28554550 TAGAGTAGAAAGAAGCAGGCAGG - Intronic
1094627050 12:32134143-32134165 TAGATTAGGAACATGGAGACTGG + Intronic
1095203585 12:39413622-39413644 TAGAATACAAAAATGTACTCAGG + Intronic
1095645700 12:44543397-44543419 TAGGAGGGAAAGATGGAATCAGG - Intronic
1096201483 12:49686698-49686720 TTGAAGAGAAATATGAAGTCTGG - Intronic
1096229993 12:49891390-49891412 TAAAATAGCAAGATAGTGTCTGG - Intronic
1096608960 12:52788636-52788658 TGGAATAGAAATGTGTAGTCAGG - Intergenic
1096730027 12:53602105-53602127 TGGAAGAGAAAAATGGAGTGGGG + Intronic
1097176757 12:57147727-57147749 TAGAATAGAAAGAAGGAAGGAGG + Intronic
1097699797 12:62808419-62808441 TAGAGTAGAAAAATGGACTATGG - Intronic
1098089102 12:66882065-66882087 GAGAAGAGAAAGATGGAGATGGG - Intergenic
1100425479 12:94481614-94481636 TAAAATAGAAATGTTGAGTCTGG + Intergenic
1100675993 12:96868713-96868735 TAGAAAAGTAAGATGGAGCCAGG + Intronic
1101169444 12:102074675-102074697 TAGACTGCAAAAATGGAGTCTGG - Intronic
1102666474 12:114578248-114578270 TAGAACAGAAAGGTGGAGGAAGG + Intergenic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1105851852 13:24342116-24342138 TAGAAGAGAAAGGCGGAGGCAGG - Intergenic
1106396823 13:29388267-29388289 GGGAAAATAAAGATGGAGTCGGG + Intronic
1107495352 13:40921167-40921189 TAGAAGAGAAAAGTGGACTCTGG - Intergenic
1109240278 13:59878110-59878132 TAGAATCTAAAGATAGAATCTGG + Intronic
1110286955 13:73760895-73760917 TAGAATATGAACATGGATTCTGG + Intronic
1111227888 13:85299037-85299059 TAGAATATAAAGATCAAGTCAGG - Intergenic
1112126462 13:96473714-96473736 TGGAATAGGAAGGTCGAGTCGGG + Intronic
1112546640 13:100377473-100377495 TAAAATAAAAAGATGGAGGCTGG - Intronic
1113146706 13:107215898-107215920 TAAAATAGAGAGATGGATTTTGG - Intronic
1113277470 13:108747793-108747815 TTGAATATAAAGATGCAGACAGG + Intronic
1114337383 14:21705172-21705194 AAGAATAAAAAGATGTAGTCTGG + Intergenic
1115040228 14:28915439-28915461 CACAAGAGAAAGATGAAGTCTGG + Intergenic
1115529074 14:34309997-34310019 TGGAGTAGAAAGATGAATTCTGG - Intronic
1115635283 14:35285055-35285077 TAGAAAATAAAACTGGAGTCAGG + Intronic
1116860446 14:49991309-49991331 TATAAAAGAAGGCTGGAGTCTGG - Intronic
1119583247 14:75806923-75806945 CAGAATAGAAAGATGACTTCTGG - Intronic
1120360612 14:83496990-83497012 TATAATCAAAAGATGGTGTCTGG + Intergenic
1120647315 14:87089460-87089482 GAGAATAAAAAGATGGATTCTGG - Intergenic
1120915967 14:89710738-89710760 AAGAGAAGAAAGATGGAGGCTGG - Intergenic
1121099624 14:91241592-91241614 GAGGATAGTAAGATGGAGACAGG - Intronic
1121304824 14:92899529-92899551 GGGAAGAGAAAGATGGAGCCGGG + Intergenic
1121352813 14:93186943-93186965 TAGAATAGAAATATGAATTCAGG - Exonic
1121626277 14:95387640-95387662 TAGCATAGAAAGATGAGGTGGGG - Intergenic
1122841075 14:104463426-104463448 TAGAACAGAAGGGTGGAGTCAGG - Intergenic
1123453212 15:20387263-20387285 TAAAATAGAAAGATAGAATCTGG - Intergenic
1123974257 15:25537873-25537895 TAGAAGAGAAATAGGGAGGCAGG - Intergenic
