ID: 976483646

View in Genome Browser
Species Human (GRCh38)
Location 4:85574374-85574396
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976483637_976483646 27 Left 976483637 4:85574324-85574346 CCGATGCTATGAGTACACAGGTA 0: 1
1: 0
2: 0
3: 5
4: 92
Right 976483646 4:85574374-85574396 CTGTCTAGAGGGCTTGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr