ID: 976482161

View in Genome Browser
Species Human (GRCh38)
Location 4:85557364-85557386
Sequence GAGCCCTGCTCAAGCACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 174}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976482161_976482164 9 Left 976482161 4:85557364-85557386 CCATGTGTGCTTGAGCAGGGCTC 0: 1
1: 0
2: 1
3: 21
4: 174
Right 976482164 4:85557396-85557418 TCCCACGTAGTTCTCTGTGTTGG No data
976482161_976482170 28 Left 976482161 4:85557364-85557386 CCATGTGTGCTTGAGCAGGGCTC 0: 1
1: 0
2: 1
3: 21
4: 174
Right 976482170 4:85557415-85557437 TTGGTCTGGAGGCCGCAGCAGGG 0: 1
1: 0
2: 2
3: 18
4: 177
976482161_976482171 29 Left 976482161 4:85557364-85557386 CCATGTGTGCTTGAGCAGGGCTC 0: 1
1: 0
2: 1
3: 21
4: 174
Right 976482171 4:85557416-85557438 TGGTCTGGAGGCCGCAGCAGGGG 0: 1
1: 0
2: 2
3: 31
4: 319
976482161_976482168 17 Left 976482161 4:85557364-85557386 CCATGTGTGCTTGAGCAGGGCTC 0: 1
1: 0
2: 1
3: 21
4: 174
Right 976482168 4:85557404-85557426 AGTTCTCTGTGTTGGTCTGGAGG 0: 1
1: 0
2: 10
3: 41
4: 265
976482161_976482169 27 Left 976482161 4:85557364-85557386 CCATGTGTGCTTGAGCAGGGCTC 0: 1
1: 0
2: 1
3: 21
4: 174
Right 976482169 4:85557414-85557436 GTTGGTCTGGAGGCCGCAGCAGG No data
976482161_976482167 14 Left 976482161 4:85557364-85557386 CCATGTGTGCTTGAGCAGGGCTC 0: 1
1: 0
2: 1
3: 21
4: 174
Right 976482167 4:85557401-85557423 CGTAGTTCTCTGTGTTGGTCTGG 0: 1
1: 0
2: 1
3: 37
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976482161 Original CRISPR GAGCCCTGCTCAAGCACACA TGG (reversed) Intronic
900566229 1:3333327-3333349 GGCCCCTTCTCCAGCACACAAGG - Intronic
900604915 1:3519659-3519681 GTGCCCGGCTCCAGCACACCAGG + Intronic
900911002 1:5596952-5596974 AAGCCCTGCGCCAGCACACTGGG + Intergenic
901530753 1:9851063-9851085 GAGCCCTGCTCCAGGTCACCTGG - Intronic
901682303 1:10920274-10920296 GAGCCCTGCTCAGCCACCAATGG - Intergenic
902334889 1:15749181-15749203 GAGCCCAGCTCCAGCCCCCAGGG + Intergenic
902688448 1:18094537-18094559 GAGCCCTGCTCCATCCCAGAGGG + Intergenic
904169608 1:28582181-28582203 GAGCCCTTTCCCAGCACACAGGG - Intergenic
905464716 1:38144232-38144254 AAGCCCTGATCAATCAAACAGGG - Intergenic
905654192 1:39675518-39675540 GAGCCCTGCTCCAGCATGCCTGG + Intergenic
906061791 1:42953688-42953710 GAGCTCTGCTCAAGTACCAAGGG - Intronic
910851551 1:91654411-91654433 AAGCCCAGCTCCAGAACACAGGG + Intergenic
911046742 1:93635024-93635046 GAGACCAGCCCAAGCACACAGGG + Intronic
912433022 1:109639569-109639591 GGGCTCTGCTCAAGTGCACATGG - Intergenic
913112342 1:115667571-115667593 GGGACCTGCTCAAGGTCACAGGG + Intronic
915605471 1:156947643-156947665 TGGACCTGCTCCAGCACACAGGG + Intronic
916295802 1:163218142-163218164 GAGCCCTGATGAAGAACTCATGG - Intronic
917194282 1:172449614-172449636 GGGCCCAGCTAATGCACACAGGG + Intronic
917285494 1:173418133-173418155 CAGCTCTGCTGAAGCACGCAGGG + Intergenic
918413812 1:184287240-184287262 GAGCCAAGCTCAAGCTCACGTGG - Intergenic
919988887 1:202695214-202695236 CACCCCTGCTCACACACACAGGG + Intronic
920031881 1:203042430-203042452 GAGCCCTGCTCAACCAAGCAAGG - Intronic