1124897229 15:33788520-33788542 TAAAATGGAAAGATGGTGTTGGG + Intronic
1125847122 15:42866946-42866968 TAGAAAAGAAAGATCTAGGCCGG + Intronic
1126377256 15:48008727-48008749 TAGAAGAGAAAGATCCAGTGTGG + Intergenic
1126626422 15:50689775-50689797 GAGAATAAAATGATGCAGTCTGG + Intergenic
1126697042 15:51335146-51335168 TACACTAGAAAGGTGGAGTGGGG + Intronic
1127915567 15:63452175-63452197 TGGAATAGAAGGATGGAATCGGG + Intergenic
1127941790 15:63705410-63705432 TAGAATAGAAAGAATGGGCCAGG - Intronic
1128007920 15:64262781-64262803 TTGAAGAAAAAGATGCAGTCAGG + Intronic
1130684779 15:86027372-86027394 AAGAATAGAAAGAGTGAGGCAGG - Intergenic
1131447913 15:92514730-92514752 TAGAACAGAATAATGGATTCTGG - Intergenic
1132152362 15:99471537-99471559 TAGAATAGAAAGGTGAAGGAAGG + Intergenic
1133474074 16:6102902-6102924 TAGAAGAAAGTGATGGAGTCTGG + Intronic
1134404697 16:13946154-13946176 CAGAAGTGAAAGATGGAGGCAGG - Intronic
1135043263 16:19134262-19134284 AATAATAAAAAGTTGGAGTCTGG - Intronic
1137449819 16:48561218-48561240 TAGAACAGAAACATGAAGTCTGG - Exonic
1137892174 16:52174327-52174349 AAGAATGGGAAGATGGAGTGGGG + Intergenic
1139178153 16:64714576-64714598 TAGAAGAGAAGGACGGAATCTGG - Intergenic
1139663546 16:68439133-68439155 CAGAGGAGAAAGATGAAGTCTGG + Intronic
1139688347 16:68621931-68621953 AAGAAGAGAAAGATGGAGAGAGG + Intergenic
1140145805 16:72307268-72307290 TAGAATCTAAAGATGTAGTTGGG + Intergenic
1141591489 16:85072054-85072076 TAGAATAGTAAGAAACAGTCTGG + Intronic
1141980767 16:87548710-87548732 GAAAATAGAAAGATGGAGGCCGG + Intergenic
1143206347 17:5142892-5142914 TAGAATACAAAGAAGTAGGCTGG + Intronic
1143967991 17:10770647-10770669 CAGAATGGAAAGATGGATTCGGG - Intergenic
1144333948 17:14252404-14252426 TAGAATACAAAAAAGAAGTCTGG - Intergenic
1144567172 17:16369194-16369216 TAAAAAAGAAAGATGTAGCCTGG - Intergenic
1148643345 17:49204588-49204610 CAGAATGGTGAGATGGAGTCAGG + Intronic
1149217804 17:54378122-54378144 TAGAATATAAACTTGAAGTCAGG + Intergenic
1149584595 17:57777208-57777230 TAGAAAAAAAAGAAAGAGTCCGG + Intergenic
1149873896 17:60210601-60210623 TAGAATACAAAGAAGTAGGCTGG - Intronic
1150059464 17:62052686-62052708 TAGAAGAAGAAGATGGAGTGTGG - Exonic
1150087674 17:62287862-62287884 TAGAATACAAAGAAGTAGGCTGG - Intergenic
1153571047 18:6473906-6473928 TAGAATAGAGAGCTGTGGTCAGG - Intergenic
1153809965 18:8743702-8743724 TAAAAATGAAAGAGGGAGTCAGG - Intronic
1153974167 18:10252359-10252381 GTGAATAGATAGATGGATTCTGG - Intergenic
1155185189 18:23381499-23381521 TAGAAAATACAGATGGAGGCCGG - Intronic
1155224564 18:23718244-23718266 TAGAATAGAACTCTGGAGTTTGG - Intronic
1155420888 18:25654805-25654827 TAGAATAAGAATAGGGAGTCAGG - Intergenic
1155689264 18:28597770-28597792 TAAAAAAGAAAGAGGGATTCGGG - Intergenic
1155719742 18:28996212-28996234 CAGAGTAGAAAGATGGATGCTGG + Intergenic
1155774591 18:29744387-29744409 AAGAATACAGAAATGGAGTCAGG + Intergenic
