ID: 976486520

View in Genome Browser
Species Human (GRCh38)
Location 4:85611872-85611894
Sequence ATTAAATATCTGAATGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 517
Summary {0: 1, 1: 0, 2: 6, 3: 50, 4: 460}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976486520_976486524 12 Left 976486520 4:85611872-85611894 CCTTCTTCATTCAGATATTTAAT 0: 1
1: 0
2: 6
3: 50
4: 460
Right 976486524 4:85611907-85611929 CTTGACCTGTGCTTTTCTCCAGG 0: 1
1: 0
2: 3
3: 24
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976486520 Original CRISPR ATTAAATATCTGAATGAAGA AGG (reversed) Intronic
904888499 1:33760240-33760262 TCTAAACATCTCAATGAAGAGGG - Intronic
905503963 1:38461777-38461799 ACTAAATATGTGAATTAAGCAGG + Intergenic
906740053 1:48173683-48173705 ATGAAATAATGGAATGAAGATGG - Intergenic
906923093 1:50085706-50085728 ATTAGATATCTGAATAAAAATGG - Intronic
908423255 1:63980363-63980385 ATCAAATATCTCAATGAGGTGGG - Intronic
908929770 1:69304595-69304617 ATTAAGTCTGTGAATGAATATGG + Intergenic
908968189 1:69792380-69792402 ATCACATGTCTGAATGCAGAGGG - Intronic
909338181 1:74500711-74500733 ACTAAATATCTTAAAAAAGAGGG - Intronic
909716924 1:78719514-78719536 TTGAAATAAATGAATGAAGAAGG - Intergenic
910401768 1:86844622-86844644 ATAAGATTTCTGGATGAAGAAGG + Intergenic
910421186 1:87065269-87065291 ATTAAATGTCTGAATTAAATTGG - Intronic
910423473 1:87096100-87096122 ATTATATATCTGTGTGAAGCTGG - Intronic
910789090 1:91032324-91032346 ATTACACATCTGAATGAGAATGG + Intergenic
911184235 1:94887339-94887361 AATTAACATCTGAATGAATAGGG - Intronic
911782942 1:101906319-101906341 TTCAAATATCTGAATAAAAATGG + Intronic
912048287 1:105489440-105489462 AGTAAATATCTGAATGACAAAGG - Intergenic
912109921 1:106329212-106329234 ATTAAATAATTGAATCAAGGGGG - Intergenic
912452515 1:109776120-109776142 AGTAAACAAATGAATGAAGAAGG + Intergenic
912904053 1:113684798-113684820 ATTAAATAACTGAAATAAAAAGG - Exonic
913122160 1:115752452-115752474 AGTAAATGAATGAATGAAGAGGG + Intronic
913229367 1:116728990-116729012 AAGAAATATCTGAATTATGAGGG + Intergenic
914258870 1:145982339-145982361 AGTAGATTTCTGACTGAAGAAGG + Intergenic
915170767 1:153975712-153975734 ATGGAATATCTGAAAGAAGAGGG - Intronic
915773750 1:158459511-158459533 ATGAAATATGTGGATGCAGAAGG - Intergenic
915993998 1:160545926-160545948 ATTAAATATCAGGATGCAGCTGG - Intronic
916437232 1:164788357-164788379 ATTAAATAAATAAATGAAAAGGG - Intronic
917310172 1:173670294-173670316 CTTGAATTTCTGAATCAAGAGGG - Intergenic
917603835 1:176604804-176604826 AATATATATCTGTATGTAGATGG + Intronic
917608422 1:176660507-176660529 ATTAAATTACTGAATGAAATAGG + Intronic
918574372 1:186038815-186038837 ATGTAATAACTGAAAGAAGAAGG - Exonic
919265398 1:195257080-195257102 ATTATATATGTAAATGAAGTAGG + Intergenic
919340894 1:196305176-196305198 AGTTAATTTCTGAATAAAGATGG + Intronic
919430263 1:197483601-197483623 ATTCAATATTTGAATGAAATTGG - Intergenic
921036694 1:211385698-211385720 ATCAAATATCTGACTGGATATGG + Intergenic
921528325 1:216246178-216246200 ACTAAATCTCTGAATAAAGCTGG - Intronic
921533114 1:216309894-216309916 ATTATATATCAGAACCAAGAGGG - Intronic
922655645 1:227380736-227380758 ATTAAAAATGTGAAGGAAAACGG + Intergenic
923230416 1:231981348-231981370 ATTTAATATGTGAATAATGAGGG + Intronic
923430647 1:233916972-233916994 ATTTGATGACTGAATGAAGAAGG - Intronic
924551656 1:245083667-245083689 ATCAAGTATATGACTGAAGAAGG + Exonic
924948985 1:248865508-248865530 ATAAAATATCTGAGGGAAGAGGG - Intergenic
1063151610 10:3342011-3342033 AATAAACATGTGAATGAAGAAGG - Intergenic
1063819236 10:9815555-9815577 ATTAAATTTCAGAAAGTAGATGG - Intergenic
1063823126 10:9860777-9860799 ATTAAATATATGTAGGAAAATGG - Intergenic
1064895513 10:20231671-20231693 ATTTAATATCTCTAAGAAGATGG + Intronic
1065664654 10:28045108-28045130 AATAAATTCATGAATGAAGAAGG - Intergenic
1066180303 10:32956140-32956162 ATTATATAAGTGACTGAAGATGG - Intronic
1067189836 10:44059881-44059903 ATTAAATAACTGAATGGATTTGG - Intergenic
1067548536 10:47215400-47215422 AATAATTATTTAAATGAAGAGGG + Intergenic
1068740864 10:60468410-60468432 ATCAAATTTCTGAAAGAAAAAGG + Intronic
1069386579 10:67888134-67888156 AATAAATATGTGAATGAAATGGG + Intronic
1069469322 10:68673054-68673076 ATAAATTATTTGAATAAAGAAGG - Intronic
1070808159 10:79282988-79283010 ATTAAAAATCTGGAAGAAGGAGG - Intronic
1071998418 10:91169700-91169722 ATTAAATATATGAATACAGTTGG - Intronic
1072517422 10:96199378-96199400 ATTAAAAATTTGAGTCAAGATGG - Intronic
1072882875 10:99245813-99245835 TTAAAACATTTGAATGAAGATGG + Intergenic
1073610407 10:104937577-104937599 ATTAAATATCTGAGTCAAGAAGG + Intronic
1073699875 10:105915099-105915121 TTTAAATCTATGATTGAAGAGGG - Intergenic
1073727038 10:106244828-106244850 ATAAAATATATGAATAAAGTGGG + Intergenic
1073775926 10:106785877-106785899 ATTAAATAACTGAAGAAGGAAGG - Intronic
1074750776 10:116584867-116584889 ATTAAATAGCTGAATGACTTTGG + Intergenic
1075339285 10:121632739-121632761 AATAAAAATAAGAATGAAGAGGG + Intergenic
1075678580 10:124315806-124315828 ATTCATTCTCAGAATGAAGAAGG + Intergenic
1077739377 11:4828458-4828480 ATCAAATAAATGAATGATGATGG + Intronic
1078792959 11:14562949-14562971 ATTAAATCTATGAATTAATATGG + Intronic
1080361532 11:31519109-31519131 TTTAAATATCTGAATTAGGCCGG - Intronic
1081556443 11:44166774-44166796 ATCATAGATCTGAATGAAGCTGG + Intronic
1082914851 11:58422140-58422162 ATGTAATACCTGAATGAGGAAGG - Intergenic
1084365746 11:68696727-68696749 ACTAAATAGCAGAATGTAGAGGG + Intergenic
1085842199 11:80025197-80025219 ATCAGATATTTAAATGAAGATGG - Intergenic
1085948253 11:81298219-81298241 AGAAAAGATTTGAATGAAGAAGG - Intergenic
1086720021 11:90108478-90108500 ACTGAATAACTAAATGAAGAAGG - Intergenic
1087296648 11:96384880-96384902 ATGAAATATCTGAGTGAAGATGG + Intronic
1087321493 11:96665145-96665167 ATTTAGTTTCTGAATGAAAATGG - Intergenic
1087408501 11:97760384-97760406 ATTCAAAATCTGCATGAATAAGG + Intergenic
1087500192 11:98941985-98942007 AATAAATAAATGAATGAAAAGGG - Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088174266 11:107033340-107033362 ATTAAAAATTTGAAGGAGGAGGG + Intergenic
1088373175 11:109113415-109113437 AATAAATGAATGAATGAAGAGGG - Intergenic
1088536655 11:110868787-110868809 ATTAAATAACTATGTGAAGAGGG + Intergenic
1090663355 11:128897553-128897575 ATTACATATCTGACTGACAAAGG - Intronic
1092798876 12:12143259-12143281 ATTAAAGATCTAAATAAACAGGG + Intronic
1092847627 12:12598626-12598648 ATTAAAATTTTGATTGAAGAAGG + Intergenic
1093253539 12:16837852-16837874 ATGAAATGACTGATTGAAGAAGG - Intergenic
1093436082 12:19136945-19136967 ATTCAAAATATGAATGAAGATGG + Intronic
1093464422 12:19435562-19435584 GTTAAATATTAGATTGAAGAAGG - Intronic
1093651370 12:21649436-21649458 ATAAAATATGTGAATACAGAGGG - Intronic
1093800738 12:23369104-23369126 AGTAAATATATGAATGATAATGG + Intergenic
1094412514 12:30182231-30182253 AGTAAATATGTCAATGTAGATGG + Intergenic
1094698876 12:32848886-32848908 ATTATATAACTAAATGAAGCAGG + Intronic
1094759868 12:33520117-33520139 ATAAAATATCTGAACAAATAGGG - Intergenic
1095757194 12:45782333-45782355 TTTAAACATCTGAATCAAGCTGG + Intronic
1096306489 12:50482000-50482022 ATTATTTATCTTAACGAAGATGG + Intergenic
1096612366 12:52810943-52810965 AATGAATATCTGTATGAATATGG - Intronic
1096695897 12:53348050-53348072 ATTAAATATGTGAGTAAAGATGG - Intergenic
1097459062 12:59837718-59837740 ATTGAATGTCTGTATGAAAAAGG - Intergenic
1097900722 12:64871450-64871472 AGTGAATATCTTAATGAAAATGG + Intronic
1098941697 12:76544267-76544289 ATTAAGGATCAAAATGAAGAAGG - Intronic
1098955770 12:76688141-76688163 CTTAAATATGTAAAGGAAGAAGG + Intergenic
1099143370 12:79008202-79008224 CTGGAATATCTGAAGGAAGAGGG + Intronic
1099567813 12:84275504-84275526 ATTAAATATCAGAAAGATAATGG + Intergenic
1100065283 12:90636279-90636301 AATAAATAAATGAATGAATAAGG + Intergenic
1102226549 12:111232773-111232795 AATGAATATGTGAATGAATAAGG - Intronic
1102716934 12:114981948-114981970 ATTAATAATTTTAATGAAGAAGG + Intergenic
1107135894 13:36943702-36943724 ATAAAATAACTGAATAAAGAAGG + Intergenic
1107375340 13:39798461-39798483 TTTAAATATTGGAATCAAGAAGG - Intergenic
1108032400 13:46247594-46247616 ATAAAATATTCCAATGAAGATGG + Intronic
1108617879 13:52152684-52152706 ATTAAGTATCTGTAAGAAAAAGG + Exonic
1108975623 13:56440387-56440409 ATAAAGTGTCTGAATGAATAAGG - Intergenic
1109467813 13:62761449-62761471 ATTAAATATAAGTATGGAGAGGG + Intergenic
1109590339 13:64471437-64471459 ATTAAAAAGCTAAATGAAAAAGG - Intergenic
1109942610 13:69390888-69390910 ATTGAAGATCTGAATGTGGAAGG - Intergenic
1110599364 13:77354446-77354468 ATGAATTAACTGAATGAAGCAGG + Intergenic
1110726768 13:78834577-78834599 ATTAACAATTTGAATGAAGTTGG + Intergenic
1110759268 13:79212662-79212684 ATTAAATACCTTAATGTAGATGG - Intergenic
1111039764 13:82731838-82731860 ATTGATTCTCTAAATGAAGAAGG + Intergenic
1111188110 13:84770335-84770357 TTTTAATAGCTAAATGAAGATGG - Intergenic
1111202985 13:84962774-84962796 ATTAAAAATTTTAATGAAGGGGG - Intergenic
1113073446 13:106445186-106445208 ATTTAATTTGTGAATGAGGATGG - Intergenic
1113876359 13:113597286-113597308 AATAAATAGATGAATGGAGATGG + Intronic
1116418077 14:44702158-44702180 ATTAAAGATCTGAATAAGCAAGG + Intergenic
1116641378 14:47467923-47467945 ATGAAATGTCTGTATGAAGATGG + Intronic
1116642466 14:47482655-47482677 AATAAATGAATGAATGAAGAAGG - Intronic
1116924283 14:50617966-50617988 ATTAAAAATGTGTCTGAAGATGG - Intronic
1116928422 14:50666512-50666534 AACAAATATCTGAATAAATAAGG + Intronic
1117318232 14:54595595-54595617 ACTAAAAATCTGCATTAAGAGGG - Intronic
1118149292 14:63172542-63172564 ATAAAATATCTCAATATAGAAGG + Intergenic
1118269803 14:64332370-64332392 AGTAAATAACAGAATAAAGATGG + Intronic
1118669450 14:68107082-68107104 TATAAACATCTTAATGAAGAGGG - Intronic
1125126830 15:36233789-36233811 ATTAAATCTATGAATAAAGTTGG - Intergenic
1125823148 15:42650869-42650891 ATTTATTATCTGAATGAATTTGG + Intronic
1126169682 15:45684767-45684789 ATTAAATATTTGTTTGAAGAAGG - Intronic
1126376836 15:48005472-48005494 ATTATACTTCTGAATTAAGATGG - Intergenic
1126380527 15:48042252-48042274 ATTAAACATCTGAAGGAACTGGG - Intergenic
1127178640 15:56389970-56389992 ATTTAATAACTTACTGAAGATGG - Intronic
1128906043 15:71468396-71468418 ATTAAATATTTTAAGGAAAAAGG - Intronic
1129522528 15:76194886-76194908 CTTCAACATGTGAATGAAGAGGG + Intronic
1129624451 15:77182060-77182082 ACAAAAAATCTGAATGAAAAAGG + Intronic
1130334385 15:82946557-82946579 ATTAAAGAGCTGAAAGAAGGAGG - Intronic
1131688598 15:94800531-94800553 TTTAAATATCAGAATCCAGAAGG - Intergenic
1132266654 15:100478921-100478943 TTTAAATATTTGAAGGAGGAGGG + Intronic
1132836495 16:1956122-1956144 ATTTAAGTTTTGAATGAAGAGGG + Intronic
1133694793 16:8252086-8252108 ATAAAATGTCTGATTGAACAAGG - Intergenic
1134773152 16:16828430-16828452 GTTGAACAACTGAATGAAGAAGG + Intergenic
1135047029 16:19164408-19164430 TTTACAGATCTCAATGAAGAAGG - Intronic
1135406765 16:22204167-22204189 ATTAAATAAATAAATGAAAAAGG - Intergenic
1135433565 16:22408652-22408674 AATAAAGACCTGAAGGAAGATGG + Intronic
1136641824 16:31571863-31571885 ATTAAATATCTACATGAAAAAGG + Intergenic
1136707895 16:32204151-32204173 ATTTAAAATCTAAATGAAGCAGG - Intergenic
1138792427 16:59921738-59921760 AATAAATATGTGAAAGGAGAAGG - Intergenic
1139203067 16:64998838-64998860 AGTCAATATCTGAATGAAGCTGG + Exonic
1139516417 16:67454920-67454942 AGGAAAGATCTGAAGGAAGAGGG - Intronic
1140374940 16:74437624-74437646 AGTAAGTATTTGAAAGAAGATGG + Intergenic
1140573743 16:76139014-76139036 ATTAAATAAATAAATGAATAGGG - Intergenic
1140989135 16:80191360-80191382 AATAAATAAATGAATGAACAAGG + Intergenic
1141068056 16:80929901-80929923 AATAAATATCTGACTGAAGAAGG + Intergenic
1143207433 17:5154219-5154241 CTTAATAATCTGAATAAAGAAGG + Intronic
1143304442 17:5934755-5934777 ATGAAAGGTCTGAATGAAGGTGG + Intronic
1144318180 17:14084166-14084188 ATTAAATATTTGTATTAAGGGGG + Intronic
1145263472 17:21368172-21368194 ATTAAAAAGCTGAGAGAAGAGGG - Intergenic
1146326704 17:31892584-31892606 ATTGGATATCTGAATGACTATGG - Intronic
1146557537 17:33839494-33839516 ATTACATATCAGAGTGTAGAAGG - Intronic
1147014329 17:37478719-37478741 ATTAGATATTTGAATGTAGAAGG - Exonic
1147115924 17:38299719-38299741 ATTAAATATATGATTAAAAAAGG - Intronic
1147227987 17:38995549-38995571 ATTATATATCTATATGGAGATGG + Intergenic
1148413754 17:47489893-47489915 ATTAAATATATGATTAAAAAAGG + Intergenic
1149050543 17:52299259-52299281 ATTAAATATTTGGTTAAAGACGG + Intergenic
1149503938 17:57177386-57177408 ATTAAATTACTTAATTAAGATGG + Intergenic
1149853766 17:60060150-60060172 ATTAAATATGTATAGGAAGAAGG - Intronic
1150721384 17:67617057-67617079 ATTAAATGTGTGCAGGAAGAAGG - Intronic
1150757841 17:67931740-67931762 ATTAAACATCAGAATAAAGACGG - Intronic
1150817354 17:68402986-68403008 ATTAAATAACTGAATCAAGTTGG - Intronic
1150862534 17:68816039-68816061 ATTAATAATCTGAAAGTAGAGGG - Intergenic
1150886129 17:69088309-69088331 TTTAAATATTTGAATTAAGTTGG + Intronic
1151056259 17:71035091-71035113 ATTAAAATACTGTATGAAGAGGG - Intergenic
1152443540 17:80325863-80325885 ATCAAATAACTGAATTAATATGG + Intronic
1152576885 17:81145351-81145373 ATTAGATTTCTGAATGGAGAAGG + Intronic
1152719944 17:81918521-81918543 ATTAAAGATCTAAGTGAGGAGGG - Exonic
1153242499 18:3043552-3043574 GTTAAATATTTCAATGAAGGTGG - Intergenic
1153318754 18:3751215-3751237 AGTAAATAAATAAATGAAGAGGG + Intronic
1153764369 18:8361541-8361563 ATTAACTAGCTGTATGAAGTTGG - Intronic
1154006844 18:10537669-10537691 GAAAAATATCTGAATGAACAGGG - Intronic
1155124345 18:22856829-22856851 AATAAATATCTGGAGGATGAGGG + Intronic
1155723829 18:29053842-29053864 ATCACATATCTGAAAGAAAAAGG + Intergenic
1155753473 18:29458909-29458931 GTTAAATATCTCACTTAAGAAGG - Intergenic
1156069411 18:33188066-33188088 ATCAATTATCTGAATGCAAAAGG + Intronic
1156435222 18:37119663-37119685 CTTCAATATATGAATGAGGATGG + Intronic
1156693659 18:39739732-39739754 ATTAAATGATTGAAAGAAGATGG - Intergenic
1157650305 18:49322689-49322711 ATTAAAAATCTGAATAAACTTGG + Intronic
1159097767 18:63923873-63923895 ATTGAATAGTTGAATGAACACGG - Intronic
1159290013 18:66405061-66405083 ACTAAATATCTGAAAGAGAAAGG + Intergenic
1159389636 18:67773082-67773104 ATGAAACATCTGATTGCAGAAGG - Intergenic
1162102779 19:8350170-8350192 ATTAAATAAGTAAATAAAGAAGG - Intronic
1162407177 19:10481939-10481961 ATAAAATAACTGAGTGAAGGGGG + Intergenic
1163229209 19:15988626-15988648 AATAAATATTTGAAGGAATAAGG - Intergenic
1164233833 19:23315002-23315024 GGTAAAGATCAGAATGAAGAGGG - Intronic
1166612935 19:44215683-44215705 AAAAAAAATCTGAAAGAAGATGG + Intronic
925935969 2:8760248-8760270 ATTAAATATGTGCATGAAGATGG - Intronic
926441733 2:12895953-12895975 TCTAAATATCTGAATCAAAAAGG + Intergenic
926749127 2:16184602-16184624 ACTAAATTACTGAATGCAGATGG - Intergenic
927408516 2:22799231-22799253 ATTAAACATTTGCATTAAGATGG + Intergenic
928215535 2:29358274-29358296 TTTAAATTTCTAAATAAAGAAGG - Intronic
929137656 2:38640059-38640081 ATAAAATATTTAAATGAAGGGGG + Intergenic
929409457 2:41680861-41680883 AATAAATATATGAAGAAAGAAGG - Intergenic
930506798 2:52292728-52292750 ATGAAATGTCTGAACCAAGAGGG + Intergenic
930917929 2:56716862-56716884 ATTAAATCCCTGAATGAAAGTGG + Intergenic
930944254 2:57052535-57052557 ATTAGATATCTGATTAAACAGGG - Intergenic
931990976 2:67790068-67790090 AATAAAAATATGAAAGAAGAGGG - Intergenic
931998159 2:67858663-67858685 AATAAAGACCTGAACGAAGATGG - Intergenic
932132257 2:69198444-69198466 GATTAATATATGAATGAAGATGG - Intronic
932347986 2:71007998-71008020 GTTGAATATCTGAAAGAGGAGGG - Intergenic
932980283 2:76655607-76655629 ATTAAATATATAAATCAAGATGG + Intergenic
934630246 2:95911788-95911810 AATTAATTTCCGAATGAAGACGG - Intronic
934676100 2:96250696-96250718 ATCAAATGTATGAAGGAAGAAGG + Exonic
934803671 2:97195351-97195373 AATTATTTTCTGAATGAAGACGG + Intronic
934804087 2:97200959-97200981 AATTATTTTCTGAATGAAGACGG + Intronic
934832960 2:97550833-97550855 AATTATTTTCTGAATGAAGACGG - Intronic
935934015 2:108162296-108162318 AATAAAGATCTTAATGAACAGGG + Intergenic
936488432 2:112947440-112947462 ATTTAATAAGTGAAAGAAGAAGG - Intergenic
936642315 2:114328501-114328523 ATCTAATAACTGATTGAAGAGGG - Intergenic
936805847 2:116331682-116331704 ATTAAATTACTTACTGAAGATGG + Intergenic
937028186 2:118716580-118716602 ATTAAATATAACCATGAAGAGGG + Intergenic
937522399 2:122727888-122727910 ATTAAATATTTCATTAAAGAAGG + Intergenic
937919036 2:127117604-127117626 AATAAATACCTGGATGGAGAGGG + Intergenic
938628867 2:133142958-133142980 ATTAAACTGCTGCATGAAGATGG + Intronic
939206927 2:139118665-139118687 ATTAAATCTAAGAATGAGGATGG - Intergenic
939390297 2:141560192-141560214 ATTAAATATCTTAAAGTGGATGG - Intronic
939536377 2:143435627-143435649 AGTCAATATCTGACTGTAGAAGG - Exonic
940297851 2:152147190-152147212 ATTAAATCTATGAAAGAAGAAGG - Exonic
940331629 2:152481363-152481385 GTTAATTATTTGAATGAAAATGG - Intronic
941273715 2:163463487-163463509 AATTAATATCATAATGAAGACGG + Intergenic
941398524 2:165001810-165001832 ATTACATATCTGAATAAAATAGG - Intergenic
942256595 2:174107704-174107726 ATTAAATATCAGAATGATTTAGG - Intronic
943002413 2:182345175-182345197 ATTAATTATCTAAGTGGAGATGG - Intronic
943687625 2:190835558-190835580 TTTAATAATATGAATGAAGAGGG - Intergenic
943874953 2:193054795-193054817 ATTATATATTTGAAGAAAGAAGG + Intergenic
944337196 2:198549389-198549411 ATTAATCTTTTGAATGAAGAAGG + Intronic
944377828 2:199068671-199068693 CTTAAACATCTGAATTAAGGGGG - Intergenic
945455158 2:210043510-210043532 ATTGAATTTCTCAATGCAGAGGG - Intronic
945499424 2:210552024-210552046 ATTAAAGATATGGATGAAGAAGG - Intronic
945591153 2:211733141-211733163 ATTAAATAAATGAATAAAGCAGG - Intronic
945654067 2:212602280-212602302 TTTAAATGGCTGAATGAGGATGG + Intergenic
945914848 2:215692622-215692644 AAGAAATATTTGAATGAAGAAGG - Intergenic
947232935 2:227906554-227906576 ATTAAATATCTTATTTGAGAAGG + Intronic
947757534 2:232578334-232578356 ATTAAGTATCTGAATGAGGCTGG + Intronic
947887798 2:233588912-233588934 ATTAAATACTTTAATGAAGATGG + Intergenic
1170092804 20:12609794-12609816 ATAAAATATCTGAGTCAATATGG - Intergenic
1171993763 20:31716830-31716852 TTCAGATATCTGAAGGAAGAGGG - Intronic
1174186492 20:48709879-48709901 AGAAAATAAGTGAATGAAGAAGG - Intronic
1174899961 20:54488826-54488848 ATTAAATATGTGCATGAAGTAGG + Intronic
1175647550 20:60687624-60687646 ATTGAATGTATTAATGAAGATGG + Intergenic
1177408332 21:20699046-20699068 ATGAAATCTCTGAATGGAAATGG + Intergenic
1177797759 21:25796987-25797009 ATTAAATATCTGGTTTGAGAGGG + Intergenic
1178240643 21:30896054-30896076 ATAAAATATCTGCATAAAAAGGG - Intergenic
1178967849 21:37141024-37141046 TTTAAAAATCTGTATGAAGATGG + Intronic
1179652167 21:42818580-42818602 ATTCAATATTTGAATGTTGAGGG - Intergenic
1181193188 22:21157703-21157725 ATTAATTATCTGAATTTATATGG - Intergenic
1182058685 22:27381347-27381369 AGTAAACATCGGAATAAAGAGGG - Intergenic
1182166094 22:28175050-28175072 ATTTAATATTTGCATGCAGAAGG + Intronic
1183235805 22:36616572-36616594 ATTACAGATCTCAATGAAAAAGG - Intronic
1203288061 22_KI270735v1_random:2183-2205 ATTAAATACCTGAATCACAAGGG + Intergenic
949323945 3:2842999-2843021 ATAAAATATCAGTATAAAGATGG - Intronic
950037054 3:9893818-9893840 ATTAAAAACCTCAATAAAGATGG + Exonic
950267794 3:11588161-11588183 AGTAAATGTGTGAATGAAAAAGG - Intronic
950604807 3:14069160-14069182 ATTAACAATATGAATGAAAATGG - Intronic
951000183 3:17549487-17549509 AATAAATATATGAATAAAAATGG + Intronic
951120408 3:18920328-18920350 ATCAGATATATGAATGAACAAGG + Intergenic
951287364 3:20830347-20830369 ATTAAATAACAAAATGAACAAGG - Intergenic
951376928 3:21929796-21929818 ATTAAAGATCTAAATAAATAGGG + Intronic
951580513 3:24157914-24157936 ATTAAGGATCTGAATGTACAGGG - Intronic
951975128 3:28498084-28498106 AATAAATATCTGAGTCAAGTGGG + Intronic
953934787 3:47032018-47032040 ATGACATATTTGAATGCAGAAGG - Intronic
955454640 3:59106364-59106386 ATTAAATAAAAGCATGAAGAAGG + Intergenic
955471516 3:59291244-59291266 AGTAAATATCTAAATGAGGATGG + Intergenic
955837622 3:63074333-63074355 ATTGCATATCTAAATAAAGAAGG - Intergenic
957128492 3:76193777-76193799 ATTAATAATCTGAATAAAGGTGG - Intronic
957314796 3:78563463-78563485 ATTACATAAATGAATGAAGTAGG - Intergenic
957439216 3:80221407-80221429 ATTAAATAGCTGACTGAAAGTGG - Intergenic
957758773 3:84527084-84527106 TTTATAAAGCTGAATGAAGAGGG + Intergenic
958012117 3:87892931-87892953 ATTAAATTCCTGAAAGGAGAAGG + Intergenic
958568441 3:95846994-95847016 TTTAAATGTCTGAATAAATAAGG - Intergenic
959033546 3:101332966-101332988 ATGATATATCTTAAAGAAGATGG - Intronic
959033601 3:101333556-101333578 ATTAAAAATCTTAATGGAGGAGG + Intronic
959605121 3:108234243-108234265 ATTAAAGATCTGAAGGATGCAGG - Intergenic
959733698 3:109633109-109633131 TTTAAATATGTGAACAAAGACGG - Intergenic
