ID: 976481518

View in Genome Browser
Species Human (GRCh38)
Location 4:85552130-85552152
Sequence ATCTTTCAGACTTTTCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1564
Summary {0: 1, 1: 0, 2: 4, 3: 116, 4: 1443}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976481516_976481518 10 Left 976481516 4:85552097-85552119 CCCTAGGTGATGATGTTAGGTTG 0: 1
1: 0
2: 2
3: 16
4: 254
Right 976481518 4:85552130-85552152 ATCTTTCAGACTTTTCCATGTGG 0: 1
1: 0
2: 4
3: 116
4: 1443
976481515_976481518 11 Left 976481515 4:85552096-85552118 CCCCTAGGTGATGATGTTAGGTT 0: 1
1: 0
2: 1
3: 15
4: 205
Right 976481518 4:85552130-85552152 ATCTTTCAGACTTTTCCATGTGG 0: 1
1: 0
2: 4
3: 116
4: 1443
976481517_976481518 9 Left 976481517 4:85552098-85552120 CCTAGGTGATGATGTTAGGTTGT 0: 1
1: 0
2: 5
3: 102
4: 575
Right 976481518 4:85552130-85552152 ATCTTTCAGACTTTTCCATGTGG 0: 1
1: 0
2: 4
3: 116
4: 1443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976481518 Original CRISPR ATCTTTCAGACTTTTCCATG TGG Intronic
900201613 1:1410154-1410176 ATATTTCAGACTATCACATGGGG - Intergenic
900234425 1:1580690-1580712 ATATTTCAGACTATCACATGGGG - Intergenic
900699600 1:4036995-4037017 CTCTTTCAGACTTTTCGATGTGG - Intergenic
900907974 1:5574230-5574252 ATATTTCAGACTATCACATGGGG + Intergenic
901601573 1:10427010-10427032 ATATTTCAGACTATCACATGGGG - Intergenic
901955928 1:12785573-12785595 ATATTTCAGACTATCACATGAGG + Intergenic
901978354 1:13013075-13013097 ATATTTCAGACTATCACATGGGG + Intronic
901979302 1:13021626-13021648 ATATTTCAGACTATCACATGGGG + Intronic
902002780 1:13207312-13207334 ATATTTCAGACTATCACATGGGG - Intergenic
902003730 1:13215863-13215885 ATATTTCAGACTATCACATGGGG - Intergenic
902022011 1:13353076-13353098 ATATTTCAGACTATCACATGGGG - Intergenic
902022954 1:13361607-13361629 ATATTTCAGACTATCACATGGGG - Intergenic
902248225 1:15135926-15135948 ATATTTCAGACTATCACATGGGG + Intergenic
902281734 1:15379615-15379637 ATATTTCAGACTTTCACATGGGG + Intronic
903746161 1:25588197-25588219 ATATTTCAGACTATCACATGGGG - Intergenic
904269271 1:29338677-29338699 ATATTTCAGACTATCACATGGGG + Intergenic
904272512 1:29359673-29359695 ATATTTCAGACTATCACATGGGG - Intergenic
904796991 1:33063864-33063886 ATCTCTCAGACTATCACATGGGG - Intronic
905227622 1:36489564-36489586 ATATTTCAGACTATCACATGGGG + Intergenic
905762554 1:40572373-40572395 ATATTTCAGACTATCACATGGGG - Intergenic
906171546 1:43730174-43730196 TTATTTCAGTCTTTTCCATTAGG - Intronic
906402293 1:45513857-45513879 ATATTTCAGACTATCACATGGGG - Intronic
906404166 1:45528448-45528470 ATATTTCAGACTATCACATGGGG - Intergenic
906498205 1:46320639-46320661 ATATTTCAGACTATCACATGGGG - Intergenic
906499328 1:46329891-46329913 ATATTTCAGACTATCACATGGGG - Intergenic
906758397 1:48345375-48345397 ATCTTTCTAACTTTTTGATGTGG - Intronic
906808180 1:48800598-48800620 CTATTTCAGACTTTTTGATGTGG + Intronic
906822263 1:48942101-48942123 AACTTTCAGGCTTTCCTATGTGG - Intronic
906836567 1:49089135-49089157 ATCTTTCTAACTTTTTGATGTGG - Intronic
906890382 1:49706655-49706677 ATCTTTCCTACTTTCTCATGAGG + Intronic
907120814 1:52006591-52006613 ATATTTCAGACTATCACATGGGG - Intergenic
907254567 1:53168866-53168888 ATATTTCAGACTATCACATGGGG + Intergenic
907465918 1:54636714-54636736 ATATTTCAGACTATCACATGGGG + Exonic
907613041 1:55892071-55892093 ATCTTTCTAACTTTTTGATGTGG + Intergenic
908022674 1:59914717-59914739 ATATTTCAGACTATCACATGGGG - Intronic
908024748 1:59938783-59938805 ATATTTCAGACTATCACATGGGG + Intergenic
908124900 1:61020973-61020995 ATCTCTCACACTTCTCCAAGAGG + Intronic
908238769 1:62171604-62171626 ATATTTCAGACTATCACATGGGG + Intergenic
908543092 1:65140143-65140165 ATATTTCAGACTATCACATGGGG - Intergenic
908660032 1:66425413-66425435 ATATTTCAGACTATCACATGGGG + Intergenic
908794829 1:67820571-67820593 ACCTGTCACACTTTTCAATGTGG + Intronic
908935478 1:69371067-69371089 ATCTTTCTAACTTTTGGATGTGG + Intergenic
909023812 1:70461029-70461051 ATATTTCAGACTATCACATGGGG + Intergenic
909033118 1:70565400-70565422 ATCTTTCTGACTTTTTGATATGG + Intergenic
909047224 1:70725224-70725246 ATCTTTCTAGCTTTTCGATGTGG + Intergenic
909234122 1:73129895-73129917 ATATTTCAGACTATCACATGGGG + Intergenic
909413178 1:75377433-75377455 ATATTTCAGACTATCACATGGGG - Intronic
909413829 1:75382838-75382860 ATATTTCAGACTATCACATGGGG - Intronic
909651795 1:77983468-77983490 ATATTTCAGACTATCACATGGGG + Intronic
909689586 1:78392261-78392283 ATCTTTCTAACTTTTTGATGTGG + Intronic
909805470 1:79869407-79869429 ATCTTTCCCACTTTCTCATGTGG - Intergenic
909874233 1:80782258-80782280 ATCTTTCTAACTTTTTGATGTGG - Intergenic
910281530 1:85506725-85506747 CTTATTCAGACTTTACCATGTGG + Intronic
910374872 1:86557317-86557339 ATCTTTCTAACTTTTTGATGTGG + Intronic
910504471 1:87934167-87934189 ATATTTCAGAGTTCTCCATGTGG - Intergenic
910604389 1:89067461-89067483 ATATTTCAGACTATCACATGGGG + Intergenic
910919122 1:92324706-92324728 TTCTTTCAGATTTTTACATGGGG + Intronic
911010662 1:93277380-93277402 ATATTTCAGACTATCACATGGGG + Intronic
911035299 1:93537680-93537702 ATCATACAGACTCATCCATGGGG - Intronic
911236236 1:95415349-95415371 ATCATCCTGAATTTTCCATGTGG - Intergenic
911374956 1:97041070-97041092 ATCTTTCTAACTTTTTGATGTGG + Intergenic
911464565 1:98235007-98235029 ATTTTTCAGACTTGTTTATGTGG - Intergenic
911514496 1:98850170-98850192 ATCTTTCTAACTTTTTGATGTGG + Intergenic
911667490 1:100570366-100570388 ATATTTCTGACTATTCAATGTGG - Intergenic
911697965 1:100914814-100914836 GTCTTTGAAATTTTTCCATGAGG + Intronic
911947855 1:104135342-104135364 ATATTTCAGACTATCACATGGGG + Intergenic
912211182 1:107558850-107558872 ATCTATCAGACCCTTCCATCAGG - Intergenic
912270745 1:108206529-108206551 ATCTTTCCCACTTTCTCATGGGG + Intergenic
912301046 1:108517793-108517815 ATATTTCAGACTATCACATGGGG - Intergenic
912611553 1:111050946-111050968 ATCTTTCTAATTTTTTCATGTGG + Intergenic
912642443 1:111360319-111360341 ATATTTCAGACTATCACATGAGG + Intergenic
912801184 1:112720558-112720580 ATCTTTCCTACTTGTCCAGGTGG + Exonic
912814396 1:112817403-112817425 ATATTTCAGACTATCACATGGGG + Intergenic
912887589 1:113491410-113491432 ACCTTTCCAACTTTTTCATGTGG - Intronic
913410950 1:118550858-118550880 ATCTTTCTAACTTTTTGATGTGG - Intergenic
913605740 1:120464191-120464213 CTCTTTCATTCTTTTCCATTTGG + Intergenic
913643157 1:120831803-120831825 CTCTTTCATTCTTTTCCATTTGG + Intronic
913643924 1:120838560-120838582 CTCTTTCATTCTTTTCCATTTGG + Intronic
913989466 1:143597145-143597167 CTCTTTCATTCTTTTCCATTTGG - Intergenic
913989617 1:143598685-143598707 CTCTTTCATCCTTTTCCATTTGG - Intergenic
914082810 1:144425025-144425047 CTCTTTCATTCTTTTCCATTTGG - Intronic
914097492 1:144556122-144556144 ATATTTCAGACTATCACATGGGG + Intergenic
914177724 1:145293539-145293561 CTCTTTCATTCTTTTCCATTTGG - Intronic
914178269 1:145298297-145298319 CTCTTTCATTCTTTTCCATTTGG - Intronic
914178814 1:145303059-145303081 CTCTTTCATTCTTTTCCATTTGG - Intronic
914179192 1:145306228-145306250 CTCTTTCATTCTTTTCCATTTGG - Intronic
914179567 1:145309411-145309433 CTCTTTCATTCTTTTCCATTTGG - Intronic
914180112 1:145314167-145314189 CTCTTTCATTCTTTTCCATTTGG - Intronic
914180657 1:145318939-145318961 CTCTTTCATTCTTTTCCATTTGG - Intronic
914181200 1:145323701-145323723 CTCTTTCATTCTTTTCCATTTGG - Intronic
914181743 1:145328449-145328471 CTCTTTCATTCTTTTCCATTTGG - Intronic
914182288 1:145333216-145333238 CTCTTTCATTCTTTTCCATTTGG - Intronic
914182833 1:145337972-145337994 CTCTTTCATTCTTTTCCATTTGG - Intronic
914183378 1:145342722-145342744 CTCTTTCATTCTTTTCCATTTGG - Intronic
914183922 1:145347480-145347502 CTCTTTCATTCTTTTCCATTTGG - Intronic
914184466 1:145352252-145352274 CTCTTTCATTCTTTTCCATTTGG - Intronic
914185010 1:145357014-145357036 CTCTTTCATTCTTTTCCATTTGG - Intronic
914185555 1:145361761-145361783 CTCTTTCATTCTTTTCCATTTGG - Intronic
914186101 1:145366515-145366537 CTCTTTCATTCTTTTCCATTTGG - Intronic
914186647 1:145371275-145371297 CTCTTTCATTCTTTTCCATTTGG - Intronic
914187191 1:145376023-145376045 CTCTTTCATTCTTTTCCATTTGG - Intronic
914187734 1:145380775-145380797 CTCTTTCATTCTTTTCCATTTGG - Intronic
914188279 1:145385529-145385551 CTCTTTCATTCTTTTCCATTTGG - Intronic
914188822 1:145390279-145390301 CTCTTTCATTCTTTTCCATTTGG - Intronic
914197677 1:145457776-145457798 ATCTTTCTGGCTTTGTCATGAGG - Intergenic
914210680 1:145575982-145576004 CTCTTTCATTCTTTTCCATTTGG - Intergenic
914269974 1:146071482-146071504 CTCTTTCATTCTTTTCCATTTGG - Intronic
914270515 1:146076204-146076226 CTCTTTCATTCTTTTCCATTTGG - Intronic
914271051 1:146080940-146080962 CTCTTTCATTCTTTTCCATTTGG - Intronic
914271589 1:146085676-146085698 CTCTTTCATTCTTTTCCATTTGG - Intronic
914272124 1:146090397-146090419 CTCTTTCATTCTTTTCCATTTGG - Intronic
914272660 1:146095115-146095137 CTCTTTCATTCTTTTCCATTTGG - Intronic
914273198 1:146099837-146099859 CTCTTTCATTCTTTTCCATTTGG - Intronic
914273737 1:146104559-146104581 CTCTTTCATTCTTTTCCATTTGG - Intronic
914274275 1:146109277-146109299 CTCTTTCATTCTTTTCCATTTGG - Intronic
914274811 1:146113987-146114009 CTCTTTCATTCTTTTCCATTTGG - Intronic
914275345 1:146118705-146118727 CTCTTTCATTCTTTTCCATTTGG - Intronic
914275880 1:146123441-146123463 CTCTTTCATTCTTTTCCATTTGG - Intronic
914301502 1:146381496-146381518 ATATTTCAGACTATCACATGGGG - Intergenic
914346322 1:146802026-146802048 CTCTTTCAGTCTTTTTGATGCGG - Intergenic
914366950 1:146987769-146987791 CTCTTTCATTCTTTTCCATTTGG + Intronic
914367486 1:146992526-146992548 CTCTTTCATTCTTTTCCATTTGG + Intronic
914380566 1:147112222-147112244 CTCTTTCATCCTTTTCCATTTGG - Intergenic
914441333 1:147710034-147710056 ATATTTCAGACTATCACATGGGG + Intergenic
914444060 1:147734439-147734461 ATATTTCAGACTATCACATGGGG + Intergenic
914476781 1:148030888-148030910 ATCTTTCTGGCTTTGTCATGAGG - Intergenic
914485498 1:148105691-148105713 CTCTTTCATTCTTTTCCATTTGG - Intronic
914532813 1:148538169-148538191 CTCTTTCATTCTTTTCCATTTGG - Intronic
914533347 1:148542889-148542911 CTCTTTCATTCTTTTCCATTTGG - Intronic
914533882 1:148547603-148547625 CTCTTTCATTCTTTTCCATTTGG - Intronic
914534418 1:148552311-148552333 CTCTTTCATTCTTTTCCATTTGG - Intronic
914534954 1:148557025-148557047 CTCTTTCATTCTTTTCCATTTGG - Intronic
914535489 1:148561742-148561764 CTCTTTCATTCTTTTCCATTTGG - Intronic
914536025 1:148566478-148566500 CTCTTTCATTCTTTTCCATTTGG - Intronic
914536560 1:148571200-148571222 CTCTTTCATTCTTTTCCATTTGG - Intronic
914536921 1:148574388-148574410 CTCTTTCATTCTTTTCCATTTGG - Intronic
914585466 1:149057670-149057692 CTCTTTCATTCTTTTCCATTTGG - Intronic
914585833 1:149060858-149060880 CTCTTTCATTCTTTTCCATTTGG - Intronic
914629001 1:149490954-149490976 CTCTTTCATTCTTTTCCATTTGG + Intergenic
914629534 1:149495717-149495739 CTCTTTCATTCTTTTCCATTTGG + Intergenic
914630069 1:149500472-149500494 CTCTTTCATTCTTTTCCATTTGG + Intergenic
914630603 1:149505233-149505255 CTCTTTCATTCTTTTCCATTTGG + Intergenic
914631136 1:149509994-149510016 CTCTTTCATTCTTTTCCATTTGG + Intergenic
914631667 1:149514751-149514773 CTCTTTCATTCTTTTCCATTTGG + Intergenic
914632203 1:149519503-149519525 CTCTTTCATTCTTTTCCATTTGG + Intergenic
914632740 1:149524260-149524282 CTCTTTCATTCTTTTCCATTTGG + Intergenic
914633274 1:149528989-149529011 CTCTTTCATTCTTTTCCATTTGG + Intergenic
914633810 1:149533740-149533762 CTCTTTCATTCTTTTCCATTTGG + Intergenic
914634346 1:149538491-149538513 CTCTTTCATTCTTTTCCATTTGG + Intergenic
914634880 1:149543228-149543250 CTCTTTCATTCTTTTCCATTTGG + Intergenic
914635415 1:149547965-149547987 CTCTTTCATTCTTTTCCATTTGG + Intergenic
914635950 1:149552702-149552724 CTCTTTCATTCTTTTCCATTTGG + Intergenic
914765591 1:150635266-150635288 ATATTTCAGACTATCACATGGGG - Intergenic
914773118 1:150709564-150709586 ATATTTCAGACTATCACATGGGG - Intronic
914968604 1:152285347-152285369 ATCTTTCTAACTTTTTGATGTGG - Intergenic
915052354 1:153088876-153088898 ATATTTCAGACTATCACATGGGG + Intergenic
915397946 1:155600135-155600157 ATATTTCAGACTATCACATGGGG + Intergenic
915401811 1:155627264-155627286 ATATTTCAGACTATCACATGGGG + Intergenic
915402715 1:155635476-155635498 ATATTTCAGACTATCACATGGGG + Intergenic
915480227 1:156179570-156179592 ATATTTCAGACTATCACATGGGG - Intergenic
915760060 1:158302323-158302345 ATCTTTCTAACTTTTTGATGTGG - Intergenic
915890402 1:159768143-159768165 ATATTTCAGACTTTCACATGGGG - Intergenic
915928187 1:160040491-160040513 TATTTTCAGACCTTTCCATGGGG + Exonic
916005035 1:160652486-160652508 ATATTTCAGACTGTCACATGGGG - Intergenic
916009380 1:160691133-160691155 ATATTTCAGACTATCACATGGGG - Intronic
916010273 1:160699396-160699418 ATATTTCAGACTATCACATGGGG - Intronic
916034943 1:160913503-160913525 ATATTTCAGACTATCACATGGGG - Intergenic
916048280 1:161017183-161017205 ATATTTCAGACTATCACATGGGG - Intronic
916092220 1:161316278-161316300 ATATTTCAGACTATCACATGGGG + Intronic
916144855 1:161729265-161729287 ATCTTTCTCACATCTCCATGTGG - Intergenic
916158940 1:161889309-161889331 ACCTTTCCCAGTTTTCCATGGGG + Intronic
916331459 1:163622254-163622276 CTCTTTCAGACTTTTTGATATGG + Intergenic
916643118 1:166753352-166753374 ATCTTTCTAACTTTTCGATATGG - Intergenic
916730147 1:167558848-167558870 ATTTTTCACACTTTTCACTGTGG + Intergenic
916904343 1:169265514-169265536 ATCTTTCCAACTTTTTGATGTGG - Intronic
917207636 1:172594388-172594410 ATCTTTCTTACTTTTTCTTGTGG + Intronic
917252857 1:173080898-173080920 ATATTTCAAACTTTTTGATGTGG - Intergenic
917585440 1:176422296-176422318 ATCTTTCTAACTTTTTGATGTGG + Intergenic
917697189 1:177537494-177537516 ATCTTTCTAACTTTTTTATGTGG - Intergenic
917998189 1:180463111-180463133 ATCTTTCTAACTTTTTGATGTGG - Intronic
918202923 1:182284109-182284131 TTCTTCCAGTCTTTTCCAGGTGG + Intergenic
918536501 1:185580923-185580945 ATCTTTCTAGCTTTTCGATGTGG + Intergenic
918784877 1:188751840-188751862 ATATTTCAGACTATCACATGGGG + Intergenic
918872235 1:189990287-189990309 ATCTTTCTGACTTCTGCAGGAGG + Intergenic
918927989 1:190812440-190812462 ATCTTTCTAACTTTTTGATGTGG - Intergenic
919231640 1:194781361-194781383 ATCTTTCTAGCTTTTCGATGTGG - Intergenic
919326124 1:196109334-196109356 ATATTTCAGACTATCACATGGGG + Intergenic
919484529 1:198130311-198130333 ATATTTCAGACTATCACATGGGG + Intergenic
919549233 1:198963981-198964003 CTCTTTCAGACTTTTTGATGTGG + Intergenic
919578387 1:199339774-199339796 ATCTTTCTAACTTTTTAATGTGG - Intergenic
919608147 1:199711984-199712006 ATCTTTCTAACTTTTTGATGTGG - Intergenic
920787379 1:209054673-209054695 ATCTTTCTAACTTTTTGATGTGG - Intergenic
920796373 1:209141530-209141552 ATATTTCAGACTATCACATGGGG - Intergenic
921404290 1:214762256-214762278 ATCTTTCTAACTTTTTGATGTGG + Intergenic
921653635 1:217708088-217708110 ATATTTCTGACTTTTTGATGTGG - Intronic
922054997 1:222033576-222033598 ATCTTTCATCCTTTTCCTTACGG + Intergenic
922305404 1:224340178-224340200 ATATTTCAGACTATCACATGGGG - Intergenic
922484888 1:225966207-225966229 ATATTTCAGACTATCACATGGGG - Intergenic
922679234 1:227577794-227577816 ATTTTGCAGACTTGTTCATGTGG + Intronic
922866257 1:228863803-228863825 ATCATTCTGATTCTTCCATGTGG + Intergenic
923855578 1:237841895-237841917 ATCTTTCTAACTTTTTGATGTGG - Intergenic
924205318 1:241705888-241705910 AGCCTTCAGAATTCTCCATGAGG - Intronic
924498610 1:244614522-244614544 ATCTTCCAAACTTTTCCCAGAGG + Intronic
924666955 1:246083032-246083054 ATATTTCAGACTGTCACATGGGG - Intronic
924764184 1:247016381-247016403 ATATTTCAGACTGTCACATGGGG + Intergenic
924917416 1:248586207-248586229 CTCTTTCAGACTTTTTGATGTGG + Intergenic
924919660 1:248614632-248614654 GTCTTTCTGACTTTTTCATGTGG - Intergenic
1063114124 10:3061835-3061857 ATATTTCAGACTATAACATGGGG - Intergenic
1063530340 10:6824778-6824800 ATATTTCAGACTATCACATGGGG + Intergenic
1063531260 10:6833272-6833294 ATATTTCAGACTATCACATGGGG + Intergenic
1064833377 10:19496590-19496612 ATCTTTCCAACTTTTTGATGTGG - Intronic
1064834479 10:19510394-19510416 ATATTTCAGACTATCACATGGGG + Intronic
1065059597 10:21885868-21885890 ATCTTTCTGACTTTTTGATGTGG - Intronic
1065553734 10:26893817-26893839 ATATTTCAGACTATCACATGGGG - Intergenic
1065735691 10:28750031-28750053 ATCTTTCCCACTTTCTCATGTGG + Intergenic
1066175056 10:32894834-32894856 ATATTTCAGACTATCACATGGGG - Intergenic
1066378579 10:34881998-34882020 ATTTTTAAGACTGTTCTATGTGG - Intergenic
1066611600 10:37254324-37254346 ATCTTTCATACATTTCCAGTGGG - Intronic
1066669300 10:37820008-37820030 CTCTTTTTGACTTTTCTATGAGG + Intronic
1066752992 10:38678611-38678633 ATCTTTCTAACTTTTCAATATGG - Intergenic
1066927254 10:41713533-41713555 ATATTTCAGACTATCACATGGGG - Intergenic
1066964028 10:42244388-42244410 ATCTTTCTAACTTTTCAATATGG + Intergenic
1067101430 10:43337550-43337572 ATATTTCAGACTATCACATGGGG - Intergenic
1067518821 10:46979105-46979127 ATCTTTCAGCCTTCTCCAAAGGG + Intronic
1067548281 10:47212808-47212830 ATCTTTCAAAGTTATCCATAAGG - Intergenic
1067643426 10:48072729-48072751 ATCTTTCAGCCTTCTCCAAAGGG - Intergenic
1068054024 10:51988264-51988286 ATTTTTGAGATTTATCCATGTGG + Intronic
1068325552 10:55481442-55481464 ATCTTTCTAACTTTTTGATGTGG + Intronic
1068441375 10:57059445-57059467 ATCTTTCTAGCTTTTTCATGTGG - Intergenic
1068905942 10:62322610-62322632 ATCTTTCTAACTTTTTGATGCGG - Intergenic
1069072279 10:64001360-64001382 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1069277155 10:66606807-66606829 ATCTTTCTAACTTTTTGATGTGG - Intronic
1069333814 10:67325341-67325363 ATCTTTCTAACTTTTTGATGTGG + Intronic
1070030002 10:72667881-72667903 ATCTTTCACACTTTTAGATGGGG - Intergenic
1070362497 10:75704639-75704661 ATCTTTCACACTTTTCTATGAGG + Intronic
1070870837 10:79751014-79751036 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1070998305 10:80806259-80806281 ATATTTCAGACTATCACATGGGG - Intergenic
1071022851 10:81079581-81079603 ATCTTTCCAACTTTTTGATGTGG + Intergenic
1071453994 10:85828323-85828345 ATCTTTCTAACTTTTTGATGTGG - Intronic
1071454936 10:85839654-85839676 ATCTTTCTAACCTTTTCATGTGG - Intronic
1071637763 10:87273225-87273247 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1071657481 10:87464725-87464747 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1071736460 10:88306211-88306233 ATCTTTCCAACTTTTTCAGGTGG - Intronic
1071772649 10:88746651-88746673 ATCTTTCTAACTTTTTGATGTGG - Intronic
1072410517 10:95197822-95197844 ATATTTCAGACTATCACATGGGG + Intronic
1072441275 10:95457874-95457896 ATCTTTAAGAATGTTTCATGAGG + Intronic
1072493408 10:95931490-95931512 ATCTTTCCCACTTTTTCCTGTGG + Intronic
1072541760 10:96403617-96403639 ATATTTCAGACTATCACATGGGG - Intronic
1072669288 10:97417429-97417451 ATATTTCAGACTATCACATGGGG + Intronic
1072708564 10:97700195-97700217 ATATTTCAGACTATTGCATGGGG - Intergenic
1072947307 10:99821435-99821457 ATATTTCAGACTATCACATGGGG + Intronic
1073286350 10:102391793-102391815 ATATTTCAGACTATCACATGGGG - Intergenic
1073863491 10:107773618-107773640 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1074013934 10:109513493-109513515 ATCTTTCTAACTTTTAGATGTGG + Intergenic
1074645568 10:115448556-115448578 ATCTTTCTAACTTTTTGATGTGG - Intronic
1074648916 10:115496606-115496628 ATCATTCTAACTTTTCGATGTGG + Intronic
1075983624 10:126764130-126764152 ATCTTTCCGGCTTTCTCATGTGG + Intergenic
1076459229 10:130628300-130628322 ATATTTCAGACTATCACATGGGG - Intergenic
1076862705 10:133147783-133147805 ATCTTTCTGACTTTTTAATATGG - Intergenic
1076932459 10:133541654-133541676 ATATTTCAGACTATCACATGGGG + Intronic
1076933229 10:133548402-133548424 ATCTTTCTGGCTTTTCGATGTGG - Intronic
1077586351 11:3456579-3456601 ATATTTCAGACTATCACATGGGG + Intergenic
1077703278 11:4461095-4461117 ATATTTCAGACTATCACATGGGG + Intergenic
1078327418 11:10391907-10391929 ATATTTCAGACTATCACATGGGG + Intronic
1078654216 11:13223154-13223176 TTCTATCAGACCTTTCCATCAGG + Intergenic
1079153386 11:17922025-17922047 ATCTTTGAGACAAGTCCATGAGG - Intronic
1079664930 11:23093132-23093154 ATATTTCAGACTATCACATGCGG + Intergenic
1079725691 11:23877877-23877899 ATCTTTCAGTCTTTTGCTTTTGG - Intergenic
1079733787 11:23970070-23970092 ATCTTCTTTACTTTTCCATGTGG - Intergenic
1079769968 11:24446433-24446455 ATATTTCAGACTATCACATGGGG - Intergenic
1079851444 11:25541079-25541101 ATATTTCAGACTATCACATGGGG - Intergenic
1080094882 11:28394042-28394064 ATGTGTCTGACTTTTCCATTAGG + Intergenic
1080513444 11:32998422-32998444 ATCTTTCTAGCTTTTCAATGTGG + Intergenic
1080756980 11:35210364-35210386 ATCTTTCTAACTTTTTTATGTGG + Intronic
1081019756 11:37930944-37930966 ATATTTCAGACTATCACATGGGG - Intergenic
1081043407 11:38240090-38240112 ATCTTTCCAACTTTTTGATGCGG + Intergenic
1081195510 11:40155242-40155264 CTCTTTCAGAGTTTTTGATGTGG - Intronic
1082267195 11:50131765-50131787 ATATTTCAGACTATCACATGGGG + Intergenic
1082288893 11:50346803-50346825 ATATTTCAGACTATCACATGGGG - Intergenic
1082672951 11:56058001-56058023 ATATTTCAGACTATCACATGGGG - Intergenic
1082706891 11:56503200-56503222 ATATTTCAGACTATCACATGGGG + Intergenic
1082706911 11:56503305-56503327 ATATTTCAGACTATCACATGGGG + Intergenic
1082716387 11:56618948-56618970 ATATTTCAGACTATCACATGGGG + Intergenic
1082982515 11:59136629-59136651 ATATTTCAGACTATCACATGGGG - Intergenic
1083139972 11:60713766-60713788 ATATTTCAGACTATCACATGGGG + Intronic
1083285413 11:61655607-61655629 ATATTTCAGACTATCACATGGGG + Intergenic
1083371140 11:62182418-62182440 ATCTTTCTAACTTTTCGATGTGG + Intergenic
1083375409 11:62216290-62216312 ATATTTCAGACTATCACATGGGG - Intergenic
1083467610 11:62859114-62859136 ATATTTCAGACTATCACATGGGG + Intronic
1083543130 11:63528569-63528591 ATATTTCAGACTATCACATGGGG + Intergenic
1083543427 11:63530912-63530934 ATATTTCAGACTATCACATGGGG + Intergenic
1083797186 11:65023825-65023847 ATATTTCAGACTCTCACATGGGG + Intronic
1084207418 11:67603952-67603974 ATATTTCAGACTATCACATGGGG + Exonic
1084247408 11:67868562-67868584 ATATTTCAGACTATCACATGGGG + Intergenic
1084830788 11:71767543-71767565 ATATTTCAGACTATCACATGGGG + Intergenic
1084880082 11:72164721-72164743 ATATTTCAGACTATCACATGGGG - Intergenic
1085222304 11:74884812-74884834 ATCTTTCTAACTTTTTGATGTGG - Intronic
1085240237 11:75047190-75047212 CTCTCTCAGACTTTTTGATGTGG + Intergenic
1085463897 11:76711464-76711486 ATATTTCAGACTATCACATGGGG - Intergenic
1085827416 11:79862934-79862956 ATCTTTTTAACTTTTCGATGTGG - Intergenic
1086608172 11:88722534-88722556 ATCTCTCAGATTTGTCCAGGAGG + Intronic
1086611389 11:88760105-88760127 ATCTTTCTAACTTTTTGATGTGG - Intronic
1087314122 11:96586477-96586499 ATATTTCAGACTATCACATGGGG - Intergenic
1087513814 11:99131288-99131310 ATCTTTCAGGCTTTTTGATGTGG - Intronic
1087723716 11:101695410-101695432 ATATTTCAGACTATCACATGGGG - Intronic
1087724647 11:101703908-101703930 ATATTTCAGACTATCACATGGGG - Intronic
1087726938 11:101729490-101729512 ATTTTTGAGGTTTTTCCATGTGG + Intronic
1088108430 11:106231180-106231202 ATTTTTCAAGATTTTCCATGAGG - Intergenic
1088375705 11:109139453-109139475 ATCCTTGAGAATTATCCATGTGG + Intergenic
1088506110 11:110529146-110529168 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1088703125 11:112432273-112432295 ATCTTTCTAACTTTTTGATGGGG + Intergenic
1088858378 11:113777415-113777437 ATATTTCAGACTATCACATGGGG - Intergenic
1089057188 11:115595224-115595246 ATCTTGCAGACATTTCCATATGG - Intergenic
1089471228 11:118721611-118721633 ATATTTCAGACTATCACATGGGG + Intergenic
1089472123 11:118729804-118729826 ATATTTCAGACTATCACATGGGG + Intergenic
1090093749 11:123723918-123723940 ATCTGTCAGAGTTCTACATGAGG - Intergenic
1091579933 12:1779106-1779128 AACTGCCAGACTTTTCCATGGGG - Intronic
1091811286 12:3400045-3400067 ATCTTTCTAGCTTTTCAATGTGG - Intronic
1092059555 12:5537365-5537387 ATATTTCAGACTGTCACATGGGG - Intronic
1092142265 12:6191899-6191921 ATATTTCAGACTGTCACATGGGG + Intergenic
1092405668 12:8220555-8220577 ATATTTCAGACTATCACATGGGG - Intergenic
1092437519 12:8462279-8462301 ATATTTCAGACTATCACATGGGG - Intronic
1092455086 12:8636004-8636026 ATATTTCAGACTATCACATGGGG - Intergenic
1092513903 12:9187714-9187736 ATCTTTCTAACTTTTCGATGTGG - Intronic
1092559819 12:9600813-9600835 ATATTTCAGACTATCACATGGGG - Intronic
1092645926 12:10571866-10571888 ATATTTCAGACTATCACATGGGG + Intergenic
1092671073 12:10861066-10861088 CTTTTTCAGACTGTTCCCTGTGG - Intronic
1092680650 12:10976454-10976476 ATCTTTCTAACTTTTCAATGTGG - Intronic
1093174143 12:15892484-15892506 ATCTTTCAGATTTTATTATGTGG + Intronic
1093219692 12:16405064-16405086 ATCTTTCTAACTTTTTGATGTGG - Intronic
1093655612 12:21690825-21690847 ATCTTTCTAACTTTTTGATGTGG - Intronic
1093683170 12:22026194-22026216 ATTTGTCAGACTTTTTGATGTGG - Intergenic
1094389371 12:29932652-29932674 ATATTTCAGACTATCACATGGGG + Intergenic
1094463929 12:30730184-30730206 ATTTTTCAGCCTTTTGCATAGGG - Intronic
1094582743 12:31749425-31749447 ATTTTTCAGACTTTGCCTTCAGG - Intergenic
1094623202 12:32099858-32099880 ATATTTCAGACTATCACATGGGG - Intergenic
1095063764 12:37738686-37738708 ATATTTCAGACTGTCACATGGGG + Intergenic
1095100265 12:38174580-38174602 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1095456125 12:42388065-42388087 ATATTTCAGACTGTCACATGGGG - Intronic
1095595591 12:43954185-43954207 ATCTTTCTAGCTTTTTCATGTGG - Intronic
1096125432 12:49116022-49116044 ATATTTCAGACTATCACATGGGG - Intergenic
1096180257 12:49546738-49546760 ATCTTTCAGTCTTGGCCATGGGG - Intronic
1096324922 12:50651525-50651547 ATTTTTCATTCTTTTGCATGTGG + Intronic
1096420702 12:51454885-51454907 ATATTTCAGACTATCACATGGGG + Intronic
1096563908 12:52459754-52459776 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1097076811 12:56400959-56400981 ATATTTCAGACTATCACATGGGG + Intergenic
1097132435 12:56822486-56822508 ATATTTCAGACTATCACATGGGG - Intergenic
1097303235 12:58040751-58040773 ATCTTTCTAACTTTTTGATGAGG + Intergenic
1097313396 12:58146488-58146510 ATCTTTCTAACTTTTTAATGTGG + Intergenic
1097330532 12:58328057-58328079 ATATTTCAGACTATCACATGGGG + Intergenic
1097331467 12:58336546-58336568 ATATTTCAGACTATCACATGGGG + Intergenic
1097350536 12:58543759-58543781 ATATTTCAGACTATCACATGGGG + Intergenic
1097385728 12:58948166-58948188 ATCTTGAAGAAATTTCCATGTGG + Intergenic
1097399142 12:59108562-59108584 ATATTTCAGACTATCACATGGGG - Intergenic
1097559002 12:61177751-61177773 ATCTTTCTGATTTTTCGATGTGG + Intergenic
1097583256 12:61484097-61484119 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1097822018 12:64137470-64137492 AGCCTTCAGATTTTCCCATGGGG + Intronic
1098343829 12:69479165-69479187 ATCTTTTAGAATTTTCCCTAGGG + Intronic
1098441650 12:70525470-70525492 ATCTTTGAGATTCTTCCACGTGG - Intronic
1098705959 12:73689693-73689715 AGCTTTCAGATTTTTCCATTTGG - Intergenic
1099744684 12:86687445-86687467 ATCTTTCCCACTTTCTCATGTGG + Intronic
1099797523 12:87418263-87418285 ATCTTTCCCACTTTCTCATGTGG + Intergenic
1099799533 12:87440300-87440322 ATTTTTCAGGCTTTTTCATTTGG + Intergenic
1100266538 12:92981927-92981949 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1100276287 12:93074750-93074772 ATATTTCAGACTATCACATGGGG - Intergenic
1100945090 12:99773945-99773967 ATATTTCATGCTTTTGCATGTGG - Intronic
1101154737 12:101916781-101916803 ATCTTTCACAGTCTTGCATGTGG - Intronic
1101445557 12:104734599-104734621 ATGTTTCTTACTTTGCCATGGGG + Intronic
1101520665 12:105479158-105479180 ATATTTCAGACTATCACATGGGG + Intergenic
1101582676 12:106056904-106056926 ATCTAGTAGAATTTTCCATGTGG - Intergenic
1101774182 12:107778723-107778745 ATCTTTTAGACTCTTCCAGCTGG + Intergenic
1101798255 12:107997665-107997687 ATATTTCAGACTATCACATGGGG + Intergenic
1102135440 12:110570385-110570407 ATATTTCAGACTATCACATGGGG - Intronic
1103092353 12:118106324-118106346 ATATTTCAGACTATCACATGGGG - Intronic
1103179160 12:118893141-118893163 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1103688442 12:122751465-122751487 ATATTTCAGACTATCACATGAGG + Intergenic
1103794310 12:123492953-123492975 ATATTTCAGACTATCACATGGGG - Intronic
1104127617 12:125862546-125862568 CACTTTCTGACTCTTCCATGAGG - Intergenic
1104238102 12:126959301-126959323 ATATTTCAGACTATCACATGGGG + Intergenic
1104741696 12:131180770-131180792 ATCTTTCAGACTTTTTGATGTGG - Intergenic
1105055626 12:133096096-133096118 ATATTTCAGACTATCACATGGGG + Intronic
1105349120 13:19600565-19600587 ATATTTCAGACTATCACATGGGG - Intergenic
1105396431 13:20040711-20040733 ATCTTTCTAACTTTTTGATGTGG + Intronic