1156296827 18:35799796-35799818 TAGAACAAAAAGGTGGAGTAAGG + Intergenic
1156757956 18:40551489-40551511 TAGAATTGAGACATGGAGGCAGG - Intergenic
1157225304 18:45857676-45857698 TAGAATGTAAAGATGTAATCAGG + Intronic
1157671487 18:49532777-49532799 TAGAATAGGAAGACTGTGTCTGG - Intergenic
1160113896 18:76058990-76059012 TTGAAAAGAAAGGTGGAGTAAGG + Intergenic
1162206088 19:9057184-9057206 TAGAAGAGAGAGATGGAGCTGGG - Intergenic
1165440581 19:35824775-35824797 TTCAATAGAAAGATGGAGCCAGG + Intergenic
1168061232 19:53893335-53893357 GAGAAAAGAAAGAGAGAGTCAGG - Intronic
924960359 2:29261-29283 AAGGATAGAAACATGGAGTTGGG + Intergenic
926482090 2:13411985-13412007 TAAAATAGAAAGATAGAATCTGG + Intergenic
926726187 2:15999900-15999922 TGGAAGAGAAAGATGGAGACAGG + Intergenic
927361272 2:22236982-22237004 TTGAATAGAAAGATGGAGATGGG - Intergenic
928751660 2:34477466-34477488 TAGAATAGAAAGATAAAATTTGG + Intergenic
929288374 2:40162243-40162265 GAGAAAAGAAAGATGGATGCTGG - Intronic
930261987 2:49157683-49157705 AAGAAAAGGAAGTTGGAGTCAGG - Intergenic
930360628 2:50374001-50374023 TAGAATTGCACGATGGAGGCTGG + Intronic
931334790 2:61328550-61328572 TAGAACAGAGAGATGTTGTCTGG - Intronic
931375569 2:61704775-61704797 TATAAGAGAAAGAGGGAGGCAGG - Intergenic
932173474 2:69578245-69578267 TAGAATAGAAAGATGCCTTTAGG + Intronic
932502093 2:72191976-72191998 GAAAATAGAAATATGGAGCCTGG + Intronic
934887624 2:98038816-98038838 TAGAAAAGAAAGAAGGAGGCCGG - Intergenic
935738823 2:106128530-106128552 TAGAACACAAAGATGGAGGAAGG + Intronic
937197445 2:120172117-120172139 TAGAATAGAAAGATGAAAACTGG + Intronic
937701075 2:124863575-124863597 AAGAATAGAAAAATGTAGTTTGG - Intronic
938574898 2:132594727-132594749 CAGAATAGAAAGGTGGCTTCTGG + Intronic
939537560 2:143450848-143450870 TACAAGAAAAAGATGGAGACAGG - Intronic
940958291 2:159753813-159753835 TAGAATGGATAGATAGATTCTGG + Intronic
942497159 2:176551880-176551902 TAGAAGAAAAAGATGGAGGAAGG + Intergenic
942511983 2:176712230-176712252 TCCAATCAAAAGATGGAGTCAGG - Intergenic
942529739 2:176896916-176896938 GAGAAAAGAAAGATGGATTAAGG + Intergenic
943013199 2:182477255-182477277 TAAAAGAGAAAAATGTAGTCTGG + Intronic
944086603 2:195854956-195854978 TACTATAGAAAGAGGCAGTCTGG + Intronic
945101186 2:206263562-206263584 GAGAATAGAAAGATGTCGTGAGG + Intergenic
948590486 2:239046798-239046820 TAGAGTAGAAAGTTGGAAGCTGG - Intergenic
1169417853 20:5432967-5432989 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1170004599 20:11652075-11652097 TATAGTAGAAAGTGGGAGTCTGG - Intergenic
1170180975 20:13529780-13529802 TATCATAGAAAGCTGAAGTCTGG - Intronic
1170382969 20:15781967-15781989 TAGATTACAGAGATGAAGTCTGG + Intronic
1172988641 20:39014747-39014769 AAGAACAGAAACATGGAGGCTGG + Intronic
1173531656 20:43774269-43774291 TGGGATAGAGAGATGGAGGCAGG + Intergenic
1174756821 20:53167131-53167153 TGGAAAAGAAAGATGGTGGCTGG + Intronic
