ID: 976482429

View in Genome Browser
Species Human (GRCh38)
Location 4:85560324-85560346
Sequence GATTCTCTCTACAATGTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976482428_976482429 -5 Left 976482428 4:85560306-85560328 CCATCTTAAGAGGGAAAAGATTC 0: 1
1: 0
2: 0
3: 17
4: 212
Right 976482429 4:85560324-85560346 GATTCTCTCTACAATGTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976482429 Original CRISPR GATTCTCTCTACAATGTATG AGG Intronic
No off target data available for this crispr