1105688736 13:22814251-22814273 ATATTTCAGACTATCACATGGGG + Intergenic
1106297385 13:28428248-28428270 GTTTTTCAGAGTTTTCCACGAGG + Intronic
1106443756 13:29804358-29804380 ATCTTTCAGACTTTTTGATATGG - Intronic
1106949626 13:34868623-34868645 ATCTGTCAAATTTTTCCCTGTGG - Intergenic
1107157644 13:37188190-37188212 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1107217566 13:37939466-37939488 ATCTAATAGACTTCTCCATGAGG - Intergenic
1107314517 13:39117073-39117095 ATCTTTCAAGCTTTTTGATGTGG + Intergenic
1107361446 13:39621999-39622021 CTCTTTCAGACTTTTTGATGTGG - Intergenic
1107667833 13:42711152-42711174 ATATTTCAGACTATCACATGGGG - Intergenic
1107700368 13:43041137-43041159 ATATTTCAGACTATCACATGGGG + Intronic
1108296988 13:49031577-49031599 CTATTTCATACTTTTACATGTGG - Intronic
1108352415 13:49599370-49599392 ATATTTCAGACTATCACATGGGG - Intergenic
1108491909 13:50990719-50990741 ATCTGTCAGATTTCTCCATGTGG + Intergenic
1108965002 13:56287447-56287469 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1109629260 13:65022948-65022970 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1109959815 13:69615474-69615496 ATATTTCAGACTATCACATGGGG + Intergenic
1110539728 13:76694683-76694705 CTCCTTCTGACTTTTCCCTGAGG - Intergenic
1111034432 13:82653794-82653816 ATCTATTAGGCTTTTGCATGCGG - Intergenic
1111050279 13:82874019-82874041 ATCTTTCCTATTTTTTCATGAGG + Intergenic
1111077177 13:83252306-83252328 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1111393632 13:87633538-87633560 ATCTTTCTAACTTTTTCATGTGG + Intergenic
1111862106 13:93720674-93720696 ATCTTTCCCACTTTCTCATGTGG + Intronic
1111882509 13:93975307-93975329 ATCTTTCAGAATTTTACTTTGGG + Intronic
1111979231 13:94999805-94999827 ATCTTTCAGAAAGCTCCATGTGG - Intergenic
1112367112 13:98764700-98764722 ATATTTCAGACTATCACATGGGG - Intergenic
1112536660 13:100264532-100264554 ATCTTTGAGATTCTTCCCTGAGG + Intronic
1112958726 13:105094285-105094307 ATCTTTCTAACTTTTTTATGTGG + Intergenic
1113991702 14:16032880-16032902 ATATTTCAGACTATCACATGGGG - Intergenic
1114006543 14:18319826-18319848 ATATTTCAGACTATCACATGGGG - Intergenic
1114072943 14:19129791-19129813 ATATTTCAGACTATCACATGGGG - Intergenic
1114089322 14:19270202-19270224 ATATTTCAGACTATCACATGGGG + Intergenic
1114132603 14:19809794-19809816 ACATTTCAGTCTTTTGCATGTGG - Intronic
1114168055 14:20242185-20242207 ATATTTCAGACTATCACATGGGG + Intergenic
1114170587 14:20269270-20269292 ATATTTCAGACTGTCACATGGGG - Intronic
1114279038 14:21173360-21173382 ATCTTTCTAACTTTTACTTGGGG - Intergenic
1114359526 14:21956117-21956139 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1114435160 14:22700052-22700074 GTCGTGCATACTTTTCCATGGGG + Intergenic
1114438155 14:22725283-22725305 ATATTTCAGACTATCACATGGGG + Intergenic
1114603249 14:23973199-23973221 ATATTTCAGACTATCACATGGGG + Intronic
1114604100 14:23982120-23982142 ATATTTCAGACTATCACATGGGG + Intronic
1114607619 14:24010320-24010342 ATATTTCAGACTATCACATGGGG + Intergenic
1114608228 14:24015682-24015704 ATATTTCAGACTATCACATGGGG + Intergenic
1114609122 14:24024917-24024939 ATATTTCAGACTATCACATGGGG + Intergenic
1114686717 14:24539284-24539306 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1114933378 14:27504042-27504064 ATCTTTCTGACCTTTGGATGTGG + Intergenic
1115021602 14:28687459-28687481 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1115148676 14:30257623-30257645 ATCTTTCTAACTTTTTTATGTGG + Intergenic
1115943360 14:38633007-38633029 ATCTTTCCAACTTTTTGATGTGG - Intergenic
1115968123 14:38914918-38914940 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1116504539 14:45662622-45662644 ATCTTTCTACCTTTTCGATGTGG + Intergenic
1116708805 14:48338408-48338430 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1116781992 14:49246085-49246107 ATCTTTCACACTTTCTGATGTGG - Intergenic
1117271606 14:54149603-54149625 CTCTTTCAGACTTTTTGATGTGG - Intergenic
1117365623 14:55024897-55024919 ATATTTCAGACTATCACATGGGG - Intronic
1117641264 14:57801449-57801471 ATTTTTCAGACTTGTTTATGTGG - Intronic
1117815129 14:59589890-59589912 ATCTTTCAAAGTCTTCCCTGAGG + Intergenic
1118054213 14:62062525-62062547 TTTTTTCAGACTATTCCCTGAGG - Intronic
1118352050 14:64979186-64979208 ATATTTCAGACTATCACATGGGG + Intronic
1119441972 14:74634628-74634650 ATCTGTCAGACTTTTTCCTGGGG - Intergenic
1119484562 14:74979348-74979370 AGCTTTCAGCCTCTTCCCTGGGG + Intergenic
1119823145 14:77635875-77635897 ATATTTCAGACTATCACATGGGG + Intergenic
1119826629 14:77661996-77662018 ATATTTCAGACTATCACATGGGG + Intergenic
1119841331 14:77795272-77795294 ATATTTCAGACTATCACATGGGG + Intergenic
1120582045 14:86264444-86264466 ATCTTTCTAGCTTTTCAATGTGG + Intergenic
1120641618 14:87020486-87020508 ATATTTCAGACTATCACATGGGG - Intergenic
1120670536 14:87357849-87357871 ATCTTTCCTACTTTTTCTTGTGG + Intergenic
1121201930 14:92124844-92124866 TTCTTTTTCACTTTTCCATGTGG + Intronic
1121527057 14:94626498-94626520 ATATTTCAGACTATCACATGGGG - Intergenic
1122997596 14:105273825-105273847 ATATTTCAGACTATCACATGGGG - Intronic
1123052845 14:105555169-105555191 ATATTTCAGACTATCACATGGGG - Intergenic
1123077426 14:105675557-105675579 ATATTTCAGACTGTCACATGGGG - Intergenic
1202919353 14_KI270723v1_random:16596-16618 ATATTTCAGACTATCACATGGGG + Intergenic
1202925279 14_KI270724v1_random:18398-18420 ATATTTCAGACTATCACATGGGG - Intergenic
1123390473 15:19866465-19866487 ATATTTCAGACTATCACATGGGG - Intergenic
1123575681 15:21665561-21665583 ACATTTCAGTCTTTTGCATGTGG - Intergenic
1123612301 15:22108034-22108056 ACATTTCAGTCTTTTGCATGTGG - Intergenic
1124078101 15:26465124-26465146 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1124388456 15:29229912-29229934 ATCTGTGAGATTTCTCCATGTGG + Intronic
1124560448 15:30769167-30769189 GTATTTCAAACTTTTCCATTAGG - Intronic
1124670765 15:31636274-31636296 GTATTTCAAACTTTTCCATTAGG + Intronic
1125291994 15:38159460-38159482 ATGTTTTACATTTTTCCATGTGG - Intergenic
1125562319 15:40644571-40644593 ATATTTCAGACTATCACATGGGG + Intronic
1125857761 15:42966756-42966778 ATCTTACATATTTTACCATGTGG + Intronic
1126002925 15:44228959-44228981 ATATTTCAGACTATCACATGGGG - Intergenic
1126219359 15:46194772-46194794 ATCTTTCTGGCTTTTTGATGTGG + Intergenic
1126233731 15:46357411-46357433 ATCTTTCTAACTTTTTGATGGGG - Intergenic
1126897696 15:53277043-53277065 ATCTTTCTAGCTTTTCGATGTGG - Intergenic
1127330810 15:57938003-57938025 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1127423640 15:58833928-58833950 ATATTTCAGACTATCACATGGGG + Intronic
1127445859 15:59062435-59062457 ATCTGTCTGACCTCTCCATGTGG + Intronic
1127936789 15:63648424-63648446 ATCTTTCATTCTTTTTCAGGTGG + Intronic
1128008711 15:64270411-64270433 ATCTTTCTAACTTTTTGATGTGG + Intronic
1128131022 15:65227140-65227162 ATATTTCAGACTATCACATGGGG + Intergenic
1128193949 15:65734001-65734023 ATATTTCAGACTATCACATGGGG - Intronic
1129485876 15:75871452-75871474 ATATTTCAGACTATCACATGGGG + Intronic
1129584927 15:76852723-76852745 ATCTTTCCAACTTTTTGATGTGG - Intronic
1130185777 15:81680235-81680257 ATCCTTCAAACTTTTTGATGTGG - Intergenic
1130422349 15:83760386-83760408 ATTTTTGAGACTTTTCTATATGG + Intronic
1130424329 15:83779963-83779985 ATCTTTCTAACTTTTTGATGTGG - Intronic
1130944499 15:88540899-88540921 ATATTTCAGACTATCACATGGGG - Intronic
1130966854 15:88704275-88704297 ATCTTTCAGATTTATCTAGGTGG + Intergenic
1131946688 15:97629731-97629753 ATATTTCAGACTATCGCATGGGG + Intergenic
1131959729 15:97776704-97776726 ATCTTTCATACTTTTTGATGTGG - Intergenic
1132440603 15:101860575-101860597 ATATTTCAGACTATCACATGGGG + Intergenic
1202984549 15_KI270727v1_random:399806-399828 ACATTTCAGTCTTTTGCATGTGG - Intergenic
1132831644 16:1931206-1931228 ATATTTCAGACTATCACATGGGG - Intergenic
1133433014 16:5754986-5755008 ATATTTCAGACTATCACATGGGG + Intergenic
1133461963 16:5994483-5994505 AAGTTTCAGATTTTTCCAAGTGG + Intergenic
1133527536 16:6620379-6620401 ATCTTTCTAACTTTTGGATGTGG - Intronic
1133602403 16:7352213-7352235 ATTTTTCAGCCTTTCCCAAGAGG + Intronic
1133687436 16:8179359-8179381 ATATTTCAGACTATCACATGGGG + Intergenic
1133716488 16:8454304-8454326 CTCTTTCAGACTTTTTGATGTGG - Intergenic
1134483311 16:14636737-14636759 ATATTTCAGACTATCACATGGGG + Intronic
1134805769 16:17123356-17123378 CTCTTTCAGACTTTTTGATGTGG + Intronic
1134877456 16:17714451-17714473 TTCTTTCTGACTTTTCCCTATGG + Intergenic
1135289408 16:21222384-21222406 ATATTTCAGACTATCACATGGGG + Intergenic
1135577847 16:23599823-23599845 ATATTTCAGACTATCACATGGGG - Intergenic
1136233443 16:28901039-28901061 CTCCTTCAGACTCTTCCTTGGGG - Intronic
1136664601 16:31798569-31798591 ATCTTTCGAACTTTTTGATGTGG + Intergenic
1136911019 16:34144448-34144470 ATATTTCAGACTCTCCTATGGGG - Intergenic
1136930379 16:34412655-34412677 ATATTTCAGACTATCACATGGGG + Intergenic
1136974195 16:34999153-34999175 ATATTTCAGACTATCACATGGGG - Intergenic
1136991466 16:35153805-35153827 ATATTTCAGACTATCACATGGGG - Intergenic
1137051646 16:35718918-35718940 ATCTTTCCTACTTTCCCTTGTGG + Intergenic
1137356418 16:47769949-47769971 ATCTTTCCCACTTTTTCTTGTGG - Intergenic
1137366580 16:47864806-47864828 ATATTTCAGACTATCACATGGGG - Intergenic
1137538217 16:49343477-49343499 ACCATGCAGACTTTTCCATGGGG - Intergenic
1137998043 16:53241520-53241542 ATCTATTAGACATATCCATGTGG - Intronic
1138924434 16:61573811-61573833 ATATTTCTGACTTTTTGATGTGG + Intergenic
1138997126 16:62469423-62469445 ATCTTTCTGACCTTTCAATGTGG + Intergenic
1139186932 16:64817500-64817522 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1139282948 16:65785470-65785492 ACCACTCAGACCTTTCCATGGGG + Intergenic
1139358442 16:66381495-66381517 TGCTTTCAGAGTTTTCAATGAGG + Intronic
1139987657 16:70913242-70913264 CTCTTTCAGTCTTTTTGATGTGG + Intronic
1140018123 16:71208441-71208463 ATCTTTCTAACTTTTTGATGTGG - Intronic
1140147354 16:72324344-72324366 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1140418899 16:74799991-74800013 ATATTTCAGACTATCACATGGGG + Intergenic
1140546626 16:75815893-75815915 ATATTTCAGACTATCACATGGGG + Intergenic
1141071331 16:80957682-80957704 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1143535889 17:7539140-7539162 ATTTTTCAGACATTTGCATGTGG - Intergenic
1144133323 17:12268564-12268586 CTCTTTCAGGCTGCTCCATGTGG - Intergenic
1144185521 17:12791653-12791675 ATTTTTCAGCCTCATCCATGGGG + Intronic
1144532335 17:16051528-16051550 ATCTTTCTAACTTTTTGATGTGG - Intronic
1144571213 17:16400480-16400502 ATATTTCAGACTATCACATGGGG - Intergenic
1144591690 17:16529454-16529476 CTTTTTCAGATTTATCCATGTGG - Intergenic
1144624038 17:16835485-16835507 ATATTTCAGACTATCACATGGGG + Intergenic
1144745512 17:17611522-17611544 ATATTTCAGACTGTCACATGGGG + Intergenic
1144882388 17:18437230-18437252 ATATTTCAGACTATCACATGGGG - Intergenic
1145031053 17:19505552-19505574 ATATTTCAGACTATCACATGGGG + Intronic
1145149846 17:20507156-20507178 ATATTTCAGACTATCACATGGGG + Intergenic
1145363309 17:22230015-22230037 ATATTTCAGACTATCACATGGGG - Intergenic
1145719185 17:27052588-27052610 ATCTTTCTAACTTTTTAATGTGG - Intergenic
1146181437 17:30700639-30700661 ATATTTCAGACTATCACATGGGG + Intergenic
1146614277 17:34340398-34340420 ATCTTTCTCACTTTTTTATGTGG + Intergenic
1146839465 17:36140400-36140422 ATATTTCAGACTATCACATGGGG - Intergenic
1147525714 17:41220469-41220491 ATCTTTCCCACTTTCTCATGTGG - Intronic
1147838753 17:43355293-43355315 ATATTTCAGACTATCGCATGGGG - Intergenic
1148273725 17:46284212-46284234 ATATTTCAGACTATCACATGGGG + Intronic
1148508187 17:48145224-48145246 ATTTTTAAGACTTCTTCATGTGG - Intronic
1149035280 17:52127246-52127268 GTCTTGGAGACTTTACCATGTGG + Intronic
1149202345 17:54201921-54201943 ATATTTCAGACTATCACATGGGG - Intergenic
1149395525 17:56237884-56237906 ATCTTTCTAACTTTTTGATGTGG + Intronic
1150307775 17:64100850-64100872 CTCATTCAGCTTTTTCCATGTGG - Intronic
1150315988 17:64169344-64169366 ATCTTTTACAATTTTGCATGGGG + Intronic
1150409334 17:64930369-64930391 ATATTTCAGACTATCACATGGGG - Intergenic
1150411252 17:64942793-64942815 ATATTTCAGACTTTTCTCTTAGG - Intergenic
1150840929 17:68604590-68604612 ATATTTCAGACTCTCACATGGGG + Intergenic
1150940301 17:69685765-69685787 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1152480917 17:80551806-80551828 ATATTTCAGACTATCACATGGGG + Intronic
1152515238 17:80819630-80819652 ATTTTTCCGACTTTTACATGTGG + Intronic
1152869594 17:82745127-82745149 ATATTTCAGACTGTCACATGGGG + Intronic
1153083750 18:1258915-1258937 AGCTTTCTGACTTTTCGATGTGG - Intergenic
1153094522 18:1385204-1385226 ATTTTTCAGACTTGTTTATGTGG - Intergenic
1153094614 18:1386336-1386358 ATCTTTCTAACTTTTTTATGTGG - Intergenic
1153143473 18:2001412-2001434 ATATTTCAGACTATCACATGGGG + Intergenic
1153422098 18:4917878-4917900 ATATTTCAGACTATCACATGGGG + Intergenic
1153424680 18:4949093-4949115 ATCTTTCTAAGTTTTTCATGTGG - Intergenic
1153664516 18:7357005-7357027 ATTTTACAGATTTATCCATGTGG + Intergenic
1153827286 18:8887181-8887203 ATCTTTCATACTTTCTCTTGTGG + Intergenic
1154530925 18:15344372-15344394 ATATTTCAGACTATCACATGGGG + Intergenic
1155115424 18:22761416-22761438 ATCTTTCCTGCTTTTCCCTGTGG - Intergenic
1155464877 18:26122824-26122846 ATTTTGCAGACTTCTTCATGCGG - Intergenic
1155472131 18:26202432-26202454 ATATTTCAGACTATCACATGGGG + Intergenic
1156099075 18:33572223-33572245 ATCTTTGATCCTTTTCCTTGGGG + Intergenic
1156563106 18:38151845-38151867 ATTTTACAGACTATGCCATGTGG - Intergenic
1156563166 18:38152502-38152524 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1156634973 18:39016524-39016546 ATCTCTCAAAGTTATCCATGAGG + Intergenic
1156745093 18:40380850-40380872 ATGTTTCAGATTTTTCCCAGGGG - Intergenic
1156808882 18:41223459-41223481 ATCTTTCCAACTATTCTATGGGG - Intergenic
1156815467 18:41305752-41305774 ATTTTTCAGACTTTTGCATTTGG + Intergenic
1157052022 18:44177413-44177435 AGCTTTCAGACTATTCCACCTGG + Intergenic
1157218848 18:45809755-45809777 CTCTTTCAGACCTTTTGATGTGG - Intergenic
1158260401 18:55600009-55600031 ATCTGTGAGATTTGTCCATGTGG + Intronic
1158342300 18:56479984-56480006 ATCCTTCTGACTTTTCCATCTGG + Intergenic