1174847472 20:53956921-53956943 CAGAATAAAGACATGGAGTCGGG - Intronic
1177064196 21:16409419-16409441 TGGAATAGAAAGAGGGTGTTGGG - Intergenic
1177236674 21:18399490-18399512 TAGAATACAAAGAAGGACTGAGG + Intronic
1177394891 21:20521033-20521055 CAGAAAAGAAAGATGAAATCAGG - Intergenic
1177738480 21:25122555-25122577 AAGAATAAAATAATGGAGTCAGG + Intergenic
1177798747 21:25806706-25806728 TAGAATAAAAAGGTGGAGGAAGG + Intergenic
1178030916 21:28524896-28524918 TTTAATAGAAAGAAGGAGTTTGG - Intergenic
1178057906 21:28819841-28819863 TAGAAAATAAAGGTGGAGCCAGG - Intergenic
1178167503 21:29996679-29996701 CAGAGGAGAAAGATGTAGTCTGG - Intergenic
1178317268 21:31577098-31577120 TAAAGGAGAAAGATGGAGACTGG + Intergenic
1179666241 21:42914570-42914592 TAAAATAGAAACTTGGAGGCCGG + Intergenic
1180558619 22:16597687-16597709 TAGAAAATAAACATGGAGGCCGG - Intergenic
1182230915 22:28836950-28836972 AAGAAAATAAAGATGGAGTTGGG - Intergenic
1183754350 22:39746201-39746223 TAAAGCAGAAAGATGGAGGCGGG - Intronic
1184197444 22:42939649-42939671 CACAATGGAAGGATGGAGTCAGG + Intronic
1184269939 22:43374332-43374354 TAGAACAGAAAGGTGGAGGAAGG - Intergenic
1184841569 22:47055256-47055278 TATAGGAGAACGATGGAGTCAGG + Intronic
1185114459 22:48923692-48923714 TAGAATGGAAAGGTGGAGGGAGG + Intergenic
949171787 3:1008482-1008504 TAGCATAGAAAGATGGTAGCAGG - Intergenic
949853039 3:8438112-8438134 GAGAATAGAAAGTTGTAGTATGG - Intergenic
951194397 3:19807555-19807577 GAGAAGAGAAAGAGGGAGTAGGG + Intergenic
951488744 3:23244928-23244950 TAGAATAAAAATTTGCAGTCGGG + Intronic
951987797 3:28640300-28640322 TAAAATAAAAAGATGGAGAAGGG - Intergenic
953414917 3:42710057-42710079 TAAAGTATAAAGATGGAGACAGG - Intronic
954330020 3:49884838-49884860 TAGGAGAGAAAGAGGGTGTCAGG - Intergenic
957268223 3:77995167-77995189 AAGAATGCAAGGATGGAGTCAGG + Intergenic
957528551 3:81410177-81410199 GAGAATAGAAACATGAGGTCTGG + Intergenic
957546177 3:81640362-81640384 TACAGGAGAAAGATGGAGGCTGG - Intronic
957661325 3:83157411-83157433 TAGAATATAAATCTGGAGGCTGG + Intergenic
957938968 3:86980242-86980264 TACATTAGAAATATAGAGTCTGG - Intronic
960204423 3:114877985-114878007 TAAAAGAGAAAGAGGGAGCCTGG - Intronic
960883165 3:122366641-122366663 TAAAATACAAACATGAAGTCAGG + Intronic
962479997 3:135789660-135789682 TTGAAGTGAAAGATGGGGTCAGG - Intergenic
963232659 3:142924623-142924645 TAGAATTGAAAAATGTAGGCTGG - Intergenic
964333841 3:155633953-155633975 TTAAAAAAAAAGATGGAGTCAGG - Intronic
964528986 3:157646578-157646600 CAGAATAGAAAGGTGGAGTGAGG + Intronic
966639469 3:182173636-182173658 TAGAAAAAAAAGCTGGATTCTGG + Intergenic
967612842 3:191528244-191528266 TAGAACAGAAAGATGGAGGAAGG + Intergenic
967875617 3:194266534-194266556 TAGAAGATAAAGATGGAGGGAGG + Intergenic
969226563 4:5802340-5802362 TAGGATACTGAGATGGAGTCAGG + Intronic
971176189 4:24284730-24284752 TAGAAAAGAAAGAAGAAGCCCGG + Intergenic