920497241 1:206463943-206463965 GAGCCCTGCTCCACCCCTCATGG + Exonic
922960453 1:229641628-229641650 GAGCCATCCTTAAGGACACAGGG - Intronic
923007821 1:230066779-230066801 GAGCCTTGCTCACGCACACGGGG - Intronic
1063744152 10:8860771-8860793 TAGCCCTGCTCTTGAACACACGG + Intergenic
1064097111 10:12431988-12432010 GACCTCTGCTCAAGGAGACATGG - Intronic
1067664945 10:48269800-48269822 GAGACCTGCTGTAGCACAGATGG + Intronic
1068218110 10:54009865-54009887 GAGCCATACTCAGGCACACAGGG + Intronic
1068876417 10:62001331-62001353 GAGCCCTGCTGAATCCCTCATGG + Intronic
1069687289 10:70326364-70326386 ATGCCCTGCTCCAGCACACTGGG + Intronic
1069887254 10:71631701-71631723 GAGCCCTCCTCTTGCACACCAGG + Intronic
1072414576 10:95236593-95236615 GAGCACTGCTCAAGAATAGATGG + Intergenic
1073719843 10:106155708-106155730 GAGCACTGGCCAAGGACACACGG + Intergenic
1074106854 10:110395172-110395194 TAGCCCTACTGAAGCACATATGG + Intergenic
1075622755 10:123939813-123939835 GAGCCCTGATCAGGCACATCTGG - Intronic
1075642767 10:124076623-124076645 GACCCATGGTCAATCACACAGGG + Intronic
1075726420 10:124613079-124613101 CTGCCCTACTCAGGCACACATGG - Intronic
1076119229 10:127922475-127922497 GAGGCCTTCTCAATCCCACACGG - Intronic
1077366961 11:2165148-2165170 CAGCCCTGCTCAAGGCCAGAAGG + Intronic
1079954125 11:26841806-26841828 GACCCCTGCTCAAGCAGTCAGGG + Intergenic
1080931982 11:36820355-36820377 GAGCCATGCTCAACCCCACATGG - Intergenic
1081127488 11:39339956-39339978 GAGCCAAGCACAAGCTCACACGG + Intergenic
1085550047 11:77360756-77360778 GACCCTTGCCCAAGGACACAGGG - Intronic
1086996621 11:93364944-93364966 GAGGAATGCTCAAGAACACAGGG - Intronic
1087568637 11:99895772-99895794 AGGCACTGCTCAAGCCCACATGG + Intronic
1089048442 11:115524810-115524832 GAGCCCAGCTCATCCACAGAAGG + Intergenic
1089370721 11:117954396-117954418 GATGCCTCCTCCAGCACACAGGG - Intergenic
1091374996 12:19320-19342 GAGCCCAGCCCATGCCCACAGGG + Intergenic
1093420761 12:18971721-18971743 GAGGCTTGCTCAAGTTCACATGG - Intergenic
1094357441 12:29593097-29593119 GAGCCCAGCTCAACCAGAGAAGG - Intronic
1096524277 12:52201263-52201285 GACCCCTGCCCAAGTCCACACGG + Intergenic
1098870239 12:75809280-75809302 GAGTCTTGCTCAAGACCACATGG + Intergenic
1102008812 12:109605798-109605820 GTGCTCTCCTCAACCACACAAGG - Intergenic
1102531974 12:113553384-113553406 TAGCCCTCCAAAAGCACACATGG + Intergenic
1103220500 12:119240355-119240377 TAGCCCAGCTCAAGCAGTCATGG - Intergenic
1104720699 12:131043668-131043690 GGGCCCTGCGCACGCACACAGGG + Intronic
1104926999 12:132318966-132318988 GGGCCCTGCTCATGCACACCGGG + Intronic
1105579696 13:21683639-21683661 GTGTGCTTCTCAAGCACACACGG - Intronic
1106516048 13:30455049-30455071 GAGGCTTGCTCAAGGACAAATGG - Intergenic
1110108243 13:71707873-71707895 GAGCCATACTCAAGGGCACATGG + Intronic
1113616022 13:111681186-111681208 CAGCCCTGCTCACACAAACACGG - Intergenic
1113621490 13:111766079-111766101 CAGCCCTGCTCACACAAACACGG - Intergenic
1113892990 13:113746205-113746227 GCTCCCTGCTCAGGAACACAAGG - Intergenic
1115950071 14:38710979-38711001 GTGCCCTGCTCCAGCACCCTGGG + Intergenic