1159170527 18:64760550-64760572 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1159336737 18:67077382-67077404 ATATTTCAGACTATCACATGGGG + Intergenic
1159413027 18:68105841-68105863 ATGTTTCAGACTATCACATGGGG + Intergenic
1159477566 18:68942867-68942889 ATGTTTCAGACTATCACATGGGG + Intronic
1159484938 18:69043450-69043472 ATATTTCAGACTATCACATGGGG + Intronic
1159606448 18:70479499-70479521 ATATTTCAGACTATCACATGGGG - Intergenic
1159606801 18:70483026-70483048 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1159723473 18:71922824-71922846 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1159763454 18:72456714-72456736 ATTTTAAAGACTTTTTCATGAGG + Intergenic
1159905786 18:74090512-74090534 ATCTTTCTAACTTTTCGATGTGG + Intronic
1160593740 18:79960464-79960486 ATATTTCAGACTATCACATGGGG - Intergenic
1160675168 19:387019-387041 ATATTTCAGACTGTCACATGGGG - Intergenic
1162668144 19:12232421-12232443 ATATTTCAGACTATCACATGGGG + Intronic
1163264704 19:16212705-16212727 ATCTTTCTAACTTTTTGATGTGG + Intronic
1163628178 19:18402815-18402837 ATGTTTCAGACTATCCCATGGGG - Intergenic
1163898810 19:20082686-20082708 ATATTTCAGACTATCACATGGGG - Intronic
1163907072 19:20156938-20156960 ATATTTCAGACTATCACATGGGG + Intergenic
1163920706 19:20286099-20286121 ATATTTCAGACTATCACATGGGG - Intergenic
1164002239 19:21112684-21112706 ATCTTTCTGGCTTTTTCATTTGG + Intronic
1164049018 19:21568291-21568313 ATATTTCAGACTATCACATGGGG - Intergenic
1164122834 19:22283883-22283905 ATATTTCAGACTATCACATGGGG - Intergenic
1164153673 19:22575285-22575307 ATATTTCAGACTATCACATGGGG - Intergenic
1164154347 19:22581139-22581161 ATATTTCAGACTATCACATGGGG - Intergenic
1164276620 19:23724239-23724261 ATATTTCAGACTGTCACATGGGG + Intergenic
1164370365 19:27638188-27638210 ATATTTCAGACTATCACATGGGG + Intergenic
1164484339 19:28641849-28641871 AAGTTTCACTCTTTTCCATGAGG + Intergenic
1164489031 19:28689910-28689932 ATATTTCAGACTATCACATGGGG + Intergenic
1165506459 19:36233962-36233984 ATATTTCAGACTATCACATGGGG + Intronic
1165508095 19:36247563-36247585 ATATTTCAGACTATCACATGGGG + Intergenic
1165595088 19:37006506-37006528 ATATTTCAGACTATCACATGGGG - Intergenic
1165634794 19:37331738-37331760 ATCTTTCAGACTATCACATGGGG - Intronic
1165666219 19:37630543-37630565 ATATTTCAGACTATCACATGGGG + Intronic
1165691397 19:37866524-37866546 ATATTTCAGACTATCACATGGGG - Intergenic
1165814252 19:38631731-38631753 ATATTTCAGACTATCACATGGGG + Intronic
1165936082 19:39389869-39389891 AGCTTTCAGACTCTGCCATGGGG - Intronic
1165952036 19:39479832-39479854 ATATTTCAGACTATCACATGGGG - Intergenic
1166248027 19:41544956-41544978 ATATTTCAGACTATCACATGGGG - Intergenic
1166260394 19:41635793-41635815 ATCTTTCCCACTTTCTCATGTGG + Intronic
1166263478 19:41660064-41660086 ATCTTTCCCACTTTCTCATGTGG - Intronic
1166264125 19:41666590-41666612 ATTTTTCAGACTTTTCGTTCTGG - Intronic
1166653635 19:44594443-44594465 ATATTTCAGACTATCACATGGGG - Intergenic
1167336568 19:48889983-48890005 ATATTTCAGACTATCACATGGGG - Intronic
1167818596 19:51906040-51906062 ATATTTCAGACTATCACATGGGG - Intronic
1167818972 19:51908788-51908810 ATATTTCAGACTATCACATGGGG + Intronic
1167833112 19:52043480-52043502 ATATTTCAGACTATCACATGGGG - Intronic
1167876930 19:52421555-52421577 ATATTTCAGACTATCACATGGGG + Intergenic
1167884041 19:52485884-52485906 ATATTTCAGACTGTCACATGGGG - Intronic
1167910528 19:52698337-52698359 ATATTTCAGACTATCACATGGGG + Intergenic
1167952602 19:53039171-53039193 ATTTTTCAGACTTTTACAATTGG - Intergenic
1168052353 19:53838973-53838995 ATATTTCAGACTATCACATGGGG - Intergenic
1168235422 19:55060050-55060072 ATATTTCAGACTATCCCACGGGG - Intronic
1168461187 19:56559922-56559944 ATATTTCAGACTATCACATGGGG + Intergenic
1168563635 19:57404431-57404453 GTCCTTCAGACTTTCCCAGGAGG - Intronic
1202676091 1_KI270711v1_random:8152-8174 CTCTTTCATTCTTTTCCATTTGG - Intergenic
924967842 2:94410-94432 ATATTTCAGACTATCACATGGGG - Intergenic
925037662 2:703178-703200 ATATTTCAGACTATCACATGGGG + Intergenic
925101142 2:1246979-1247001 GTATTTCAGATTTTTCTATGAGG - Intronic
925441693 2:3893056-3893078 GTTTTTCAGACTTTTTGATGCGG + Intergenic
925795461 2:7537090-7537112 CTCTTTCAGACTTTTTGATGTGG + Intergenic
926148076 2:10408956-10408978 ATCTTTTTTACTTTTCAATGCGG - Intronic
926557028 2:14370338-14370360 ATCTTTCTAACTTTTTGATGTGG - Intergenic
926572333 2:14543491-14543513 ATTTTTCAGCCTTGTCCAGGAGG - Intergenic
927036466 2:19182562-19182584 CTCTTTCAGACTTTTTGATGTGG + Intergenic
927117530 2:19919617-19919639 ATCTTTCCTGCTTTCCCATGTGG - Intronic
927188827 2:20501798-20501820 ATATTTCAGACTATCACATGGGG + Intergenic
927292312 2:21416889-21416911 ATCCTTCAGACTTGTAAATGAGG + Intergenic
927992828 2:27460326-27460348 ATATTTCAGACTATCACATGGGG - Intronic
928355877 2:30614070-30614092 ATATTTCAGACTATCACATGGGG + Intronic
928540028 2:32276180-32276202 ATATTTCAGACTATCACATGGGG + Intergenic
928990228 2:37225665-37225687 ATATTTCAGACTATCACATGGGG - Intronic
929208093 2:39321508-39321530 ATATTTCAGACTATCACATGGGG - Intronic
929529606 2:42739990-42740012 ACCTTTCAAAGTTATCCATGAGG + Intronic
929838315 2:45428698-45428720 ATCTTTCCCACTTTCCCCTGTGG - Intronic
930017947 2:46983758-46983780 ATTTTACAGACTTTCCCATAAGG - Intronic
930135694 2:47902416-47902438 ATTTTTCAAAGCTTTCCATGGGG - Intronic
930143418 2:47976563-47976585 ATCTTTCACACTTTCTCTTGTGG - Intergenic
930586246 2:53270345-53270367 ATCTTTCTAACTTTTTGATGTGG - Intergenic
930598827 2:53420845-53420867 ATCTTTCTAACTTTTTGATGTGG + Intergenic
930786827 2:55279620-55279642 ATATTTCAGACTATCACATGGGG - Intergenic
930838198 2:55817023-55817045 ATCTTTCCTGCTTTTCCTTGTGG - Intergenic
930899970 2:56494299-56494321 ATCTTTCAAACTTTTTGATGTGG + Intergenic
931136755 2:59411599-59411621 CTCTTTCAGACTTTTTGATGTGG + Intergenic
931211808 2:60204432-60204454 ATCTTTCTCACTTTCTCATGTGG + Intergenic
931710271 2:64983757-64983779 ATCCTTCAGATTGATCCATGTGG + Intergenic
932512008 2:72301946-72301968 ATCTTTCTAACTTTTTGATGTGG + Intronic
933336075 2:80961376-80961398 ATCTTTCTAACTTTTTGATGTGG + Intergenic
933436341 2:82255338-82255360 ATCTTGCAGACTTGTTTATGTGG + Intergenic
933838042 2:86261647-86261669 ATATTTCAGACTATCACATGGGG - Intronic
934542969 2:95191718-95191740 ATATTTCAGACTATCACATGGGG - Intergenic
934549277 2:95245072-95245094 ATCTTTCTAGCTTTTTCATGTGG - Intronic
934897371 2:98130466-98130488 ATATTTCAGACTGTCACATGGGG + Intronic
934996351 2:98964764-98964786 ATCTTTCTAACTTTTTGATGTGG + Intergenic
935180438 2:100685214-100685236 ATATTTCAGACTGTCACATGGGG - Intergenic
935491297 2:103723648-103723670 ATCTTTGAAAATGTTCCATGTGG + Intergenic
935656152 2:105425405-105425427 ATATTTCAGACTATCACATGGGG - Intronic
935841640 2:107118559-107118581 ATCGTGCAGTCTTTTCCATTAGG + Intergenic
935861568 2:107336852-107336874 AACTTTCAGCCCTTTCCTTGCGG + Intergenic
935929746 2:108111662-108111684 ATTTTGCAGACTTGTCTATGTGG + Intergenic
936014437 2:108947129-108947151 AGGTTTCAGACTTTTGCATGGGG - Intronic
936107497 2:109637465-109637487 ATATTTCAGACTATCACATGGGG + Intergenic
936378526 2:111963440-111963462 ATATTTCAGACTATCACATGGGG + Intronic
936486995 2:112934602-112934624 ATATTTCAGACTATCACATGGGG - Intergenic
936639994 2:114301416-114301438 ATCTTTCCCACTTTCCCCTGTGG + Intergenic
936797982 2:116230390-116230412 ATCTTTCTAACTTTTTGATGTGG - Intergenic
936847618 2:116855550-116855572 ATCTTTCTAACTTTTTGATGTGG - Intergenic
937196034 2:120157321-120157343 ATCTTTCTAACTTTTTGATGTGG - Intronic
938235363 2:129701728-129701750 ATATTTCAGACTATCACATGGGG - Intergenic
938270118 2:129962563-129962585 ATATTTCAGACTATCACATGGGG + Intergenic
938486995 2:131721572-131721594 ATATTTCAGACTATCACATGGGG - Intergenic
938530015 2:132175646-132175668 ATATTTCAGACTATCACATGTGG + Intronic
938538385 2:132265165-132265187 ATCTTTCAAACCCTTCCTTGAGG - Intergenic
939180677 2:138798960-138798982 ATCTTTCCCACTTTCTCATGTGG - Intergenic
939187599 2:138878880-138878902 AGCTCTGGGACTTTTCCATGGGG - Intergenic
939374277 2:141343978-141344000 ATCTTCCAGACTGTGGCATGGGG - Intronic
939750304 2:146036147-146036169 ATCTTTCTGACTATTCCTGGTGG - Intergenic
940017349 2:149121082-149121104 ATCATTAAGACTTTGCCAGGCGG - Intronic
940358343 2:152769706-152769728 ATATTTCAGACTATCACATGGGG + Intergenic
940437859 2:153675898-153675920 ATCTTTCTAACTTTTTGATGTGG - Intergenic
940539849 2:154998976-154998998 ATTGTTCAGACTTTTCACTGTGG - Intergenic
940708176 2:157129652-157129674 ATCTTTCTAACTTTTTGATGTGG - Intergenic
941262040 2:163309482-163309504 ACATTTCAGACTGTTTCATGTGG + Intergenic
941278896 2:163525476-163525498 ATCTTTCTAACTTTTTGATGTGG + Intergenic
941704965 2:168648631-168648653 ATCTTTCCAACTTTTTGATGTGG + Intronic
942650582 2:178163152-178163174 ATATTTCAGACATTTCCATCAGG - Intergenic
942700081 2:178697605-178697627 ATCATTCAGACTTTTCTGAGTGG - Intronic
942949438 2:181705451-181705473 ATCTTTCTAACTTTTTGATGTGG - Intergenic
943368907 2:186991209-186991231 ATCTTTCCTACTTTTGCTTGTGG - Intergenic
943455870 2:188105882-188105904 ATCTTTCTAACTTTTTGATGTGG - Intergenic
943838232 2:192542539-192542561 ATATTTCAGACTATCACATGGGG + Intergenic
943880917 2:193142769-193142791 ATATTTCAGACTATCACATGGGG - Intergenic
943923763 2:193744304-193744326 ATCATTCTAACTTTTTCATGTGG - Intergenic
943977695 2:194504910-194504932 ATATTTCAGACTATCACATGGGG + Intergenic
944045942 2:195412092-195412114 CTCTTTCTGCCTTTTCCAAGTGG + Intergenic
944436814 2:199698659-199698681 ATCTTTCTAACTTTTTGATGTGG - Intergenic
944464006 2:199982443-199982465 ATATTTCAGAGTTTTTCTTGAGG - Intronic
944471563 2:200058664-200058686 ATCTTTCTAACTTTTTGATGTGG - Intergenic
944581977 2:201139349-201139371 ATATTTCAGACTATCACATGGGG - Intronic
944941339 2:204631661-204631683 ATTTTGCAGACTTTTTAATGTGG + Intronic
944995748 2:205291769-205291791 CTTTTTCAGACTTTTCAATATGG - Intronic
945175202 2:207037172-207037194 ATATTTCAGACTATCACATGGGG - Intergenic
945299157 2:208199902-208199924 ATATTTCAGACTATCACATGGGG - Intergenic
945357055 2:208852952-208852974 ATCTTTCTGACTTTCTGATGTGG + Intronic
945608625 2:211970001-211970023 ATCTTTCTAACTTTTTGATGTGG + Intronic
945761348 2:213919393-213919415 ATCTTTCTAACTTTTTGATGTGG + Intronic
945832380 2:214803232-214803254 ATATTTCAGACTATCACATGGGG - Intronic
946204723 2:218095886-218095908 ATATTTCAGACTATCACATGGGG - Intergenic
946525948 2:220520532-220520554 ATCTATCAGTCTTTGACATGTGG + Intergenic
947273423 2:228364240-228364262 ATATTTCAGACTATCACATGGGG + Intergenic
947520755 2:230844235-230844257 ATATTTCAGACTATCACATGGGG + Intergenic
947619074 2:231577123-231577145 ATATTTCAGACTATCACATGGGG - Intergenic
947730090 2:232423353-232423375 ATATTTCAGACTATCACATGGGG - Intergenic
947953563 2:234168663-234168685 ATATTTCAGACTATCACATGGGG + Intergenic
948291528 2:236828593-236828615 ATCTTCCCGACTTTTCCCTGTGG - Intergenic
948343403 2:237274261-237274283 ATCTTTCTAACTTTTTAATGTGG - Intergenic
1169247438 20:4034594-4034616 ATATTTCAGACTCTCACATGGGG + Intergenic
1169940346 20:10930356-10930378 ATCTTTCCCACTTTCTCATGTGG - Intergenic
1170283347 20:14676599-14676621 ATCTTTCACACTTTCTCCTGTGG - Intronic
1170299884 20:14871604-14871626 ATTTTTCAGACTTGTTTATGTGG - Intronic
1170378417 20:15728989-15729011 ATCTTTCTAACTTTTTGATGTGG + Intronic
1170492413 20:16891664-16891686 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1170596527 20:17810086-17810108 ATTGTTCAAACTGTTCCATGTGG - Intergenic
1170737182 20:19022246-19022268 TTCCTTCATACTTTTCCAGGGGG + Intergenic
1171081758 20:22193871-22193893 ATCTTTCTAGCTTTTTCATGTGG - Intergenic
1171158661 20:22900562-22900584 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1171264178 20:23756877-23756899 ATATTTCAGACTTTCATATGGGG + Intergenic
1171272875 20:23829949-23829971 ATATTTCAGACTATCACATGGGG + Intergenic
1171291015 20:23982990-23983012 ATATTTCAGACTGTCACATGGGG - Intergenic
1171362258 20:24596064-24596086 ATCTTTCTAACTTTTTGATGTGG + Intronic
1171451880 20:25241596-25241618 ATATTTCAGACTATCACATGGGG - Intergenic
1171770162 20:29316782-29316804 ATATTTCAGACTATCACATGGGG + Intergenic
1171783318 20:29440886-29440908 ATATTTCAGACTATCACATGGGG + Intergenic
1171812871 20:29759577-29759599 ATATTTCAGACTATCACATGGGG + Intergenic
1171824738 20:29884613-29884635 ATATTTCAGACTATTGCATGGGG + Intergenic
1171867292 20:30496973-30496995 ATCTTTCAAACCCTTCCTTGAGG - Intergenic
1171900341 20:30850510-30850532 ATATTTCAGACTATCACATGGGG + Intergenic
1172448745 20:35007171-35007193 GTCTTTCAGATTTTTTCATATGG - Intronic
1172479513 20:35262722-35262744 ATATTTCAGACTATCACATGGGG + Intronic
1173319056 20:41971243-41971265 ATATTTCAGACTATCACATGGGG - Intergenic
1173712047 20:45167017-45167039 ATCTTTCTAACTTTTTAATGTGG - Intergenic
1174440209 20:50545501-50545523 CTTTTTCAGACTAATCCATGAGG - Intronic
1175573490 20:60041779-60041801 ATATTTCAGACTATCACATGGGG + Intergenic
1176349092 21:5775991-5776013 ATTTTTCAGACTTGTTTATGTGG - Intergenic
1176355906 21:5896575-5896597 ATTTTTCAGACTTGTTTATGTGG - Intergenic
1176543413 21:8174061-8174083 ATTTTTCAGACTTGTTTATGTGG - Intergenic
1176562364 21:8357106-8357128 ATTTTTCAGACTTGTTTATGTGG - Intergenic
1176766486 21:13024090-13024112 ATATTTCAGACTATTACATGGGG - Intergenic
1176881415 21:14199130-14199152 ATCTTTCTAACTTTTTGATGTGG - Intronic
1176888168 21:14281542-14281564 ATATTTCAGACTATCACATGGGG + Intergenic
1177134471 21:17294400-17294422 ATCTTTCCAACTTTTTGATGTGG - Intergenic
1177175164 21:17694814-17694836 ATATTTCAGACTATCACATGGGG + Intergenic
1177249123 21:18569275-18569297 ATATTTCAGACTATCACATGGGG + Intergenic
1177694868 21:24557846-24557868 ATCTTTCCCACTTTCTCATGTGG - Intergenic
1178546369 21:33496102-33496124 TGCTTTCAGAGTTTTCCATCTGG - Intergenic
1178741220 21:35203579-35203601 ATTTCTCAGAGTTTCCCATGAGG + Intronic
1178912911 21:36690581-36690603 ATCTTTCAGACTATATCACGTGG + Intergenic
1180315568 22:11274647-11274669 ATATTTCAGACTATCACATGGGG + Intergenic
1180333009 22:11550010-11550032 ATATTTCAGACTATCACATGGGG - Intergenic
1180333706 22:11556501-11556523 ATATTTCAGACTATCACATGGGG + Intergenic
1180431052 22:15250637-15250659 ATATTTCAGACTATCACATGGGG - Intergenic
1180491385 22:15852145-15852167 ATATTTCAGACTATCACATGGGG - Intergenic