971638729 4:29100636-29100658 TTGGTTAGAAAGATGGAGGCAGG - Intergenic
973610428 4:52631392-52631414 TAGAAAAGAAAGTTTGAGACAGG + Intronic
975261273 4:72302540-72302562 AAGAAGAGAAAGATGGGGTGGGG + Intronic
975598644 4:76075878-76075900 TAGAAGAGAAAAATGAAGACGGG + Exonic
976478719 4:85514143-85514165 TAGAATAGAAAGATGGAGTCTGG - Intronic
976478829 4:85515107-85515129 TAGAATAGAAAGCTGGAGGCTGG + Intronic
976759442 4:88532460-88532482 TAGAATAAAAAGGTGGAGGAAGG - Intronic
976907358 4:90256241-90256263 TGTAATAGAAAGAATGAGTCAGG - Intronic
977255020 4:94731139-94731161 TAGAGTATAAAGAAGGAGTATGG + Intergenic
977463189 4:97351384-97351406 TACAACAGAAAGATGGAGAAAGG - Intronic
977697516 4:99982504-99982526 TAGAAACAAAAGTTGGAGTCTGG - Intergenic
979211721 4:118112781-118112803 AAAAATAGGAAGATGGATTCAGG - Intronic
979810171 4:125027047-125027069 CACAAAAGAAAGATGGAGGCCGG - Intergenic
980217219 4:129868006-129868028 TACAGGAGAAAGATGAAGTCTGG - Intergenic
980807622 4:137833811-137833833 TAGAATAAAAAGGTGGAGAAAGG - Intergenic
980874087 4:138643209-138643231 TTGATTAGAAACATGGAGTAAGG + Intergenic
982962016 4:161851240-161851262 TAAAAGAGAAAGATGGTGTCAGG - Intronic
984364206 4:178777324-178777346 GAGATTTGAAAGATGGAGGCTGG + Intergenic
984369578 4:178845583-178845605 TAACATAAAAAGATGGAGTTTGG + Intergenic
984535487 4:180969685-180969707 GAGAATAGATAGAAGGAGTAAGG + Intergenic
985115515 4:186586247-186586269 GAGAACAAAAAAATGGAGTCTGG + Intergenic
987340247 5:16933610-16933632 TAGAATAGAAACAGCGAGTGTGG - Intronic
987580186 5:19780353-19780375 AAGAATGGAAAAATGGTGTCAGG - Intronic
987581152 5:19794341-19794363 TAGAAGAAAAAGATGGAGAAAGG + Intronic
987915626 5:24209191-24209213 TTGAATGGAAAGATAGAGTAAGG - Intergenic
988008022 5:25444958-25444980 TAGAATGGAGAGATTTAGTCAGG - Intergenic
988151379 5:27386228-27386250 TAGAAAAGAAAGATACAGCCTGG - Intergenic
988942693 5:36162067-36162089 TAGAACAGAAAGGTGGATGCAGG - Intronic
989005707 5:36809853-36809875 TAGAACTGAAAGATGGAGAGAGG - Intergenic
989550304 5:42727078-42727100 TAGAAGGGAAAAATGCAGTCTGG - Intergenic
990054910 5:51561758-51561780 TAGAATAGAAAGATAGAAAATGG - Intergenic
991921570 5:71662750-71662772 TAGCAGAGAAAGAGGGAATCTGG - Intergenic
992322353 5:75626177-75626199 TAGAATGGGAAGAAGGAATCTGG - Intronic
992657945 5:78929103-78929125 CAGAACAGAAAGATGAAGTCTGG - Intronic
992948375 5:81832237-81832259 TAGAACAAAAAGATGGAGCAAGG - Intergenic
993074141 5:83205999-83206021 TAAAGTAGAAAGATGAAGACTGG + Intronic
993820764 5:92613510-92613532 TAGAATAAAAAGAATGAGTGGGG + Intergenic
994787395 5:104181848-104181870 TAGAAAAGAAAGCTAGGGTCTGG + Intergenic
996314548 5:122147265-122147287 TAAACAAGAAAGATGGAGTTGGG - Intronic
996736884 5:126766432-126766454 GAGAATAGAAAAATGGATTGTGG - Intergenic
998145210 5:139723879-139723901 AAGAATATCAACATGGAGTCTGG - Intergenic
999023774 5:148201573-148201595 TAGAATGGAAAGAGGGAGGAAGG + Intergenic