1119424147 14:74524889-74524911 GAGCACTGCCCAAGCCCAGAAGG - Intronic
1119847519 14:77841358-77841380 GAGCTCAGGTCAAGAACACAGGG + Intronic
1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG + Intronic
1121978322 14:98427828-98427850 AAGCCCTGCTTACACACACAAGG - Intergenic
1123024639 14:105419078-105419100 GACCTGTGCACAAGCACACACGG + Intronic
1123443415 15:20305748-20305770 AAACACTGCTCAAACACACAGGG + Intergenic
1127836948 15:62797709-62797731 GTGCCCTGCTCTGGCCCACAAGG - Intronic
1127969208 15:63945681-63945703 GTGGCCTGCTTAAGCTCACATGG - Intronic
1128233797 15:66053602-66053624 GACCCCTGCTCATGGAGACATGG + Intronic
1130772221 15:86936005-86936027 GAGCCCTGCTCCAGCAGGCAAGG + Intronic
1130878641 15:88035587-88035609 AAGCCCTACCCACGCACACAAGG + Intronic
1132670903 16:1101972-1101994 CAGCCCTGCTCAAGGACTCAGGG + Intergenic
1134783214 16:16917538-16917560 GAGCCATGCTGAAGCCGACACGG - Intergenic
1136105112 16:28024914-28024936 GAGGGCTGCTGCAGCACACAGGG - Intronic
1136397677 16:30001892-30001914 GAGACCTGCTCAAGGCCACGTGG - Intronic
1138457910 16:57131905-57131927 GAGCCATGCTCACACTCACATGG + Intronic
1140734051 16:77882096-77882118 GAGGCCTGCTCAAACACTGAGGG + Intronic
1141691417 16:85598849-85598871 GGTCCCTGCTCCAGCAAACAAGG - Intergenic
1141840789 16:86572918-86572940 GAGACCTTCACAAGCACACAGGG - Intergenic
1142031395 16:87840243-87840265 AAACCGTGCTCAAGGACACACGG + Intronic
1143292129 17:5839204-5839226 GAGCCCTGCACATACAGACAGGG - Intronic
1144703794 17:17354431-17354453 GAGACCCTCTCAAGCACAGAGGG + Intergenic
1145963227 17:28899660-28899682 TAGCCTTTCTCAAGCACACCAGG + Intronic
1146927220 17:36753379-36753401 CAGCCTTGCTCAAGGTCACAGGG + Intergenic
1152265666 17:79293225-79293247 GTGACCTGCTCAAGCCCACATGG + Intronic
1152285773 17:79411782-79411804 GAGCCCTGGGCTAGCACTCAGGG + Intronic
1152372449 17:79897829-79897851 GAGCAATGCTTAAGGACACAAGG - Intergenic
1152753789 17:82078587-82078609 GGCCCCTGCACAGGCACACAGGG - Exonic
1152781884 17:82230404-82230426 GGGCCCTGCCCAAGGTCACATGG - Intronic
1158241746 18:55385831-55385853 CAGCCCTGCTCAAGTTCTCAGGG + Intronic
1160588616 18:79927316-79927338 GAGCCCCGGGCAGGCACACAGGG + Intronic
1160842208 19:1151222-1151244 GAGTCCGTCTCAGGCACACACGG + Intronic
1161713781 19:5864261-5864283 GAGCCCTGCTCCACCACTTAGGG - Intergenic
1161716221 19:5877501-5877523 GAGCCCTGCTCCACCACTTAGGG - Intronic
1163416745 19:17191402-17191424 GAGCCCTGCTGAAGAACAGCAGG - Intronic
1164170243 19:22718600-22718622 GAGCCCTGGTCCAGCACCCACGG - Intergenic
1165593566 19:36991733-36991755 AAGCCCTGCTCAAAAACAAAGGG - Intronic
925181782 2:1822165-1822187 CCGCCCAGCCCAAGCACACATGG - Intronic
925349620 2:3191706-3191728 GTGGACTGCTCAAGGACACAGGG + Intronic
927915656 2:26934447-26934469 GGGACCTGCCCAAGCTCACAGGG - Intronic
928949340 2:36800509-36800531 GAGACCTGCGCAGTCACACAGGG - Intronic
932263520 2:70346524-70346546 GAGTCCTTCTCAAGCAAACCAGG + Intergenic
933795390 2:85915360-85915382 GAGCCATGCTCTAGCAGAGAGGG + Intergenic
934564040 2:95328650-95328672 GAGCCCCTCCCCAGCACACAGGG - Intronic
