ID: 976479144

View in Genome Browser
Species Human (GRCh38)
Location 4:85519233-85519255
Sequence CTACTAATGTGTGGCACCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976479144_976479147 -4 Left 976479144 4:85519233-85519255 CCTTTGGTGCCACACATTAGTAG 0: 1
1: 0
2: 0
3: 6
4: 55
Right 976479147 4:85519252-85519274 GTAGGTGCTGAATGTCATCCAGG 0: 1
1: 0
2: 0
3: 13
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976479144 Original CRISPR CTACTAATGTGTGGCACCAA AGG (reversed) Intronic
904715081 1:32461661-32461683 CTGCTGAAGTGTGGCAGCAAAGG + Intergenic
910735510 1:90450396-90450418 CTACTAAAGTGTGACTCCAATGG - Intergenic
915004783 1:152625903-152625925 CTACTGACCTGTGGCAGCAACGG + Intergenic
915521740 1:156449307-156449329 CTATTAATGGGAGGCAGCAATGG + Intergenic
923378488 1:233390893-233390915 CTTCTAAGGTGTGACACCAAAGG - Intergenic
923492249 1:234494261-234494283 CTACTAATATGAGGTACCTAGGG - Intergenic
1063687118 10:8247423-8247445 TTGCTTATGTGTGGCACAAATGG - Intergenic
1067764662 10:49075829-49075851 CTTCTGGTGGGTGGCACCAAGGG + Intronic
1083600683 11:63945696-63945718 CTCCAAATGTGTGGCAGCAGAGG + Intronic
1087813753 11:102635870-102635892 CTCCTGATGTGAGGTACCAAAGG - Intergenic
1095396835 12:41771622-41771644 CTGCTAATGAGAGGCACCAGAGG + Intergenic
1108394277 13:49978130-49978152 CTACAAATGGGAGGCACCCAGGG - Intergenic
1109035585 13:57256102-57256124 CTCCTTATGTGTTGCACAAAAGG - Intergenic
1115185473 14:30683460-30683482 CTCATAATGTGTGGCAGCAAGGG - Intronic
1123634065 15:22285701-22285723 CTACTAATGTGTATCATAAAGGG - Intergenic
1125792945 15:42383447-42383469 CTACAGATGTGTGCCACCATGGG - Intronic
1131836774 15:96398796-96398818 TTAATAAAGTGTGGCACCAAGGG - Intergenic
1138309770 16:56013413-56013435 TTACTGATGTTTGGCATCAAAGG + Intergenic
1143103351 17:4515784-4515806 CTGCTTATTTGTGGCACCAGGGG + Intronic
1149473135 17:56935729-56935751 CTGCTAGTGAGTGGCACCACTGG + Intergenic
1155899697 18:31373732-31373754 CAACTTATGTATGGCAACAAGGG - Intergenic
1159716606 18:71831671-71831693 TTAATAATCTGTGGCCCCAAAGG - Intergenic
1166277868 19:41767659-41767681 CTACTAATGTGTAGCCACGATGG + Intronic
926199673 2:10785590-10785612 CTAACAATCTATGGCACCAATGG + Intronic
932569090 2:72928364-72928386 CTGCCCATGTGGGGCACCAACGG + Intronic
935264083 2:101380172-101380194 ATACAATTGTTTGGCACCAAAGG + Intronic
935265796 2:101392775-101392797 CTATTAGTGAGTAGCACCAAAGG - Intergenic
935413294 2:102788304-102788326 GTTCTGATGTGTGGCAGCAATGG + Intronic
935953822 2:108354841-108354863 CTCCCAATTTCTGGCACCAATGG + Intergenic
943185093 2:184597961-184597983 CTACAAATGTGTGGGAGCAGGGG + Intergenic
946281389 2:218668210-218668232 CCCCTACTGTGTGGCAGCAAAGG - Intronic
1170722062 20:18890318-18890340 CTACTGTAGTGTGGCAGCAATGG - Intergenic
959871178 3:111330240-111330262 ATCCTAATGTCTGCCACCAAAGG + Intronic
960723609 3:120648659-120648681 CTACTAATGGGTGGTCCTAATGG + Intronic
961020801 3:123505185-123505207 CTACTCATATGTGGTACCTAGGG + Intronic
968752622 4:2398126-2398148 ATACAAGTGTGAGGCACCAAGGG + Intronic
976136964 4:81948119-81948141 TCACTAATGTCTTGCACCAAGGG - Intronic
976231555 4:82849142-82849164 CTACTCAAGACTGGCACCAAAGG + Intronic
976479144 4:85519233-85519255 CTACTAATGTGTGGCACCAAAGG - Intronic
977853963 4:101865263-101865285 CTACTAGTTTGTGGCTCCAGTGG - Intronic
983445497 4:167845463-167845485 TTACTAAAGTGTGACTCCAATGG - Intergenic
985407964 4:189655050-189655072 CTGCTTATGTGTGGCAACACAGG - Intergenic
992137365 5:73760912-73760934 CTACTTTTGTCTGGCAACAATGG + Intronic
992892149 5:81213397-81213419 CTTCTATTCTCTGGCACCAATGG - Intronic
995900295 5:117058072-117058094 ATACTAATGTATTGCACAAAGGG - Intergenic
1004697576 6:18048179-18048201 CTATCAATGTGTGGCTCCAGTGG - Intergenic
1007165180 6:39824111-39824133 TTACTAATGTGTAGCACAGAAGG - Intronic
1008131261 6:47722054-47722076 CCAAGAATGTGTGGTACCAACGG - Intergenic
1030772401 7:113490614-113490636 CTACTAATGTGGGGGAGAAAAGG - Intergenic
1040635760 8:49270907-49270929 CTATTCCTGTGTGGCACCACAGG - Intergenic
1041316650 8:56570345-56570367 CTACTCAAGTGTGACATCAAGGG - Intergenic
1049992937 9:1006945-1006967 CAACTAATATGTGGAAGCAATGG - Intergenic
1051617095 9:19016671-19016693 TTTCTAATCTGTGGCACCAATGG - Intronic
1055324027 9:75109974-75109996 CTACACATGTGTGGCAGCAGGGG - Intronic
1062505431 9:136872379-136872401 CTACAAGTGTGTGCCACCATGGG - Intronic
1189055655 X:37697076-37697098 CTAGGAATGTTTGCCACCAATGG + Intronic
1189612995 X:42756384-42756406 AGACCAATGTGTGGCACCAAAGG + Intergenic
1189800392 X:44686569-44686591 CTCTTAATGTGTGGCACGCACGG - Intergenic
1194594943 X:95846422-95846444 ATACAAAAGAGTGGCACCAAAGG - Intergenic
1198632539 X:138656782-138656804 CTACTAAAGTGTGAAACAAATGG + Intronic
1202305443 Y:23465369-23465391 CTACTAATGTGTATCATAAAGGG - Intergenic
1202565366 Y:26205220-26205242 CTACTAATGTGTATCATAAAGGG + Intergenic