999633882 5:153600088-153600110 TGTAATAGAAGTATGGAGTCTGG + Intronic
999659096 5:153840177-153840199 GAGAATAGAAAGAAATAGTCAGG - Intergenic
1000518129 5:162265548-162265570 TGGAAAAGAGAGATGGAGGCAGG - Intergenic
1001180584 5:169516344-169516366 CAGAATAGTAAGATGGGGTCAGG + Intergenic
1001466478 5:171971449-171971471 TAGGACAAAAAGATGAAGTCAGG - Intronic
1002320381 5:178371937-178371959 TAGAAAAGAAAAATTGAGCCTGG + Intronic
1003519543 6:6846715-6846737 TAGGATGGGAAGATGGAGTGAGG + Intergenic
1004009794 6:11672901-11672923 TAGAAAAGCAAGATGAATTCTGG - Intergenic
1004460634 6:15832410-15832432 AAGAATAGAAAGTTGTAGCCGGG + Intergenic
1006736625 6:36278092-36278114 TGGAAAAGAGAGATGGAGTGGGG - Intronic
1006974912 6:38090751-38090773 AAGAATAGAATGAAGGAGTGAGG + Intronic
1007913668 6:45540443-45540465 TAGAATAGAATGCTGGAGCTAGG + Intronic
1008053906 6:46927076-46927098 TAGCATAGAATGATGGAATTTGG - Intronic
1008078080 6:47166827-47166849 TATAATAGAAAGAGGGACTTTGG - Intergenic
1008078352 6:47169398-47169420 TAGAACAAAAAGATGGAGTAAGG - Intergenic
1009372211 6:62919646-62919668 GAGAATAGAAAGAATGAGGCAGG - Intergenic
1009768808 6:68118796-68118818 GAAAAAAGAAAGATGGGGTCAGG + Intergenic
1010017895 6:71125469-71125491 GAGAAAAGAAAAATGGAATCAGG - Intergenic
1010095058 6:72033143-72033165 AAGAATACAAAGATGAATTCTGG - Intronic
1012414397 6:98997201-98997223 TAGAATATAATGATGGAGACAGG - Intergenic
1012627887 6:101426687-101426709 TAGATTAGAAAGAGAGAGGCAGG - Intronic
1014196341 6:118563935-118563957 TGGAGTAGAAAGATGAATTCAGG - Intronic
1014890857 6:126844090-126844112 TAGCATATAAATTTGGAGTCAGG - Intergenic
1015294175 6:131571655-131571677 TAACATACAAAGATGGATTCAGG + Intergenic
1015752349 6:136573205-136573227 TAGAACAAAAAGATGGAGAAAGG + Intronic
1015994561 6:138984909-138984931 TAGAATAGAAAGGGAGAGACTGG - Intronic
1016619435 6:146091030-146091052 CAGAATAGAAAGACTGAGTGTGG - Intronic
1016635081 6:146279071-146279093 CACAATAGAAAAATGGACTCAGG - Intronic
1016942640 6:149495876-149495898 TAGAATATATAAATGGAGACTGG + Intergenic
1018497647 6:164366371-164366393 TAGAATGGAAAGAAGGTGGCCGG + Intergenic
1018698374 6:166407955-166407977 TAGAATTGGAAGAGGGAGGCAGG + Intergenic
1018724285 6:166598833-166598855 TGGAATACAAGGATGGAGGCAGG - Intronic
1018923888 6:168193724-168193746 TTGAAGAGAAAGGTGGAGTTGGG + Intergenic
1019287267 7:229971-229993 TGGGATAGAAAGATGGGGTAGGG + Intronic
1020527309 7:9278485-9278507 TTGAACAAAAAAATGGAGTCAGG + Intergenic
1024769166 7:52698083-52698105 TAAAATAAAAAGAGGAAGTCAGG - Intergenic
1026857970 7:73767594-73767616 TAGAAAAGAAGGCTGGAATCTGG - Intergenic
1027694586 7:81393850-81393872 TCCAATAGATAGATGGATTCAGG + Intergenic
1028302733 7:89221679-89221701 TAGAATAGAAATATTGAGGAAGG - Intronic
1028977463 7:96930016-96930038 TAGAATAAATAGAGGGAGACAGG - Intergenic
1029025672 7:97414489-97414511 TAGAATAGAAAATTAGAGACTGG - Intergenic