935270490 2:101430216-101430238 AAGCCCTGCACATGCACATAGGG + Intronic
935758441 2:106296627-106296649 GAGGACTGCTAAAGCACAGATGG + Intergenic
946158915 2:217824258-217824280 GAGCCGTGCGCCAGGACACATGG + Intronic
948362020 2:237428665-237428687 GAGCCCTGCACAAACTCCCAAGG + Intergenic
948902798 2:240964758-240964780 ACGCCCTGCTCAGGCTCACAGGG + Intronic
1170304276 20:14920281-14920303 GAGCCCTGGTTATTCACACAAGG - Intronic
1170695031 20:18650332-18650354 GTGACCTGAGCAAGCACACAGGG - Intronic
1174130294 20:48339799-48339821 GAGCCCTGGTAAAGCAGGCAGGG - Intergenic
1175249735 20:57601956-57601978 GAGACCTGCTTCAGCACAAAAGG - Intergenic
1176123214 20:63463513-63463535 GAACCCTGCACCCGCACACAGGG + Intronic
1176386489 21:6140697-6140719 GTACCGTGCCCAAGCACACACGG - Intergenic
1177851105 21:26349730-26349752 GAGCCCTTCTCTGGCGCACAGGG + Intergenic
1178517908 21:33264289-33264311 GGGCCCTGCACAAGGAAACAGGG + Exonic
1178692898 21:34764345-34764367 AAGCCCTGGTCAAGGACACTTGG - Intergenic
1179451801 21:41473249-41473271 GAGACCTGCTCAAGGTCACAGGG + Intronic
1179736984 21:43397555-43397577 GTACCGTGCCCAAGCACACACGG + Intergenic
1179898956 21:44379027-44379049 GAGCCCTCCACAACCACACAGGG - Exonic
1181432289 22:22888763-22888785 GGGCCAGGCTCAAGGACACAGGG + Intronic
1181530069 22:23512291-23512313 GGGCCCTTCTCCATCACACATGG + Intergenic
1181815043 22:25431041-25431063 GGGGCCTGCCCAAGCTCACATGG + Intergenic
1184777218 22:46629142-46629164 GGGCCCTGCTCACCCACACTAGG - Intronic
950655998 3:14436722-14436744 GAGCCCTCCTCTAGCAAACAGGG - Intronic
951626166 3:24665556-24665578 GCCTCCTGCTGAAGCACACAAGG + Intergenic
953167906 3:40481845-40481867 AAGCCCTGCACAAGAACAGAGGG - Exonic
953363422 3:42321497-42321519 AGGATCTGCTCAAGCACACATGG - Intergenic
955667733 3:61368237-61368259 GAGGCCCGCTACAGCACACATGG + Intergenic
961658783 3:128457472-128457494 GAGACGTGCTCAAGGTCACAGGG - Intergenic
962273389 3:133994639-133994661 GTGCCCTGCTCATGCACCCTTGG + Intronic
964432323 3:156620498-156620520 GAGCCAAGCACAAGCTCACATGG - Intergenic
969046662 4:4341364-4341386 GAGGCCTGCTCAAGCCCCCCAGG + Intergenic
969348033 4:6581428-6581450 GAGCCCAGGCCAGGCACACATGG - Intronic
972154325 4:36139938-36139960 GTGTCCTCCTCAAGCACTCAAGG + Intronic
972320442 4:37968829-37968851 GGGTCCTGCTCACTCACACATGG - Intronic
972662473 4:41129577-41129599 AAGCCCTGCCCCAGCGCACATGG - Intronic
976482161 4:85557364-85557386 GAGCCCTGCTCAAGCACACATGG - Intronic
977574872 4:98665089-98665111 AAGCCCAGCACAAGCTCACATGG + Intergenic
977586424 4:98779935-98779957 GAGCCCTGCCAAAGTGCACATGG + Intergenic
981305444 4:143242154-143242176 GAGCCAAGCACAAGCTCACATGG - Intergenic
982976016 4:162061768-162061790 GATTCATGCTTAAGCACACAGGG + Intronic
985853955 5:2410687-2410709 GAGCCCAGCTCAGCCACAGAAGG + Intergenic
987652564 5:20761913-20761935 GAGCCCTGCTCAAGGCAACCTGG + Intergenic
988742996 5:34099569-34099591 GAGCCCTGCTCAAGGCAACCTGG - Intronic
994787738 5:104186317-104186339 GAGCCAAGCACAAGCTCACATGG - Intergenic
995490998 5:112691610-112691632 GACCCCTGCTCCAAGACACAGGG - Intergenic