1180513613 22:16118538-16118560 ATATTTCAGACTATCACATGGGG - Intergenic
1180606017 22:17059511-17059533 ATATTTCAGACTATCACATGGGG - Intergenic
1180837723 22:18939021-18939043 ATATTTCAGACTATCACATGGGG - Intergenic
1180838632 22:18947232-18947254 ATATTTCAGACTATCACATGGGG - Intergenic
1181412830 22:22736470-22736492 ATCCCTCAGACTTTTCCCTTAGG - Intronic
1181534873 22:23536409-23536431 ATATTTCAGACTGTCACATGGGG - Intergenic
1181594827 22:23907431-23907453 ATATTTCAGACTATCACATGGGG - Intergenic
1181642621 22:24211487-24211509 ATATTTCAGACTGTCACATGGGG + Intergenic
1181702928 22:24631041-24631063 ATATTTCAGACTGTCACATGGGG + Intergenic
1181864060 22:25841296-25841318 ATCTTCCAGAAGTATCCATGGGG + Intronic
1182820096 22:33208261-33208283 ATCTTCCAGCCTGTTCTATGTGG - Intronic
1182968499 22:34548199-34548221 ATCTTTCTAACTTTTTGATGCGG - Intergenic
1183041967 22:35187565-35187587 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1183767522 22:39892968-39892990 ATCTTCCAGAGCTTACCATGTGG + Intronic
1183798369 22:40140033-40140055 ATGGTTCATACATTTCCATGTGG + Intronic
1183798666 22:40142871-40142893 ATGGTTCATACATTTCCATGTGG - Intronic
1203248280 22_KI270733v1_random:90280-90302 ATTTTTCAGACTTGTTTATGTGG - Intergenic
1203287814 22_KI270734v1_random:164320-164342 ATATTTCAGACTATCACATGGGG - Intergenic
949108014 3:223958-223980 ATTTTTCAGACTCTTGCATTTGG - Intronic
949297664 3:2544979-2545001 ATCTTTCTGAATTTTTGATGTGG + Intronic
949547178 3:5082194-5082216 ATATTTCAGACTATCACATGGGG + Intergenic
949593898 3:5523870-5523892 ATCTTTCTAACTTTTTGATGTGG + Intergenic
949601462 3:5602976-5602998 ATCTTTCTAACTTTTTTATGTGG - Intergenic
949897772 3:8782206-8782228 AAATTTCATACTTTTGCATGTGG - Intronic
950030400 3:9848280-9848302 ATATTTCAGACTATCACATGGGG + Intronic
950607124 3:14091783-14091805 ATATTTCAGACTATCACATGGGG + Intergenic
950629535 3:14273191-14273213 ATATTTCAGACTATCACATGGGG - Intergenic
950848668 3:16040970-16040992 ATCTTTCTAACTTTTCTGTGTGG + Intergenic
951235953 3:20236560-20236582 AGCTTTCAGACTTTTTTAGGGGG - Intergenic
951260869 3:20506345-20506367 ATCTTTCTAACTTTTTGATGTGG + Intergenic
951309220 3:21103609-21103631 ATCTTTCTAACTTTTTCTTGCGG + Intergenic
951745490 3:25973184-25973206 ATCTGTCATCCTTTGCCATGAGG + Intergenic
951763987 3:26176575-26176597 CTCTTTCAGACTTTTTGATGTGG + Intergenic
951886683 3:27531619-27531641 ATATTTCAGACTATCACATGGGG - Intergenic
952025167 3:29071863-29071885 ATCTTTCTAACTTTTTGATGTGG + Intergenic
952685375 3:36141700-36141722 ATATTTCAGACTATCACATGGGG + Intergenic
953059949 3:39418897-39418919 ATATTTCAGACTATCACATGGGG + Intergenic
953079789 3:39605757-39605779 ATCTTTCTAACTTTTTGATGTGG + Intergenic
953960076 3:47259881-47259903 ATATTTCAGACTATCACATGGGG - Intronic
954267621 3:49482254-49482276 ATATTTCAGACTATCACATGGGG - Intronic
954440660 3:50520229-50520251 ATATTTCAGACTATCACATGGGG - Intergenic
954491264 3:50908333-50908355 ATCTTTCTGGCTTTTTGATGTGG + Intronic
954498991 3:50992125-50992147 ATCTTTCTAACTTTTTGATGTGG - Intronic
954896306 3:53978112-53978134 ATATTTCAGACTATCACATGGGG + Intergenic
955257103 3:57343562-57343584 ATATTTCAGACTATCACATGGGG - Intronic
956049552 3:65233034-65233056 ATCTCTGAGATTTATCCATGTGG + Intergenic
956356006 3:68392889-68392911 ATCTTTCCCACTTTCTCATGTGG - Intronic
956705655 3:71996698-71996720 ATCTCTCTGACCTTTCCCTGAGG + Intergenic
957025398 3:75176100-75176122 AAATTTCTGATTTTTCCATGGGG - Intergenic
957067542 3:75538098-75538120 ATATTTCAGACTATCACATGGGG - Intergenic
957069880 3:75559347-75559369 ATATTTCAGACTATCACATGGGG - Intergenic
957344855 3:78947556-78947578 ATCTTTCCTACTTTTCCTTGTGG - Intronic
957816403 3:85303988-85304010 ATCTCTAAGACTTTTGTATGTGG - Intronic
958082538 3:88765057-88765079 ATCTTTCTAACTTTTTCATGTGG + Intergenic
958272344 3:91518179-91518201 TTCTTTCTGGTTTTTCCATGAGG + Intergenic
958464941 3:94445800-94445822 ATCTTTCTAACTTTTTAATGTGG - Intergenic
958608365 3:96390212-96390234 ATCTTTCTAACTTTTTGATGTGG + Intergenic
958721243 3:97846454-97846476 ATGTTCCAGACATTTCCCTGTGG + Intronic
958765585 3:98363185-98363207 ATATTTCAGACTATCACATGGGG + Intergenic
958873754 3:99591894-99591916 ATCTTTCCTGCTTTTCCTTGTGG - Intergenic
958912207 3:100006452-100006474 ATCTTTCAGTGCTTTTCATGAGG + Intronic
958937557 3:100273091-100273113 ATATTTCAGACTATCACATGGGG + Intronic
958943266 3:100336924-100336946 ATATTTCAGACTATCACATGGGG + Intronic
958975782 3:100666738-100666760 ATATTTCAGACTATCACATGGGG + Intronic
959069864 3:101692241-101692263 ATATTTCAGACTATCACATGGGG - Intergenic
959070769 3:101700395-101700417 ATATTTCAGACTATCACATGGGG - Intergenic
959071311 3:101704431-101704453 ATATTTCAGACTATCACATGGGG + Intergenic
959143147 3:102510496-102510518 TTCTTTCAGACATTTGCATTAGG - Intergenic
959369588 3:105506398-105506420 GTATTTCAGTCTTTTCCATGTGG + Intronic
959482529 3:106890720-106890742 ATCTTTCTAACTTTTTGATGTGG - Intergenic
959606533 3:108247456-108247478 AACTTTGAGATTTTTCCAGGTGG + Intergenic
959801287 3:110498061-110498083 ATCTTTCCCACTTTTTCCTGTGG - Intergenic
959815377 3:110667934-110667956 ATCTTGAAGATTGTTCCATGTGG - Intergenic
959885059 3:111489469-111489491 TTATTTCAGACTTTTCAATTTGG - Intronic
959985289 3:112564677-112564699 ATATTTCAGACTATCACATGGGG + Intronic
960027443 3:113024875-113024897 ATATTTCAGACTATCACATGGGG + Intergenic
960028356 3:113033074-113033096 ATATTTCAGACTATCACATGGGG + Intergenic
960069712 3:113415471-113415493 ATCTTTCTGGCTTTTTGATGTGG + Intronic
960118646 3:113924381-113924403 ATCTTTCTAACTGTTTCATGTGG + Intronic
960152826 3:114268221-114268243 TTCTTTCAGACTTTTTGATGTGG + Intergenic
960343209 3:116500367-116500389 ATCTTTCTAACTTTTTGATGTGG - Intronic
960502263 3:118452629-118452651 ATTTTGCAGACTTTTTTATGTGG + Intergenic
960560164 3:119074546-119074568 ATCTTTCTAACTTTTTGATGTGG - Intronic
960685946 3:120293732-120293754 ATCTTTCTAACTTTTTGATGTGG - Intergenic
960688359 3:120316581-120316603 ATCTTTCTAACTTTTTGATGTGG - Intergenic
960764334 3:121109334-121109356 ATCTTTCTAGCTTTTCGATGTGG + Intronic
960782343 3:121333408-121333430 ATCTTTCCAACTTTTTGATGTGG - Intronic
960809135 3:121611716-121611738 ATATTTCAGACTATCACATGGGG + Intronic
961285610 3:125799875-125799897 ATATTTCAGACTATCACATGGGG + Intergenic
961296737 3:125890798-125890820 ATATTTCAGACTATCACATGGGG - Intergenic
961297557 3:125899132-125899154 ATATTTCAGACTATCACATGGGG - Intergenic
961512604 3:127412260-127412282 ATATTTCAGACTATCACATGGGG + Intergenic
961834039 3:129641693-129641715 ATATTTCAGACTATCACATGGGG + Intergenic
961890149 3:130123965-130123987 ATATTTCAGACTATCACATGGGG + Intergenic
962034689 3:131639045-131639067 CTCTTTCAGACTTTTTGATGTGG - Intronic
962128616 3:132649143-132649165 ATATTTCAGACTATCACATGGGG - Intronic
962639860 3:137374446-137374468 ATCTTTCCCACTTTCTCATGTGG + Intergenic
962655398 3:137539321-137539343 ATCTTTCTAACTTTTTGATGTGG + Intergenic
962997461 3:140645082-140645104 ATCTTTCTAACTTTTTGATGTGG + Intergenic
963013668 3:140800369-140800391 ATCTTTCCCACTTTCCCCTGTGG + Intergenic
963216328 3:142752674-142752696 ATATTTCAGACTATCACATGGGG + Intronic
963407852 3:144890674-144890696 ATCTTACTGACATTGCCATGAGG + Intergenic
963535438 3:146522608-146522630 ATATTTCAGACTATCACATGGGG - Intronic
963615040 3:147526008-147526030 ATCTTTCTAACTTTTTGATGTGG + Intergenic
963676942 3:148324074-148324096 ATCTTTCTAACTTTTTAATGTGG + Intergenic
963913653 3:150837844-150837866 ATCTTTCTAACTTTTTGATGTGG + Intergenic
964061859 3:152534953-152534975 ATCTTTCTAACTTTTTAATGTGG + Intergenic
964147012 3:153476065-153476087 CTCTTTCAGACTTTTTGATGTGG + Intergenic
964160899 3:153643658-153643680 CTCTTTCAGACTTTTTGATGTGG - Intergenic
964188576 3:153976665-153976687 ATCTTTAAATCTTTTCCATTTGG + Intergenic
965172066 3:165278397-165278419 ATCTTTCTAACTTTTTGATGTGG + Intergenic
965621641 3:170648249-170648271 ATCTTTCCCACTTTCTCATGTGG + Intronic
965649732 3:170921056-170921078 ATCTTTCCAACTTTTTGATGTGG - Intergenic
965918525 3:173881767-173881789 ACCTCTCAGAGTTATCCATGAGG + Intronic
966000277 3:174941110-174941132 ATCTTTCTAACTTTTTGATGTGG + Intronic
966073367 3:175906148-175906170 ATATTTCAGACTATCACATGGGG + Intergenic
966152622 3:176880827-176880849 ACCTTTCTAACTTTTCAATGTGG - Intergenic
966269998 3:178093310-178093332 ATCTTTCTACCTTTTCAATGTGG - Intergenic
966319374 3:178684197-178684219 GTCCTCCAGACTTATCCATGTGG - Intronic
966361897 3:179138634-179138656 ATCTTTCTGACTTTTTGATGTGG - Intergenic
966652703 3:182319035-182319057 ATCTTTCTAACTTTTTTATGTGG + Intergenic
966733562 3:183170356-183170378 ATATTTCAGACTGTCACATGGGG - Intergenic
966771916 3:183511551-183511573 ATATTTCAGACTATCACATGGGG + Intronic
966964695 3:184978907-184978929 ATCTTTCTAACTTTTCGATGTGG + Intronic
967025875 3:185563146-185563168 ATATTTCAGACTATCACATGGGG + Intergenic
967026784 3:185571358-185571380 ATATTTCAGACTATCACATGGGG + Intergenic
967134380 3:186501283-186501305 ATCTTTCTAACTTTTTGATGTGG + Intergenic
967176559 3:186866098-186866120 ATATTTCAGACTCTCACATGGGG + Intergenic
967179725 3:186893567-186893589 ATATTTCAGACTATCACATGGGG - Intergenic
967350354 3:188507759-188507781 AGGTTTCAGCCTTTTCCAGGGGG - Intronic
967418915 3:189251969-189251991 ATATTTCAGACTATCACATGGGG + Intronic
968095622 3:195928123-195928145 ATATTTCAGACTATCACATGGGG + Intergenic
968217796 3:196908474-196908496 ATCTTTCCAGCTTTTCGATGTGG - Intronic
968221666 3:196944423-196944445 ATATTTCAGACTATCACATGGGG - Intergenic
968375897 4:41136-41158 ATCTCTCAGGCTATTACATGGGG + Intergenic
968387252 4:152340-152362 ATATTTCAGACTATCACATGGGG + Intronic
968987434 4:3883978-3884000 ATATTTCAGACTATCACATGGGG + Intergenic
969000622 4:3977953-3977975 ATATTTCAGACTATCACATGGGG + Intergenic
969001547 4:3986530-3986552 ATATTTCAGACTATCACATGGGG + Intergenic
969012118 4:4074668-4074690 ATATTTCAGACTCTCACATGGGG - Intergenic
969145454 4:5119412-5119434 CTATTTCCCACTTTTCCATGTGG - Intronic
969741966 4:9035041-9035063 ATATTTCAGACTATCACATGGGG + Intergenic
969753395 4:9130720-9130742 ATATTTCAGACTATCACATGGGG - Intergenic
969760449 4:9177428-9177450 ATATTTCAGACTATCGCATGGGG + Intergenic
969812370 4:9658330-9658352 ATATTTCAGACTATCACATGGGG - Intergenic
969813296 4:9666903-9666925 ATATTTCAGACTATCACATGGGG - Intergenic
969837457 4:9854029-9854051 ATCTTTCTAACTTTTTGATGTGG - Intronic
969952344 4:10851237-10851259 ATCTTTCCAACTTTTTGATGTGG + Intergenic
970418076 4:15878905-15878927 ATATTTCAGACTATCACATGGGG - Intergenic
970440430 4:16077012-16077034 ATATTTCAGACTATCACATGGGG - Intronic
971026956 4:22598388-22598410 ATATTTCAGACTATCACATGGGG + Intergenic
971039966 4:22741152-22741174 ATCTTTCTACCTTTTCCAGGTGG - Intergenic
971097688 4:23426604-23426626 ATTTTCCATAATTTTCCATGAGG - Intergenic
971720073 4:30233513-30233535 ATATTTCAGACTATCACATGGGG + Intergenic
971726809 4:30325033-30325055 ATCTTTCTAACTTTTTAATGTGG + Intergenic
972010419 4:34173251-34173273 ATCTTTCTAACTTTTTGATGTGG + Intergenic
972755854 4:42045094-42045116 ATCTTTCCGACTTTCTCCTGTGG - Intronic
972846941 4:43002261-43002283 ATATTTCAGACTATCACATGGGG + Intronic
973129538 4:46633613-46633635 ATCTTTCTGACTTTTTGATGTGG + Intergenic
973273593 4:48285961-48285983 ATATTTCAGACTATCACATGGGG + Intergenic
973283948 4:48393897-48393919 ACCTTTTAAAGTTTTCCATGAGG - Intronic
974184361 4:58427602-58427624 ATCTTTCTAACTTTTTGATGTGG + Intergenic
974230953 4:59112861-59112883 ATCTTTCCTACTTTTTCTTGTGG + Intergenic
974326029 4:60416498-60416520 ATCTTTCCCACTTTCTCATGTGG + Intergenic
974517949 4:62941225-62941247 ATATTTCAGACTGTCACATGGGG - Intergenic
974621127 4:64356224-64356246 ATATTTCAGACTATCACATGGGG - Intronic
974766951 4:66359356-66359378 ATATTTCAGACTATCACATGGGG + Intergenic
974952354 4:68598377-68598399 ATATTTCAGACTATCACATGGGG - Intronic
974952798 4:68602856-68602878 ATATTTCAGACTATCACATGGGG - Intronic
975059106 4:69975353-69975375 ATCTTTCTAACTTTTTGATGTGG + Intergenic
975153761 4:71048102-71048124 ATCTTTCTAGCTTTTGCATGTGG - Intergenic
975246846 4:72129822-72129844 ATATTTCAGACTATCACATGGGG + Intronic
975400068 4:73926777-73926799 ATCTTTCTAACTTTTTGATGTGG - Intergenic
975519707 4:75287225-75287247 ATATTTCAGACTATCACATGGGG + Intergenic
975790283 4:77941981-77942003 CTCTTTCAGATTTTTTGATGTGG + Intronic
976080700 4:81351682-81351704 ATCTGTTTAACTTTTCCATGGGG + Intergenic
976481518 4:85552130-85552152 ATCTTTCAGACTTTTCCATGTGG + Intronic
976845069 4:89479486-89479508 ATCTTTCTGGCTTTTTGATGTGG - Intergenic
976948212 4:90796591-90796613 ATCTTTCTAACTTTTTGATGTGG + Intronic
977497647 4:97798291-97798313 ATCTTTCCTACTTTCTCATGTGG + Intronic
977696784 4:99974562-99974584 ATCTTTCTAACTTTTTTATGTGG - Intergenic
977735182 4:100406341-100406363 ATCTTTCTGATTTTTTGATGTGG + Intronic
977906246 4:102480930-102480952 ATCTTTCACACTTTCTCTTGTGG - Intergenic
977953985 4:103005979-103006001 ATCTTTCTAACTTTTATATGGGG - Intronic
978048914 4:104171345-104171367 ATATTTCAGACTATCACATGGGG - Intergenic
978143800 4:105348350-105348372 ACCTTTCAGACTTTTCCATCTGG - Intergenic
978163475 4:105578031-105578053 ATCTTTTAGACTTTTTAATGTGG + Intronic
978163641 4:105580323-105580345 ATCTTTCTAACTTTTCGATGTGG + Intronic
978208485 4:106107667-106107689 ATCTTTCTAACTTTTTGATGTGG - Intronic
978313546 4:107412282-107412304 ATCTTTCCCACTTTTTCCTGTGG - Intergenic
978336518 4:107675066-107675088 ATCTTTCCTGCTTTTCCTTGTGG - Intronic
978683472 4:111411910-111411932 ATCTTTCTAACTTTTCTATATGG + Intergenic
979116606 4:116832276-116832298 ATCTTTCTAACTTTTTGATGTGG - Intergenic
979141644 4:117183460-117183482 ATATTTCAGACTATCACATGGGG - Intergenic
979159795 4:117445745-117445767 ATCTTAAAGAATGTTCCATGTGG + Intergenic
979179739 4:117709761-117709783 ATTTTGCAGACTTTTTAATGTGG - Intergenic
979322742 4:119343130-119343152 ATATTTCAGACTATCACATGGGG + Intergenic
979327464 4:119396712-119396734 ATATTTCAGACTATCACATGGGG - Intergenic
979346735 4:119595872-119595894 ATCTTTTAGACTTCTCCAGTTGG + Intronic
979497196 4:121396903-121396925 ATATTTCAGACTATCACATGGGG - Intergenic
979501612 4:121446647-121446669 ATATTTCAGACTATCACATGGGG + Intergenic
980333420 4:131439114-131439136 ATTTTTCAGACTTGTTTATGTGG + Intergenic
980380582 4:132010202-132010224 ATCTTTCAGACTATGATATGTGG - Intergenic
980547984 4:134294581-134294603 ATCTTTCTAACTTTTTCATGTGG - Intergenic
981460260 4:145005568-145005590 ATCTTTCTAACTTTTTGATGTGG + Intronic
981644970 4:146988618-146988640 ATCTTTTTGACTTTTTGATGTGG + Intergenic
981968131 4:150631844-150631866 ACCTTTTTGATTTTTCCATGTGG - Intronic
982294949 4:153818265-153818287 ATCTTTCTAACTTTTTGATGTGG - Intergenic
982499383 4:156133922-156133944 ATCTTTCTAACTTTTTGATGTGG - Intergenic
982512860 4:156305360-156305382 ATATTTCAGACTATCACATGGGG + Intergenic
982876584 4:160659133-160659155 ATATTTCAGACTATCACATGGGG - Intergenic
983036094 4:162867687-162867709 CTCTTTCAGACTTTTTGATGTGG - Intergenic
983205467 4:164906112-164906134 ATATTTCAGACTATCACATGGGG + Intergenic
983212749 4:164975734-164975756 ATATTTCAGACTATCACATGGGG - Intronic
983215168 4:164996034-164996056 ATATTTCAGACTATCTCATGGGG - Intergenic
983215886 4:165002297-165002319 ATATTTCAGACTATCACATGGGG - Intergenic
983313277 4:166093692-166093714 ATATTTCAGACTATCACATGGGG + Intronic
983317046 4:166145727-166145749 AGCTTTCAGAATTTTCCCTAGGG - Intergenic
983424256 4:167562119-167562141 ATCTTTCTAACTTTTTCAAGTGG + Intergenic
983456779 4:167974957-167974979 ATCTTTCTAACTTTTTGATGTGG - Intergenic
983747002 4:171213912-171213934 ATCTATCACATTTTTCCTTGTGG - Intergenic
983824378 4:172239693-172239715 ATCTTTCTAACTTTTTTATGTGG + Intronic
983846603 4:172527788-172527810 GAGTTTCAGGCTTTTCCATGAGG + Intronic
983877247 4:172892141-172892163 TTATTTCAGACATTTCAATGTGG + Intronic
983895939 4:173081946-173081968 ATCTTTCCCACTTTTTCATGTGG + Intergenic
984012114 4:174383377-174383399 ATATTTCAGACTATCACATGGGG - Intergenic
984013603 4:174401108-174401130 ATATTTCAGACTATCACATGGGG - Intergenic
984038186 4:174694618-174694640 ATCTTTCCAACTTTTTGATGTGG - Intronic
984144193 4:176041377-176041399 ATCTTTCTAACTTTTTTATGTGG + Intergenic
984407106 4:179347150-179347172 GTCTTCCACACTTTGCCATGGGG - Intergenic
984423440 4:179553774-179553796 ATATTTCAGACTATCACATGGGG + Intergenic
984581731 4:181517700-181517722 ATCATTCAGATTTTTCCCTGTGG - Intergenic
984854259 4:184179904-184179926 ATCTTTCTAGCTTTTCAATGTGG - Intronic
984863998 4:184265573-184265595 ATCTTTCCATATTTTCCATGTGG - Intergenic
985262281 4:188126219-188126241 ACTTTTCTGACTCTTCCATGAGG + Intergenic
985443559 4:190004340-190004362 ATCTTTCTAACTTTTTGATGTGG - Intergenic
985480190 5:105209-105231 GTCTTGAAGACTTCTCCATGAGG + Intergenic
985494582 5:197401-197423 ATATTTCAGACTATCACATGGGG + Exonic
985586185 5:736849-736871 CTCTTTCAGTCTTTTTGATGTGG - Intronic
985600773 5:829031-829053 CTCTTTCAGTCTTTTTGATGTGG - Intronic
985676646 5:1234877-1234899 AATCCTCAGACTTTTCCATGAGG + Intronic
985738092 5:1596575-1596597 ATATTTCAGACTATCACATGGGG + Intergenic
986100602 5:4606598-4606620 ATCTTTCTAACTTTTTGATGTGG - Intergenic
986130477 5:4925276-4925298 ATATTTCAGACTATCACATGGGG - Intergenic
986229461 5:5849229-5849251 ATCTTTCTAACTTTTTGATGTGG + Intergenic
986549613 5:8938088-8938110 ATATTTCAGACTATCACATGGGG - Intergenic
986563673 5:9088910-9088932 AGCTATCAGACTGTGCCATGTGG - Intronic
986620640 5:9669794-9669816 ATCTTTCTAACTTTTTGATGTGG - Intronic
986655677 5:10009044-10009066 ATCTTTCTAACTTTTTGATGTGG - Intergenic
987490845 5:18578802-18578824 ATATTTCAGACTATCACATGGGG - Intergenic
987635062 5:20528776-20528798 ATCTTTCCAGCTTTTTCATGTGG - Intronic
987769728 5:22285491-22285513 ATTTTTCACACTTTTACATAAGG - Intronic
987936038 5:24466116-24466138 ATATTTCAGACTATTACATGGGG - Intergenic
988062988 5:26197782-26197804 ATATTTCAGACTATCACATGGGG - Intergenic
988187564 5:27886981-27887003 ATCTTTCCTACTTTCCCTTGTGG + Intergenic
988379998 5:30487251-30487273 ATATTTCAGACTATCACATGGGG + Intergenic
989505809 5:42226195-42226217 ATCTTTCTGACTTTTTGATTTGG + Intergenic
989640743 5:43580768-43580790 ATATTTCAGACTATCACATGGGG - Intergenic
989693588 5:44173036-44173058 ATCTTTCTAACTTTTTGATGTGG - Intergenic
989737929 5:44731085-44731107 ATATTTCAGACTATCACATGGGG + Intergenic
989789096 5:45371161-45371183 ATATTTCTAACTTTTCAATGTGG - Intronic
989847172 5:46159232-46159254 ATCTTTCCTGCTTTTCCTTGTGG + Intergenic
990134370 5:52627563-52627585 ATCTTTCTAACTTTTTGATGTGG + Intergenic
990195424 5:53309899-53309921 TTCTTTTTAACTTTTCCATGTGG + Intergenic
990414279 5:55571419-55571441 ATATTTCAGACTATCACATGGGG - Intergenic
990475378 5:56157345-56157367 ATATTTCAGACTATCACATGGGG - Intronic
990572263 5:57090808-57090830 ACCTTTCAAAATTATCCATGAGG - Intergenic
990724016 5:58733400-58733422 GTGCTTCAGACTTGTCCATGTGG + Intronic
990789737 5:59464134-59464156 ATATTTCAGACTATCACATGGGG - Intronic
991008689 5:61858558-61858580 ATCTTTCTAACTTTTTGATGTGG - Intergenic
991233502 5:64365157-64365179 ATCTTTCTAACTTTTTGATGTGG + Intronic
991379081 5:65999761-65999783 CCGTTTCAGACTTTTCCTTGAGG + Intronic
991964497 5:72077719-72077741 CTCTTGCTGACTTTTCCATTTGG + Intergenic
992284231 5:75216832-75216854 ATCTTTCTAACTTTTTGATGTGG + Intronic
992320218 5:75606431-75606453 ATATTTCAGACTATCACATGGGG + Intergenic
992355630 5:75979760-75979782 ATCTTTCTAACTTTTTGATGTGG - Intergenic
992484174 5:77180017-77180039 ATCTTTCAGCGTTTTCCTGGGGG + Intergenic
992655938 5:78909713-78909735 ATATTTCAGACTATCACATGGGG - Intronic
992965862 5:81999415-81999437 ATCTTTCTAACTTTTTGATGTGG - Intronic
993018934 5:82567359-82567381 ATCTTTCTAACTTTTCAATGTGG - Intergenic
993146365 5:84098792-84098814 ATCTTTCTAACTTTTTGATGTGG - Intronic
993200444 5:84809254-84809276 ATCTTACAGTCTTTTTTATGAGG - Intergenic
993351013 5:86850524-86850546 ATCTTTCTAACTTTTTGATGTGG + Intergenic
993362492 5:86995181-86995203 ATCTTTCTAACTTTTTGATGTGG + Intergenic
993405563 5:87508280-87508302 CTCTTTCTAACTTTTCAATGTGG - Intergenic
993445380 5:88005290-88005312 GTCTTTCACTGTTTTCCATGAGG + Intergenic
993634072 5:90323328-90323350 ATCTATCTGACTTTTTGATGTGG + Intergenic
993708720 5:91200770-91200792 ATATTTCAGAATTTGCCATTAGG - Intergenic
993801974 5:92352979-92353001 ATCTTTCTAACTTTTTGATGTGG + Intergenic
993833866 5:92792241-92792263 ATCTTTCTAACTTTTTGATGTGG + Intergenic
994235029 5:97353141-97353163 ATCTTTCTAACTTTTTGATGTGG + Intergenic
994400343 5:99271880-99271902 ATCATTCCAACTTTTCCAAGTGG - Intergenic
994404584 5:99328771-99328793 ATATTTCAGACTATCACATGGGG - Intergenic
994470199 5:100194001-100194023 ATCTTTCTGACTTTTTGATGTGG - Intergenic
994532006 5:100983632-100983654 ATATTTCAGACTATCACATGGGG + Intergenic
994614054 5:102081113-102081135 ATCTTTCTAACTTTTTGATGTGG - Intergenic
994657634 5:102613404-102613426 ATCTTTCTAACTTTTTGATGTGG + Intergenic
994936525 5:106259767-106259789 ATATTTCAGACTATCACATGGGG + Intergenic
994970761 5:106733641-106733663 ATCTTTCTTACTTTTTGATGTGG - Intergenic
995219930 5:109636679-109636701 ATCTTTCTAACTTTTTGATGTGG - Intergenic
995298912 5:110555120-110555142 ATCTTTTAAACATTTTCATGTGG + Intronic
995417594 5:111927269-111927291 AGCTTTCAAATTTTTTCATGAGG + Intronic
995428865 5:112052434-112052456 ATCTTTCTAACTTTTTGATGTGG - Intergenic
995488269 5:112661392-112661414 ATCTTTCTAACTTTTTGATGTGG - Intergenic
995750460 5:115448732-115448754 ATATTTCAGACTATCACATGGGG - Intergenic
995878843 5:116821478-116821500 ATATTTCAGACTATCACATGGGG - Intergenic
996071865 5:119140154-119140176 ATCTTTCTGACTTTTTGATGTGG - Intronic
996163425 5:120195282-120195304 ATATTTCAGACTATCACATGGGG + Intergenic
996194909 5:120593047-120593069 ATCTTTCTAACTTTTGGATGTGG - Intronic
996306213 5:122050859-122050881 ATCTTTCTTACTTTTTAATGTGG + Intronic
996469178 5:123839904-123839926 ATCTTTCTAACTTTTTGATGTGG - Intergenic
996602130 5:125276790-125276812 TACCTTCAGACTTTTCCTTGAGG - Intergenic
997010223 5:129868144-129868166 ATCTTTCTAACTTTTTGATGTGG - Intergenic
997100429 5:130962322-130962344 ATCTTTCTAACTTTTTGATGGGG + Intergenic
997908608 5:137845567-137845589 ATCTTTCAGTGATCTCCATGTGG - Intergenic
998189575 5:140011660-140011682 GTCTTTCAGACTCATTCATGTGG - Intronic
998553772 5:143103033-143103055 ATCTTTCACAAATTTTCATGGGG - Intronic
998776300 5:145607354-145607376 ATCTTTCTAACTTTTTGATGTGG + Intronic
998941133 5:147283327-147283349 CTCTTTCAGTCTTTTCAATGTGG - Intronic
999295089 5:150454353-150454375 ATATTTCAGACTATCACATGGGG + Intergenic
999602863 5:153285966-153285988 ATCTTTCCTACTTTCTCATGTGG - Intergenic
999620965 5:153473045-153473067 ATCTTTCTAGCTTTTCAATGTGG + Intergenic
999752196 5:154636583-154636605 ATATTTCAGACTATCACATGGGG + Intergenic
999753046 5:154644277-154644299 ATATTTCAGACTATCACATGGGG + Intergenic
999846658 5:155488974-155488996 ATCTTTCTAACTTTTTGATGTGG + Intergenic
999951718 5:156658304-156658326 ATATTTCAGACTATCACATGGGG + Intronic
999952621 5:156666516-156666538 ATATTTCAGACTATCACATGGGG + Intronic
1000031995 5:157410099-157410121 ATCTTTCTAACTTTTTGATGAGG - Intronic
1000158822 5:158579339-158579361 CTCTTTCAGACTTTTTGATGTGG + Intergenic
1000477758 5:161732525-161732547 ATTCTTTAGATTTTTCCATGTGG - Intergenic
1000527007 5:162370480-162370502 ATATTTCAGACTATCACATGGGG - Intergenic
1001232118 5:169997473-169997495 ATATTTCAGACTATCACATGGGG + Intronic
1001402564 5:171454375-171454397 AGCTTCCAGAATTTTCCATGGGG + Intronic
1002007711 5:176250027-176250049 ATCTTTCCGGCTTTTTCCTGTGG + Intronic
1002218666 5:177660602-177660624 ATCTTTCCGGCTTTTTCCTGTGG - Intergenic
1002482812 5:179514561-179514583 ATATTTCAGACTATCACATGGGG + Intergenic
1002650598 5:180690173-180690195 ATATTTCAGACTATCACATGGGG + Intergenic
1003063412 6:2880320-2880342 CTCTTTCAGGCTTTTTGATGTGG - Intergenic
1003066582 6:2909011-2909033 ATATTTCAGACTATCCCATGGGG - Intergenic
1003437331 6:6103474-6103496 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1003577240 6:7308745-7308767 CTCTTTCAGACTTTTTTTTGGGG - Intronic
1004320663 6:14628994-14629016 ACCTTTGAGACCTTTCCAAGAGG + Intergenic
1004716948 6:18227087-18227109 ATATTTCAGACTATGACATGGGG - Intronic
1004907022 6:20245397-20245419 ATTTTTCAGACTTTTCATTCTGG - Intergenic
1005293412 6:24400650-24400672 ATATTTCAGACTATCACATGGGG + Intergenic
1005351898 6:24944297-24944319 ATCTTGCAGTCTTTGCCAAGGGG - Intronic
1005430265 6:25749113-25749135 ATATTTCAGACTATCACATGGGG + Intergenic
1005638758 6:27775058-27775080 ATATTTCAGACTATCACATGGGG + Intergenic
1005644224 6:27826254-27826276 ATATTTCAGACTATCACATGGGG + Intergenic
1005672353 6:28119693-28119715 TTCTTTCTAACTTTTCCATTTGG - Intergenic
1006040439 6:31248843-31248865 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1006048833 6:31324049-31324071 ATCTTTCTAACTTTTTGATGTGG - Intronic
1006238569 6:32657724-32657746 ATATTTCAGACTATCACATGGGG + Intergenic
1006250416 6:32778665-32778687 ATATTTCAGACTATCCCATGGGG + Intergenic
1007354197 6:41299270-41299292 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1007461901 6:42025287-42025309 GTCTCTCAGACTTCTCCCTGGGG - Intronic
1007624915 6:43240124-43240146 ATATTTCAGACTATCACATGGGG + Intergenic
1007793541 6:44328640-44328662 ATATTTCAGACTATCACATGGGG + Intronic
1008267080 6:49440707-49440729 ATCTTTCAGACTTTCCTCTAAGG - Intronic
1008563911 6:52748905-52748927 ATATTTCAGACTATCACATGGGG + Intergenic
1008565290 6:52762177-52762199 ATATTTCAGACTATCACATGGGG - Intronic
1008582974 6:52923019-52923041 ATATTTCAGACTATCACATGGGG - Intergenic
1008751003 6:54734039-54734061 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1009193301 6:60655361-60655383 ATATTTCAGACTATTACATGGGG - Intergenic
1009236550 6:61131129-61131151 ATCTTTCTGACTTTCTCCTGTGG + Intergenic
1009247504 6:61257523-61257545 ATCTTTCTAACTTTTCAATGTGG + Intergenic
1009289267 6:61864333-61864355 ATTTTTCAGACTTGTTCATATGG + Intronic
1009621387 6:66082490-66082512 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1010017183 6:71118886-71118908 ATCTTGGAGAATGTTCCATGTGG + Intergenic
1010023046 6:71183569-71183591 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1010423868 6:75704707-75704729 ATATTTCAGACTATCACATGGGG + Intronic
1010466159 6:76168670-76168692 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1010591471 6:77717543-77717565 ATATTTCAGACTATCACATGGGG + Intronic
1010592408 6:77726005-77726027 ATATTTCAGACTATCACATGGGG + Intronic
1010686403 6:78859135-78859157 ATATTTCAGACTATCACATGGGG - Intergenic
1010750395 6:79611005-79611027 AACTTTCTTACTTTTACATGTGG - Intergenic
1010763130 6:79747663-79747685 ATCTTTCTGACTTTTTGATGTGG + Intergenic
1010839725 6:80635030-80635052 ATATTTCAGACTATCACATGGGG - Intergenic
1011048703 6:83117761-83117783 ATCTCTAAGACTTTTTCAGGGGG - Intronic
1011536542 6:88381935-88381957 ATATTTCAGACTATCACATGGGG - Intergenic
1011579821 6:88848898-88848920 ATTTTTCAGACTCTTCTATATGG + Intronic
1011582955 6:88891376-88891398 ATCTTTCAGACATTTCGTAGTGG - Intronic
1011654928 6:89543520-89543542 ATCTTTCAGACTGTTAGATACGG - Intronic
1011693473 6:89891167-89891189 ATATTTCAGACTATCACATGGGG - Intergenic
1011922616 6:92599628-92599650 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1011967160 6:93173712-93173734 ATATTTCAGACTATCACATGGGG - Intergenic
1012120606 6:95361829-95361851 ATATTTCAGACTATCACATGGGG + Intergenic
1012201480 6:96411612-96411634 GTGTTTAAGACTTTTCTATGGGG - Intergenic
1012345108 6:98175880-98175902 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1012458129 6:99429718-99429740 ATATTTCAGACTATCACATGGGG - Intergenic
1012490393 6:99777093-99777115 ATCTTTCTAACTTTTAGATGTGG + Intergenic
1012514353 6:100041461-100041483 ATCTTTCCCACTTTCTCATGTGG - Intergenic
1012708632 6:102568237-102568259 TGCTTTCAGAATTTTTCATGAGG + Intergenic
1012743923 6:103058318-103058340 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1013555796 6:111255686-111255708 ATATTTCAGACTATCACATGGGG + Intergenic
1013991813 6:116262720-116262742 ATCTTTCTAACTTTTTGATGTGG + Intronic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1014800843 6:125776447-125776469 ATATTTCAGACTATCACATGGGG + Intergenic
1015205773 6:130636981-130637003 ATCTTTCCCACTTTCCAATGTGG - Intergenic
1015261762 6:131246056-131246078 ATGACTCAGACTTTTCCATGAGG + Intronic
1015574794 6:134659708-134659730 ATATTTCAGACTATCACATGGGG + Intergenic
1015698615 6:136010053-136010075 ATCTTTCTAACTTTTCTATGTGG + Intronic
1015878122 6:137844817-137844839 ATATTTCAGACTATCACATGGGG - Intergenic
1015902107 6:138078068-138078090 ATTTTGCAGACTTGTTCATGTGG - Intergenic
1015997129 6:139006760-139006782 AACTTTCAGACTGCTCCCTGTGG + Intergenic
1016177338 6:141096838-141096860 ATATTTCAGACTATCACATGGGG + Intergenic
1016237867 6:141890060-141890082 ATCTTTCTAACTTTTCAATGTGG - Intergenic
1016257303 6:142123177-142123199 AACTTTCATAGTTTTCCATGAGG - Intergenic
1016697536 6:147015604-147015626 ATCTTTCATATTTCTCCATGAGG - Intergenic
1016778169 6:147928770-147928792 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1017160725 6:151363158-151363180 TGCTTTCAGACCTTTCCTTGTGG + Intergenic
1017171125 6:151455808-151455830 ATATTTCAGACTATCACATGGGG + Intronic
1017190229 6:151645804-151645826 TTCTTTCAGTCTTTTTGATGTGG + Intergenic
1017224929 6:152009934-152009956 ATTTTTAAGACTTAGCCATGTGG - Intronic
1017762474 6:157581029-157581051 ATCCTTCTTACTTTTTCATGTGG + Intronic
1017785409 6:157752811-157752833 ATATTTCAGACTATCACATGGGG + Intronic
1018060116 6:160083541-160083563 ATATTTCAGACTATCACATGGGG + Intronic
1018478274 6:164165011-164165033 ACATTTGAGACTTTTCCAAGAGG + Intergenic
1019071254 6:169346883-169346905 ATATTTCAGACTATCACATGGGG + Intergenic
1019071607 6:169350987-169351009 ATCTTTCTCACTTTCCCTTGTGG + Intergenic
1019976145 7:4583024-4583046 ATATTTCAGACTTTCACATGGGG + Intergenic
1020329388 7:7002371-7002393 ATATTTCAGACTATCACATGGGG + Intergenic
1020514032 7:9093675-9093697 ATCTTTCTGACTTCTTGATGTGG - Intergenic
1020533623 7:9365422-9365444 TTATTTCAGACTTTTCAATTTGG - Intergenic
1020607128 7:10353590-10353612 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1021013391 7:15500796-15500818 ATCTTTCCAACTTTTAGATGTGG + Intronic
1021067771 7:16198069-16198091 ATATTTCAGACTATCACATGGGG - Intronic
1021366524 7:19786365-19786387 ATCTTTCTAACTTTTTAATGTGG - Intergenic
1021425903 7:20498897-20498919 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1021671579 7:23040203-23040225 ATATTTCAGACTATCACATGGGG - Intergenic
1021780180 7:24097017-24097039 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1021824471 7:24534721-24534743 ATCTTTCAAACTTTTTGATGTGG + Intergenic
1022164318 7:27742251-27742273 ATATTTCAGACTATCACATGGGG + Intronic
1022477196 7:30719207-30719229 ATATTTCAGACTATCACATGGGG + Intronic
1022545474 7:31184012-31184034 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1022613464 7:31901958-31901980 ATCTTTAAATCTTTTCCATTTGG - Intronic
1022878042 7:34555580-34555602 ATCTTTCTAACTTTTTTATGTGG - Intergenic
1023234985 7:38075941-38075963 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1023248356 7:38231471-38231493 ATATTTCAGACTATCACATGGGG + Intergenic
1023886028 7:44356987-44357009 ATCTTTCTAACTTTTGGATGTGG + Intergenic
1023912971 7:44568437-44568459 ATCTTACAGACTGTTCCATATGG + Intronic
1024313247 7:47990020-47990042 ATATTTCAGACTATCACATGGGG - Intronic
1024545764 7:50516460-50516482 CTCTTTCAGTCTTTTCAATGAGG - Intronic
1024859810 7:53825413-53825435 ACCTTTCTATCTTTTCCATGTGG - Intergenic
1024932234 7:54675808-54675830 ATATTTCAGACTGTCACATGGGG + Intergenic
1025222763 7:57130020-57130042 ATCTTTCTAACTTTTTGATGTGG - Intronic
1025574532 7:62619576-62619598 ATATTTCAGACTATCACATGGGG - Intergenic
1025850986 7:65243631-65243653 ATATTTCAGACTATCACATGGGG + Intergenic
1025853662 7:65260753-65260775 ATATTTCAGACTCTCACATGGGG + Intergenic
1026008667 7:66619556-66619578 ATATTTCAGACTATCACATGGGG + Intergenic
1026736396 7:72951557-72951579 ATATTTCAGACTATCACATGGGG - Intergenic
1026855648 7:73752472-73752494 ATCCCTCAAACTTATCCATGAGG - Intergenic
1027107337 7:75413505-75413527 ATATTTCAGACTATCACATGGGG + Intergenic
1027508021 7:79043115-79043137 ATCTTTCTAACTTTTTGATGTGG - Intronic
1027508171 7:79044844-79044866 AACTGTCAAACTTTTCCAAGTGG - Intronic
1027627193 7:80561040-80561062 ATCTTTCTAACTTTTTGATGTGG + Intronic
1028008955 7:85615587-85615609 ATCTTTCTAACTTTTTCATGTGG - Intergenic
1028077134 7:86530743-86530765 ATCTTTCTAACTTTTCGATATGG + Intergenic
1028183615 7:87754473-87754495 ATCTTTCCTACATTTTCATGTGG - Intronic
1028337541 7:89675913-89675935 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1028394487 7:90352448-90352470 ATCTGTCAGACATTTCCACCAGG - Intronic
1028463427 7:91121849-91121871 AGCTTCCAGTCTTTTCCTTGGGG - Intronic
1028648538 7:93124367-93124389 ATCTTTCCCACTTTCCCCTGTGG - Intergenic
1028780704 7:94732881-94732903 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1028814076 7:95123926-95123948 ACCTTTAATAGTTTTCCATGAGG - Intronic
1029534775 7:101150451-101150473 ATATTTCAGACTATCCCATGGGG + Intergenic
1029790550 7:102838854-102838876 ATATTTCAGACTATCACATGGGG - Intronic
1029966708 7:104748268-104748290 ATATTTCAGACTATCACATGGGG - Intronic
1030009155 7:105149014-105149036 ATATTTCAGACTATCACATGGGG - Intronic
1030094255 7:105884078-105884100 ACATTTCAGGCTTTTCCTTGAGG + Intronic
1030374759 7:108742696-108742718 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1030760314 7:113342115-113342137 ATATTTCAGACTATCACATGGGG + Intergenic
1031606974 7:123780984-123781006 ATATTTCAGACTATCACATGGGG - Intergenic
1031724608 7:125221768-125221790 ATATTTCAGACTATCACATGGGG + Intergenic
1031795414 7:126168507-126168529 ATATTTCAGACTATCACATGGGG - Intergenic
1031888796 7:127269999-127270021 ATATTTCTCACTTTTCAATGTGG + Intergenic
1032249668 7:130244218-130244240 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1032588702 7:133172397-133172419 CTCTGCCAGACTTTTCCAGGTGG - Intergenic
1033212116 7:139467752-139467774 ATATTTCAGACTATCCCATGGGG - Intronic
1033349885 7:140553575-140553597 ATATTTCAGACTATCCCATGAGG + Intronic
1033481951 7:141751481-141751503 ATATTTCAGACTATCACATGGGG - Intronic
1033612729 7:142981334-142981356 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1034019846 7:147629858-147629880 CTCTTTCAGACTTTTTGATGAGG - Intronic
1034055025 7:148025243-148025265 ATTTTCCAGACTTTTGCATTTGG + Intronic
1034229915 7:149515412-149515434 ATCTTGGAGAATGTTCCATGTGG + Intergenic
1035349648 7:158237138-158237160 ATATTTCAGACTATCACATGGGG - Intronic
1035631992 8:1114803-1114825 ATCTTTCCAACTTTTTGATGTGG + Intergenic
1035898826 8:3435397-3435419 ATGTTTCAGGCATTTCTATGAGG - Intronic
1035958529 8:4111058-4111080 TTCTACCAGATTTTTCCATGCGG - Intronic
1036261156 8:7241283-7241305 ATATTTCAGACTATCACATGGGG + Intergenic
1036262783 8:7253538-7253560 ATATTTCAGACTGTTACATGGGG + Intergenic
1036264086 8:7261170-7261192 ATATTTCAGACTGTCACATGGGG + Intergenic
1036265382 8:7268792-7268814 ATATTTCAGACTGTCACATGGGG + Intergenic
1036266683 8:7276414-7276436 ATATTTCAGACTGTCACATGGGG + Intergenic
1036267989 8:7284036-7284058 ATATTTCAGACTGTCACATGGGG + Intergenic
1036269293 8:7291658-7291680 ATATTTCAGACTGTCACATGGGG + Intergenic
1036291693 8:7498473-7498495 ATATTTCAGACTATCACATGGGG + Intronic
1036292624 8:7506976-7506998 ATATTTCAGACTATCACATGGGG + Intronic
1036298603 8:7555421-7555443 ATATTTCAGACTGTCACATGGGG - Intergenic
1036299908 8:7563071-7563093 ATATTTCAGACTGTCACATGGGG - Intergenic
1036301213 8:7570717-7570739 ATATTTCAGACTGTCACATGGGG - Intergenic
1036302513 8:7578366-7578388 ATATTTCAGACTGTCACATGGGG - Intergenic
1036303805 8:7586020-7586042 ATATTTCAGACTGTTACATGGGG - Intergenic
1036305448 8:7598264-7598286 ATATTTCAGACTATCACATGGGG - Intergenic
1036313195 8:7699827-7699849 ATATTTCAGACTATCACATGGGG + Intergenic
1036314823 8:7712077-7712099 ATATTTCAGACTGTTACATGGGG + Intergenic
1036316126 8:7719709-7719731 ATATTTCAGACTGTCACATGGGG + Intergenic
1036317435 8:7727357-7727379 ATATTTCAGACTGTCACATGGGG + Intergenic
1036318743 8:7735005-7735027 ATATTTCAGACTGTCACATGGGG + Intergenic
1036320050 8:7742652-7742674 ATATTTCAGACTGTCACATGGGG + Intergenic
1036321359 8:7750300-7750322 ATATTTCAGACTGTCACATGGGG + Intergenic
1036322668 8:7757948-7757970 ATATTTCAGACTGTCACATGGGG + Intergenic
1036323973 8:7765597-7765619 ATATTTCAGACTGTCACATGGGG + Intergenic
1036325280 8:7773253-7773275 ATATTTCAGACTGTCACATGGGG + Intergenic
1036352067 8:8018710-8018732 ATATTTCAGACTGTCACATGGGG - Intergenic
1036354660 8:8034012-8034034 ATATTTCAGACTGTTACATGGGG - Intergenic
1036356298 8:8046261-8046283 ATATTTCAGACTATCACATGGGG - Intergenic
1036376605 8:8206051-8206073 ATATTTCAGACTATCACATGGGG - Intergenic
1036513512 8:9422134-9422156 ATCTTTCATTCTCTTCCCTGGGG - Intergenic
1036846062 8:12171504-12171526 ATATTTCAGACTATCGCATGGGG - Intergenic
1036852932 8:12217087-12217109 ATATTTCAGACTATCACATGGGG + Intergenic
1036867427 8:12413823-12413845 ATATTTCAGACTATCGCATGGGG - Intergenic
1036874305 8:12459609-12459631 ATATTTCAGACTATCACATGGGG + Intergenic
1036887101 8:12566358-12566380 ATATTTCAGACTATCACATGGGG - Intergenic
1037019771 8:13955812-13955834 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1037260979 8:17008037-17008059 ATTTTTCTCACTTTTTCATGGGG - Intergenic
1037429437 8:18794296-18794318 ATATTTCAGACTATCACATGGGG - Intronic
1037980842 8:23252652-23252674 ATCTCTCAGACTTTTCTGTATGG + Intronic
1038107994 8:24458342-24458364 ATCTTTTAAAGTTTTCAATGTGG + Intronic
1038182899 8:25245475-25245497 ATTTTTCTAACTCTTCCATGTGG + Intronic
1038233300 8:25726362-25726384 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1038479837 8:27894262-27894284 TTCTCTCTGACTCTTCCATGTGG - Intronic
1038730080 8:30119019-30119041 ATATTTCAGACTATCACATGGGG + Intronic
1038859635 8:31373241-31373263 ATCGTTCAAACTTTTTGATGCGG + Intergenic
1039150194 8:34496169-34496191 AAATTTTAGACTTTTCCAAGTGG - Intergenic
1039264725 8:35812081-35812103 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1039392657 8:37193966-37193988 ATATTTCAGACTATCACATGGGG + Intergenic
1039636904 8:39177568-39177590 ATTTTGCAGACTTTTTTATGTGG + Intronic
1039674598 8:39647613-39647635 ATATTTCAGACTATCACATGGGG + Intronic
1040027630 8:42796292-42796314 ATATTTCAGACTATCACATGGGG + Intronic
1040126170 8:43740137-43740159 ATATTTCAGACTATCACATGGGG + Intergenic
1040316660 8:46264659-46264681 ATATTTCAGACTATCACATGGGG + Intergenic
1040339181 8:46431605-46431627 ATATTTCAGACTATCACATGGGG + Intergenic
1040400946 8:47048958-47048980 ATCTTTCTGGCTTTTTGATGTGG - Intergenic
1040413312 8:47176631-47176653 ATATTTCAGACTGTCACATGGGG + Intergenic
1040540583 8:48350478-48350500 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1041013091 8:53563164-53563186 ATCTTTCTAACTTTTTTATGTGG - Intergenic
1041060757 8:54032279-54032301 ATATTTCAGACTATCACATGGGG + Intergenic
1041112524 8:54498004-54498026 TTCTTGGAGAATTTTCCATGTGG + Intergenic
1041150564 8:54928459-54928481 CTCTTTTAGACTTTTTGATGTGG - Intergenic
1041374549 8:57200202-57200224 ATATTTCAGACTATCACATGGGG + Intergenic
1041513071 8:58672339-58672361 ATATTTCAGACTATCACATGGGG + Intergenic
1041519708 8:58741576-58741598 CTGTTTCAGACATTTCCCTGAGG + Intergenic
1041855801 8:62453414-62453436 ATCTTTCTAACTTTTTGATGTGG - Intronic
1041907090 8:63045508-63045530 CTCTTTCTGACTTTTTGATGTGG + Intergenic
1042356434 8:67833595-67833617 ATCTTTCAGTATTGTCCATTTGG - Intergenic
1042433621 8:68738332-68738354 ATCTTTCTAACTTTTCAATGTGG - Intronic
1042473395 8:69217039-69217061 ATCTTTCAAACTTTTTGATGTGG - Intergenic
1042673952 8:71297226-71297248 ATTTTTCATTGTTTTCCATGTGG + Intronic
1042940865 8:74106658-74106680 TTCTTTCAGACTGTTTCATGAGG + Intergenic
1042981903 8:74539374-74539396 ATTTTGCAGACTTGTTCATGGGG + Intergenic
1043188936 8:77192429-77192451 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1043190974 8:77222745-77222767 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1043278986 8:78439121-78439143 ATATTTCAGACTATCACATGGGG - Intergenic
1043324778 8:79036001-79036023 ATTTTGCAGACTTGTCTATGTGG - Intergenic
1043379678 8:79689248-79689270 ACCTTCCAGCCTTTTTCATGTGG + Intergenic
1043396867 8:79846060-79846082 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1043876126 8:85488648-85488670 CTCTTTCAGACTTTTTGATGTGG + Intergenic
1043951593 8:86315599-86315621 ATCATTCTAACTTTTCGATGTGG - Intronic
1044288005 8:90431944-90431966 ATCTTTCAAAGTAATCCATGAGG - Intergenic
1044310162 8:90684379-90684401 ATATTTCAGACTATCACATGGGG - Intronic
1044310294 8:90685226-90685248 ATATTTCAGACTATCACATGGGG - Intronic
1044771140 8:95635615-95635637 ATCTTTCTAACTTTTTAATGTGG - Intergenic
1045673046 8:104577933-104577955 ATCTTTCTAACTTTTTGATGTGG - Intronic
1046255465 8:111691480-111691502 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1046334873 8:112772522-112772544 ATATTTCAGACTATCACATGGGG - Intronic
1046475245 8:114733751-114733773 ATTTTTCAGACTTGTTTATGTGG - Intergenic
1046485944 8:114888647-114888669 ATCTTTCTAGCTTTTTCATGTGG + Intergenic
1046486159 8:114891521-114891543 ATCTTTCTAGCTTTTTCATGTGG + Intergenic
1046939535 8:119917642-119917664 ATATTTCAGACTATCACATGGGG - Intronic
1047357069 8:124132379-124132401 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1048011754 8:130462894-130462916 ATCTGTGAGATTTGTCCATGTGG - Intergenic
1048947221 8:139460504-139460526 ATATTTCAGACTATCACATGGGG + Intergenic
1049506744 8:143005710-143005732 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1049557027 8:143287882-143287904 ATATTTCAGACTGTCACATGGGG + Intergenic
1049663621 8:143832336-143832358 ATATTTCAGACTATCACATGGGG - Intergenic
1049667126 8:143850301-143850323 ATATTTCAGACTGTCACATGGGG + Intergenic
1049725890 8:144146079-144146101 ATATTTCAGACTATCACATGGGG - Intergenic
1049845010 8:144796241-144796263 ATATTTCAGACTATCACATGGGG - Intergenic
1049867715 8:144949804-144949826 ATATTTCAGACTATCACATGGGG - Intronic
1050003910 9:1107948-1107970 ATTTTTCCAACTTTTCAATGTGG + Intergenic
1050234083 9:3559970-3559992 ATCTTTCCCACTTTCTCATGTGG + Intergenic
1050239245 9:3617103-3617125 ATCTTTCTATCTTTTCGATGTGG + Intergenic
1050385244 9:5082634-5082656 ATATTTCAGACTATCACATGGGG + Intronic
1050390986 9:5144110-5144132 ATCTTTCTAACTTTTTGATGTGG + Intronic
1050398927 9:5230319-5230341 ATCTTGCACACCTTTCCATATGG - Intergenic