1029123904 7:98284752-98284774 TAGAAAGGGAAGATGGAGTCAGG - Intronic
1029586328 7:101474156-101474178 CAGATGAGAAAGATGGGGTCAGG + Intronic
1032655229 7:133921256-133921278 TAGAACAGAAAGGTGGAGATGGG - Intronic
1032670417 7:134077292-134077314 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1033864168 7:145668228-145668250 TAGTATAGACAGCTGGAGACAGG + Intergenic
1034520966 7:151619465-151619487 TAGCATAGAAATACAGAGTCAGG + Intronic
1034618693 7:152440323-152440345 TAGAAAATAAACATGGAGGCCGG + Intergenic
1034633688 7:152550630-152550652 CAGAAAAGAAACATGGGGTCTGG + Intergenic
1036141538 8:6213496-6213518 TAGAAATGAAAGAAGGAGCCAGG + Intergenic
1036526203 8:9537162-9537184 TAGAACAAAAAGATGGAGGAAGG + Intergenic
1037900457 8:22685192-22685214 AAGAATAGCAAGGTGGATTCTGG - Intergenic
1040279593 8:46032294-46032316 TAGAAACGAAAGAAGGAGGCTGG + Intergenic
1040614512 8:49020778-49020800 TACAGGAGAAAGATGGAGGCTGG + Intergenic
1041119041 8:54568027-54568049 CAGAATGGAAAAATAGAGTCTGG - Intergenic
1041740493 8:61152005-61152027 TAGAAAAGAAAGCTGGGGGCGGG - Intronic
1042048765 8:64684719-64684741 TAGAAGAGAAAAATGAAGGCAGG - Intronic
1043079075 8:75742102-75742124 TAGAAAAGTAAGAAGGGGTCAGG - Intergenic
1043266268 8:78270882-78270904 TAGAAGGGAAATATGGGGTCAGG - Intergenic
1043452518 8:80382316-80382338 TAGAATATAATGATGGTGTGAGG - Intergenic
1043798998 8:84583000-84583022 GTGTATAGATAGATGGAGTCAGG - Intronic
1044740180 8:95318418-95318440 TAGAACAGAAAGGTGGAGAGTGG + Intergenic
1045164092 8:99583380-99583402 TAGTATAGAAAAATGTTGTCTGG + Intronic
1046012790 8:108570874-108570896 TAGAACAAAAAGATGGAGGAAGG - Intergenic
1046564067 8:115876175-115876197 GATAATAGAAACATGTAGTCTGG - Intergenic
1047017062 8:120734990-120735012 TAAAATAGGAAGAATGAGTCAGG + Intronic
1047225704 8:122953928-122953950 TAGATCAGATAGCTGGAGTCAGG + Exonic
1048083691 8:131155692-131155714 AAGAAGAAAAAGATGAAGTCCGG + Intergenic
1048694117 8:137004990-137005012 GACAATGGAAAGATGGACTCAGG + Intergenic
1050353835 9:4764550-4764572 TAAAAAATAGAGATGGAGTCAGG + Intergenic
1050745066 9:8866613-8866635 TAGAATGGAAAAATGGGCTCAGG - Intronic
1051461371 9:17320379-17320401 AAAAAAAGAAAGATGGAATCAGG - Intronic
1052356998 9:27515171-27515193 TAAAAAAGCAAGATGAAGTCGGG - Intronic
1052430235 9:28356901-28356923 TAGAACAGAAATATGGGGTAGGG + Intronic
1052436676 9:28438346-28438368 TAGAATAGAAAGGTAGAGGAAGG + Intronic
1052645997 9:31233861-31233883 TATAAGAGAAAGATGTAGGCTGG + Intergenic
1052730714 9:32281982-32282004 TGGAAGAGAAAACTGGAGTCAGG + Intergenic
1052968763 9:34363588-34363610 TAGAAAAGAAAGAACGAGTTGGG - Intergenic
1053100892 9:35371473-35371495 TACATTAGAAAGGAGGAGTCGGG - Intronic
1055300028 9:74873090-74873112 TAGAATGTAGAGATGGAGGCAGG - Intronic
1055902055 9:81251569-81251591 TAGAATATAAATTTGGAGTCAGG + Intergenic
1056196026 9:84229325-84229347 TAGCAAAGGAAGTTGGAGTCAGG - Intergenic