997430968 5:133840978-133841000 GAGACCTCCTCATGCCCACAAGG + Intergenic
999267052 5:150273267-150273289 CAGAGCTGCTCAAGCTCACAGGG + Intronic
1002432993 5:179214006-179214028 GTGACCTTGTCAAGCACACACGG + Intronic
1002565422 5:180110539-180110561 CACCCCAGCTCAAGCCCACAGGG + Intronic
1005999822 6:30956102-30956124 GAGCCCTGTTCAAACCCACACGG + Intergenic
1007794233 6:44334630-44334652 GAGCCCTGCTCACACCAACATGG - Intronic
1007953623 6:45896430-45896452 GAGCCTTGCTCAAGGGCACATGG + Intergenic
1008562987 6:52740232-52740254 GAGCCCTGCTCAGACATACTTGG + Intergenic
1008565670 6:52765920-52765942 GGGCCCTGCTCAGACACACTTGG + Intergenic
1008569858 6:52806256-52806278 GGGCCCTGCTCAGACACACTTGG + Intergenic
1010882467 6:81195948-81195970 TAGCTCTTCTCAAGCTCACATGG - Intergenic
1010958120 6:82114618-82114640 GACACCTGCTGAAACACACAGGG - Intergenic
1011807605 6:91089799-91089821 GAGCCCTACTTAGCCACACATGG - Intergenic
1014178259 6:118353688-118353710 GAGCCAAGCACAAGCTCACATGG + Intergenic
1018002619 6:159593102-159593124 GAGACTTGCCCAAGGACACATGG - Intergenic
1018954874 6:168402698-168402720 GAACCCTGCCCCAGCCCACAGGG + Intergenic
1022718990 7:32925678-32925700 AAGCCCTACTCAGGCACTCAGGG + Intergenic
1026267800 7:68810495-68810517 CAGCCCTGCTCTAGCACAAGTGG + Intergenic
1027200994 7:76063788-76063810 GGGCCCAGCTCCAGCACGCAAGG + Intronic
1028482338 7:91321286-91321308 GAGCCCAGCTGCAGCCCACAGGG - Intergenic
1032616532 7:133478468-133478490 GAGACCTGCTCAGACACACATGG - Intronic
1034869633 7:154672761-154672783 GGCCCCTGCTCCAGCACATAGGG - Intronic
1035033991 7:155883647-155883669 GAGCTCTGCTCAGGGACCCAGGG - Intergenic
1035469388 7:159099990-159100012 GGGCCCAGCTCCAGCACGCATGG - Intronic
1035475750 7:159143315-159143337 GAGCCCTCCTTAAGCCCCCAAGG - Intronic
1035862549 8:3045971-3045993 TAGCCCTACTTATGCACACAGGG + Intronic
1039970795 8:42320182-42320204 GATCCTTGCCCAAGTACACAGGG - Intronic
1041504344 8:58578137-58578159 GAGCTCTGATAAAGCGCACAAGG + Exonic
1042545002 8:69943455-69943477 GAGCTCTGATAAAGCGCACAAGG + Intergenic
1045654225 8:104370152-104370174 AAGCCCTGCTCATGCACAAAGGG + Intronic
1055057807 9:72039694-72039716 AAGCCCTGCCCAGGCTCACAGGG - Intergenic
1059405534 9:114096634-114096656 GGGCCCTGCTCTAGCAGAGATGG + Intronic
1060228795 9:121812370-121812392 GAGCCCGGCTCATGAACGCAGGG + Intergenic
1060998442 9:127888054-127888076 CAGCCCATCTCAATCACACATGG - Intronic
1061992408 9:134166620-134166642 GAGCCCAGCGCTTGCACACAGGG + Intergenic
1186150783 X:6672457-6672479 GAGGACTGCTCAAGCCCAGAAGG + Intergenic
1187397829 X:18933515-18933537 GTGCCCTGCACAAGCACATCTGG + Intronic
1187435567 X:19265754-19265776 GAGACCTGCTCAAGCTCACATGG - Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189424930 X:40891009-40891031 GAGCTCTGATAAAGCACACAAGG - Intergenic
1197707687 X:129646370-129646392 GAACCCTGCTCAAGCAAAAGGGG + Exonic
1197873119 X:131078813-131078835 CCTCCCTGCTCCAGCACACAGGG - Intronic
1199760234 X:150899064-150899086 GAGCCCTTCTCAAGGTCACCCGG - Intergenic
1199919887 X:152388791-152388813 AATACATGCTCAAGCACACAGGG + Intronic