1050878503 9:10671435-10671457 ATCTTTCTGACTTTTTGATGTGG + Intergenic
1050928271 9:11293834-11293856 ATCATTCTAACTTTTTCATGTGG + Intergenic
1050972523 9:11895120-11895142 ATATTTTAGACTTTCACATGGGG + Intergenic
1051089545 9:13390036-13390058 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1051115975 9:13694986-13695008 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1051166877 9:14271727-14271749 ACCTTACAGTGTTTTCCATGAGG - Intronic
1051471271 9:17445708-17445730 ATATTTCAGACTATCACATGGGG - Intronic
1051861502 9:21630132-21630154 ATCTTTCCAACTGTTTCATGTGG - Intergenic
1052074871 9:24129027-24129049 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1052078910 9:24179433-24179455 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1052094364 9:24366681-24366703 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1052279397 9:26715809-26715831 ATATTTCAGACTATCACATGGGG + Intergenic
1052348005 9:27429309-27429331 AAATATCACACTTTTCCATGTGG - Intronic
1052469858 9:28880569-28880591 ATATTTCAGACTATCACATGGGG - Intergenic
1052499107 9:29266292-29266314 ATCTCTCAAAGTTATCCATGAGG - Intergenic
1052519988 9:29534222-29534244 ATCTTTCTAACTTTTTAATGTGG - Intergenic
1052676592 9:31633477-31633499 ATATTTCAGACTATCACATGGGG + Intergenic
1053053636 9:34980774-34980796 ATGTTTCAGTCTTTTCTTTGTGG + Exonic
1053542642 9:38990814-38990836 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1053708625 9:40782119-40782141 ATATTTCAGACTATCACATGGGG + Intergenic
1053736378 9:41105539-41105561 ATATTTCAGACTATCACATGGGG - Intergenic
1053807095 9:41814331-41814353 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1054322250 9:63682207-63682229 ATATTTCAGACTATCACATGGGG + Intergenic
1054362050 9:64132380-64132402 ATCCCTCAGACTGATCCATGTGG + Intergenic
1054418536 9:64902914-64902936 ATATTTCAGACTATCACATGGGG + Intergenic
1054623497 9:67373096-67373118 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1054691995 9:68325861-68325883 ATATTTCAGACTATCACATGGGG + Intergenic
1054843122 9:69763735-69763757 ATATTTCAGACTATCACATGGGG + Intergenic
1055131582 9:72781349-72781371 ATCTTTCTAACTTTTTGATGTGG - Intronic
1055157960 9:73087805-73087827 ATATTTCAGACTATCACATGGGG + Intergenic
1055168563 9:73226447-73226469 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1055341275 9:75286293-75286315 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1055341336 9:75287236-75287258 ATTTTTCAGACTTGTTTATGTGG + Intergenic
1055343111 9:75307025-75307047 ATTTTGCAGACTTGTTCATGTGG + Intergenic
1055367821 9:75564206-75564228 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1056375123 9:86000994-86001016 ATCTTTCTAACTTTTTGATGTGG + Intronic
1057119199 9:92555996-92556018 CTCTTTCAGACTTTTTGATGTGG + Intronic
1057136840 9:92696527-92696549 ATCTTTCTGACTTTTTGATGTGG + Intergenic
1057679441 9:97164701-97164723 ATCCTCCAGACTGATCCATGTGG - Intergenic
1058313683 9:103537064-103537086 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1058571934 9:106356109-106356131 ATCTTTTTAACTTTTTCATGTGG + Intergenic
1058590386 9:106558757-106558779 CTGGTTCAGACCTTTCCATGTGG + Intergenic
1058745778 9:107989264-107989286 ATGTTCCAGACTTTTTCAAGGGG + Intergenic
1058806243 9:108594952-108594974 ATATTTCAGACTATCACATGGGG - Intergenic
1058916449 9:109571019-109571041 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1059143412 9:111875647-111875669 ATATTTCAGACTATCACATGGGG - Intergenic
1060167351 9:121429453-121429475 ATATTTCAGACTATCACATGGGG - Intergenic
1060831043 9:126716876-126716898 ATATTTCAGACTATCACATGGGG - Intergenic
1060876353 9:127086725-127086747 ATCTTTTAGTCTTTTCCTTTAGG + Intronic
1061154653 9:128850594-128850616 ATATTTCAGACTATCACATGGGG - Intronic
1061554240 9:131357058-131357080 ATATTTCAGACTATCACATGGGG - Intergenic
1061955266 9:133958120-133958142 ATATTTCAGACTATCACATGGGG - Intronic
1061979521 9:134093034-134093056 ATATTTCAGACTATCACATGGGG + Intergenic
1203456765 Un_GL000219v1:175558-175580 ATATTTCAGACTATCCCATGGGG - Intergenic
1203464683 Un_GL000220v1:73531-73553 ATTTTTCAGACTTGTTTATGTGG - Intergenic
1203363853 Un_KI270442v1:240569-240591 ATATTTCAGACTATCACATGGGG + Intergenic
1203377796 Un_KI270442v1:390986-391008 ATATTTCAGACTATCACATGGGG + Intergenic
1203556483 Un_KI270744v1:2587-2609 ATCTGTCAGACTGATCCACGTGG - Intergenic
1203573331 Un_KI270744v1:153014-153036 ATCTCTCAGGCTATTACATGGGG - Intergenic
1185444749 X:251757-251779 ATATTTCAGACTATCACATGGGG + Intergenic
1185575794 X:1171288-1171310 ATATTTCAGACTATCACATGGGG - Intergenic
1186679081 X:11853279-11853301 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1187198873 X:17115608-17115630 ATATTTCAGACTATCACATGGGG + Intronic
1187234185 X:17451504-17451526 ATCTTTGTGACTTTTCTATTAGG + Intronic
1187385784 X:18847087-18847109 ATATTTCAGACTATCACATGGGG + Intergenic
1187408941 X:19030608-19030630 ATCTGTCAAGCTTTTCCATAGGG - Intronic
1187624696 X:21097618-21097640 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1187750530 X:22459210-22459232 ATCTTTCTGACTTTTTTATTAGG + Intergenic
1188319260 X:28715429-28715451 ATCTTTCTAACTTTTTGATGTGG - Intronic
1188504757 X:30870331-30870353 ATCTTTCAAACTCTTCCACTAGG - Intronic
1188711617 X:33407428-33407450 ATCTTTCTAACTTTTTCATGTGG + Intergenic
1188834205 X:34936293-34936315 ATCTTTCTAATTTTTTCATGTGG - Intergenic
1188843150 X:35040314-35040336 ATCTTTCTGTCTTTTTGATGTGG - Intergenic
1189595186 X:42557094-42557116 ATCTTTCTAACTTTTGGATGTGG - Intergenic
1189673796 X:43440634-43440656 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1189855161 X:45216463-45216485 ATTTTGCAGACTTCTACATGTGG - Intergenic
1189873299 X:45406729-45406751 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1190133229 X:47769864-47769886 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1190722022 X:53156659-53156681 ATCTTTCAGCCTTCACCATAGGG - Intergenic
1190960747 X:55244481-55244503 ATTTTTCTGGCTTTTCAATGTGG - Intronic
1191016426 X:55814194-55814216 CTCTTTCAGTCTTTGCCATTTGG - Intergenic
1191017315 X:55823124-55823146 ATCTTTCTGACTTTTTGATGTGG + Intergenic
1191033341 X:55998368-55998390 ATATTTCAGACTATTACATGGGG + Intergenic
1191099975 X:56715895-56715917 ATCTTTCTAACTTTCCGATGAGG - Intergenic
1191155551 X:57268823-57268845 ATTTTGCAGACTTTTTTATGTGG - Intergenic
1191161631 X:57335753-57335775 ATATTTCAGACTATCACATGGGG + Intronic
1191610778 X:63110220-63110242 ATTTTGCAGACTTTTTTATGTGG - Intergenic
1191632246 X:63334275-63334297 ATCTTTCCGACTTTCACCTGTGG - Intergenic
1191708495 X:64120017-64120039 ATCTTTCTAACCTTTTCATGTGG + Intergenic
1191891366 X:65945532-65945554 ATCTTTCCAACTTTTTGATGTGG + Intergenic
1192055929 X:67773105-67773127 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1192296872 X:69859336-69859358 ATCTTTCTAACTTTTTGATGTGG + Intronic
1192311306 X:70016744-70016766 ATCTTTCTAACTTTTTGATGTGG - Intronic
1192626426 X:72733532-72733554 ATATTTCAGACTATCACATGGGG - Intergenic
1192849557 X:74940636-74940658 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1193032211 X:76910839-76910861 ATCTTTCTAACTTTTTCATGTGG - Intergenic
1193043534 X:77028868-77028890 ATCTTTCCCACTTTCTCATGTGG + Intergenic
1193068311 X:77280861-77280883 ATCTTTCTCACTTTTTGATGTGG - Intergenic
1193299352 X:79870750-79870772 ATCATTCTAACTTTTCGATGGGG - Intergenic
1193366549 X:80640748-80640770 CTCTTTCAGACTTTTTGATATGG - Intergenic
1193394257 X:80965601-80965623 ATCTTTCCCACTTTCCGATGTGG + Intergenic
1193405997 X:81103134-81103156 ATCTTTCTGACTTTTCACTGTGG + Intergenic
1193425234 X:81334328-81334350 ATCTTTCTGACTTTTTGATGTGG + Intergenic
1193496177 X:82216247-82216269 AACTCTCATACTTTTCTATGTGG + Intergenic
1193552999 X:82922068-82922090 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1193570183 X:83131660-83131682 ATCTTTCTAACTTTTTTATGTGG - Intergenic
1193617421 X:83706951-83706973 CTCTTTCAGACTTTTAAATGTGG + Intergenic
1193626126 X:83822375-83822397 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1193647385 X:84086266-84086288 ATCTTTCTAACTTTTTGATGTGG + Intronic
1193672885 X:84411268-84411290 ATCTTTCTAACTTCTTCATGTGG + Intronic
1193727895 X:85064488-85064510 ATCTTTCTAGCTTTTCGATGTGG + Intronic
1193762611 X:85486351-85486373 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1193789951 X:85805532-85805554 ATCTTTCTAACTTTTTTATGTGG + Intergenic
1193823859 X:86198297-86198319 ATCTTTCTAACTTTTTGATGTGG - Intronic
1193877326 X:86876709-86876731 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1194040535 X:88936803-88936825 ATCTTTCAAAGTTTTTGATGTGG + Intergenic
1194080172 X:89452817-89452839 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1194083397 X:89496991-89497013 ATCTTTCAGATTTGTCTATCTGG + Intergenic
1194119939 X:89949477-89949499 ATCTTTCACACTGTTTTATGGGG + Intergenic
1194169113 X:90559864-90559886 ATCTTTCTGACTTTTTGATGTGG + Intergenic
1194202845 X:90976235-90976257 ATCTTTCTCACTTTTTCCTGTGG + Intergenic
1194219209 X:91170644-91170666 ATATTTCAGACTATCACATGGGG - Intergenic
1194235307 X:91375862-91375884 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1194423666 X:93709082-93709104 ATCTGTCAGAATCTTACATGAGG + Intronic
1194434964 X:93858906-93858928 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1194542722 X:95194215-95194237 ATCTTTCCAACTTTTTGATGTGG + Intergenic
1194631929 X:96295750-96295772 ATCTTGGAGAATGTTCCATGTGG - Intergenic
1194635359 X:96339885-96339907 ATCTTTCTAACTTTTTCATGTGG + Intergenic
1194774985 X:97952295-97952317 ATCTTTCTAGCTTTTCGATGTGG - Intergenic
1194777694 X:97985367-97985389 TTCTTTCATAGTTTTGCATGTGG + Intergenic
1194867701 X:99088871-99088893 ATCTTTTAAACTTTTTGATGTGG - Intergenic
1195155486 X:102118784-102118806 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1195212832 X:102666961-102666983 ATCTTTCTAGCTTTTCGATGTGG + Intergenic
1195379275 X:104255441-104255463 ATCTCTCGGTCTTTTCCGTGGGG - Intergenic
1195500406 X:105591524-105591546 ATCTTTCTAACTTTTTTATGTGG + Intronic
1195548696 X:106141650-106141672 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1195568494 X:106373140-106373162 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1195586392 X:106569827-106569849 ATCTTTCTAACTTTTTAATGTGG - Intergenic
1195834167 X:109093755-109093777 ATCTTTCAAACTGTTTGATGTGG + Intergenic
1196152375 X:112389506-112389528 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1196244807 X:113388528-113388550 ATCTTTCTGGCTTTTTGATGTGG + Intergenic
1196524088 X:116710853-116710875 ATCTTTCTAACTTTTGCATGTGG + Intergenic
1196933005 X:120699755-120699777 AACTTTCTAACTTTTCAATGTGG - Intergenic
1197077156 X:122365515-122365537 ATTTTTCTCTCTTTTCCATGTGG + Intergenic
1197141754 X:123124765-123124787 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1197383840 X:125779858-125779880 ATATTTCAGACTATCACATGGGG - Intergenic
1197399420 X:125971887-125971909 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1197402617 X:126009927-126009949 ATCTTTCCAACTTTTTGATGAGG - Intergenic
1197509532 X:127354299-127354321 ATATTTCAGACTATCACATGGGG - Intergenic
1197913364 X:131509717-131509739 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1198157364 X:133974628-133974650 ATTTTCCAGGCTTTTGCATGTGG - Intronic
1198204595 X:134453851-134453873 ATCTTGCAGGCTTTGGCATGGGG - Intergenic
1198297701 X:135303335-135303357 ATATTTCAGACTATCACATGGGG + Intronic
1198602269 X:138296380-138296402 ATATTTCAGACTATCACATGGGG + Intergenic
1198605614 X:138333834-138333856 ATATTTCAGACTATCACATGGGG - Intergenic
1198695961 X:139338380-139338402 CTCTTTCAGTCTTTTTGATGTGG + Intergenic
1199256228 X:145721439-145721461 ATATTTCAGACTATCACATGGGG + Intergenic
1199269807 X:145870087-145870109 ATCTTTCTTACATTTTCATGTGG + Intergenic
1199272157 X:145897095-145897117 ATCTTTCTAACTTTTTGATGGGG + Intergenic
1199365763 X:146980560-146980582 ATCTTTCAGGCTTTTTGATGTGG + Intergenic
1199376099 X:147110990-147111012 ATTTTGCAGACTTCTTCATGTGG - Intergenic
1199561187 X:149164245-149164267 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1199706831 X:150434519-150434541 ATCTTTCTAACTTTTTGATGTGG + Intronic
1199896179 X:152129966-152129988 ATATTTCAGACTATCACATGGGG - Intergenic
1200245421 X:154521534-154521556 ATATTTCAGACTATCACATGGGG - Intergenic
1200336535 X:155356734-155356756 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1200349935 X:155484493-155484515 ATCTTTCTAACTTTTTGATGTGG + Intergenic
1200432850 Y:3108877-3108899 ATCTTTCTAACTTTTTGATGTGG - Intergenic
1200436049 Y:3152866-3152888 ATCTTTCAGATTTGTCTATCTGG + Intergenic
1200472803 Y:3606994-3607016 ATCTTTCACACTGTTTTATGGGG + Intergenic
1200515353 Y:4137650-4137672 ATCTTTCTGACTTTTTGATGTGG + Intergenic
1200548682 Y:4551681-4551703 ATCTTTCTCACTTTTTCCTGTGG + Intergenic
1200555727 Y:4634401-4634423 ATATTTCAGACTATCACATGGGG - Intergenic
1200639110 Y:5696719-5696741 ATCTTTCTAGCTTTTCAATGTGG + Intronic
1200731636 Y:6749235-6749257 ATATTTCAGACTATCACATGGGG - Intergenic
1200743533 Y:6881136-6881158 ATCTTTCATGATTTTCCCTGTGG + Intergenic
1200752465 Y:6959027-6959049 ATATTTCAGACTATCACATGGGG + Intronic
1200777201 Y:7180223-7180245 ATATTTCAGACTATCACATGGGG - Intergenic
1201068735 Y:10124993-10125015 ATATTTCAGACTATCACATGGGG + Intergenic
1201074464 Y:10176268-10176290 ATATTTCAGACTATCACATGGGG - Intergenic
1201313085 Y:12615042-12615064 ATCTTTCTCACTTTCACATGTGG - Intergenic
1201356718 Y:13104420-13104442 ATATTTCAGACTATCACATGGGG + Intergenic
1201452693 Y:14133554-14133576 ATATTTCAGACTATCACATGGGG - Intergenic
1201962755 Y:19700077-19700099 ATATTTCAGACTATCACATGGGG + Intergenic
1201977986 Y:19872922-19872944 ATCTTGCACACCTTTCCATATGG - Intergenic
1202245527 Y:22816271-22816293 TTCTTTCACAGTTCTCCATGTGG - Intergenic
1202253165 Y:22893637-22893659 ATATTTCAGACTATCACATGGGG + Intergenic
1202398516 Y:24450019-24450041 TTCTTTCACAGTTCTCCATGTGG - Intergenic
1202406155 Y:24527386-24527408 ATATTTCAGACTATCACATGGGG + Intergenic
1202464627 Y:25142695-25142717 ATATTTCAGACTATCACATGGGG - Intergenic
1202472265 Y:25220067-25220089 TTCTTTCACAGTTCTCCATGTGG + Intergenic