1056240746 9:84644099-84644121 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG + Intergenic
1056825869 9:89875953-89875975 TAAAAAAGAAAGAAGGAGGCTGG + Intergenic
1057686491 9:97238977-97238999 TAGAAGAGAAAAGTGGACTCTGG + Intergenic
1059560486 9:115329950-115329972 TTGAATAAAATGATGGAGTTAGG - Intronic
1060016753 9:120093293-120093315 TAGAATAAAAAGATGGGTTGAGG - Intergenic
1186343896 X:8671050-8671072 GAGAATGGAAAGCGGGAGTCTGG - Intronic
1186360047 X:8831472-8831494 TACAATAAAAATATGGAGTCAGG + Intergenic
1187796902 X:23013738-23013760 TAGAAGAGGAATATGGAGACAGG + Intergenic
1188310093 X:28605768-28605790 TAGAAAAGAGAGAATGAGTCGGG - Intronic
1188974800 X:36660354-36660376 GAGAATAGAAGGATGGTGACCGG + Intergenic
1189095530 X:38134677-38134699 TTGAATAGATAGATGGGGTGAGG + Intronic
1189198112 X:39168499-39168521 CAGAAGAGAAAGGTGGAGTTAGG + Intergenic
1189242616 X:39537373-39537395 TAGAACAGAAAAATGGAGAAAGG + Intergenic
1189742046 X:44129215-44129237 TAGAAGAGAAAGTTTGGGTCGGG + Intergenic
1189757822 X:44289653-44289675 AAGAAAAGAAAGATGTAGACCGG - Intronic
1189804026 X:44717737-44717759 TAGAACAAAAAGATGGAGGAAGG - Intergenic
1190616914 X:52243276-52243298 TATAATAGAAATATGCAGTTTGG - Intergenic
1192625802 X:72727064-72727086 TAGAATAGAAAGATGCTACCTGG + Intergenic
1193568524 X:83111303-83111325 CACAAGAGAAAGATGGAGGCCGG + Intergenic
1193741197 X:85219749-85219771 AAGAAAGGAAAGAAGGAGTCAGG - Intergenic
1194626871 X:96235568-96235590 TAGAACAAAAAGATGGAGGAAGG + Intergenic
1194886861 X:99326434-99326456 GTGAAAAGCAAGATGGAGTCAGG + Intergenic
1195056540 X:101151532-101151554 TAGAATAGTATGATGAAGCCAGG + Intronic
1195623922 X:106988213-106988235 TATAAGAGAAAGTTGAAGTCCGG - Intronic
1195874031 X:109519336-109519358 TAGAGTAGAAGGATGGTTTCCGG + Intergenic
1196046636 X:111262715-111262737 AACAATAGGATGATGGAGTCTGG - Intronic
1196715408 X:118806296-118806318 CAGTATTGAAACATGGAGTCTGG + Intergenic
1197259914 X:124306671-124306693 CAGGATAGAAAGTTAGAGTCGGG + Intronic
1197687076 X:129451997-129452019 GAGAATAAAAAAATGGAGGCTGG - Intronic
1197691285 X:129503666-129503688 AAGAATAGAAAGTTGGGGCCAGG + Intronic
1198174859 X:134145204-134145226 AAGAATGGAAAGTTGTAGTCAGG - Intergenic
1198670500 X:139075219-139075241 CAGAATGGGAAGATAGAGTCTGG - Intronic
1199245011 X:145593710-145593732 TAGCATAGAAAGTTTGAGTTGGG - Intergenic
1200085482 X:153602296-153602318 TTGAATAGAAAGATGAAGGGTGG - Intergenic
1200704149 Y:6427258-6427280 TAGAATAGATTGATGATGTCTGG - Intergenic
1200814518 Y:7517751-7517773 TACCATAGAAAGATGGAGGCTGG + Intergenic
1201029962 Y:9737450-9737472 TAGAATAGATTGATGATGTCTGG + Intergenic
1201423736 Y:13827401-13827423 GAGAATGGAAAGCGGGAGTCTGG + Intergenic
1201558767 Y:15292610-15292632 GAAAATAGAAAAATGGAATCTGG + Intergenic
1201730710 Y:17199776-17199798 TAGAATAAAAAGGTGGAGAAAGG + Intergenic
1202112929 Y:21443401-21443423 TAGAAAAGACAGATGGATACTGG + Intergenic