959854550 3:111135158-111135180 ATTAAATAACTAAAACAAGATGG - Exonic
960556702 3:119037885-119037907 TTTATATATATGAATGAAGAGGG - Intronic
960718208 3:120598664-120598686 AATAAAGATCTGAAAGAAGTGGG + Intronic
960880358 3:122338773-122338795 ATTAAATATGTTAATGTTGATGG - Intronic
962825751 3:139099962-139099984 ATTAAGAATCTGAATGCAAAAGG + Intronic
963553524 3:146756185-146756207 ATTAGATATTTAAATGAAAATGG + Intergenic
963948857 3:151176679-151176701 AATAAATATCTGAAAGGATATGG - Intronic
965045997 3:163577288-163577310 ATTTAATAACTGGATGACGAGGG - Intergenic
965905847 3:173705039-173705061 ATTGTAGATCTGAATGAAGATGG - Intronic
966628515 3:182046381-182046403 AATAAATATTTGAATGAGAATGG + Intergenic
966703395 3:182882203-182882225 ATTAATTATCTGAAAGAGGAAGG - Intronic
966974872 3:185074680-185074702 ACCAAATATCTGGATGAACATGG - Intergenic
967596752 3:191334329-191334351 ATTACTTTTTTGAATGAAGAAGG + Intronic
968841675 4:3011408-3011430 ATTAAATATTTAAATAGAGATGG - Intronic
970970576 4:21978921-21978943 CTTAAAAATCTGAAAGAGGAAGG - Intergenic
971102724 4:23485638-23485660 AATAAATATCAGTATGAAGTAGG - Intergenic
971495852 4:27264440-27264462 ATTTATTGTCTGAATGAAAAAGG - Intergenic
972066211 4:34948687-34948709 ATTAACTAGCTAAATGATGATGG - Intergenic
972286855 4:37657543-37657565 GTTAAATATCTGAATAGAAAAGG + Intronic
972850854 4:43048639-43048661 ATTTAATATATGAATCAAGGAGG + Intergenic
973096455 4:46207359-46207381 TTTCAATATTTGAATGTAGAAGG + Intergenic
973287084 4:48430722-48430744 ATTCAACAGCTGACTGAAGATGG + Intergenic
973562267 4:52149095-52149117 ATGAAATATCTGTAAAAAGATGG + Intergenic
973987744 4:56372027-56372049 ATTGAATAACTGCTTGAAGAAGG - Intronic
974506370 4:62778936-62778958 AATAAATAAATGAATGAAAAAGG + Intergenic
976486520 4:85611872-85611894 ATTAAATATCTGAATGAAGAAGG - Intronic
976596014 4:86895411-86895433 ACTAAATATCTTATTGTAGAAGG + Intronic
976866115 4:89729267-89729289 TTTAAATATTAGAATGAAGAAGG - Exonic
976945455 4:90761378-90761400 AATAAATACATGAATGAATAGGG + Intronic
976945484 4:90761749-90761771 ATTAAATAACTGAATTTAAATGG + Intronic
976961234 4:90977791-90977813 ATTAAATGTGTAAATGATGATGG - Intronic
978901585 4:113956568-113956590 ATAAAATGTTTGAATTAAGAAGG + Intronic
978905920 4:114005357-114005379 ATGGAATATCTGAATGAATGAGG + Intergenic
979427609 4:120586717-120586739 ATTAAAAAAATGAATGAATAAGG + Intergenic
979803683 4:124943857-124943879 ATTTAATATTTGAAAAAAGATGG + Intergenic
979900529 4:126210949-126210971 AGTAAATATGTGAGTGAAGAGGG + Intergenic
980094654 4:128476506-128476528 TTTAAATAGCTGCAAGAAGATGG - Intergenic
980923412 4:139110897-139110919 AGTAATTATCTTAAGGAAGAAGG + Intronic
982037221 4:151357434-151357456 ATTAAATATCCTGATTAAGAAGG + Intergenic
982209906 4:153025856-153025878 ATCAAATATCATAATGAACATGG + Intergenic
982757678 4:159242496-159242518 ATTAAATATTTAAATAAAAAGGG - Intronic
982801028 4:159708011-159708033 ATTACATATTTGAATGAATGTGG - Intergenic
982881161 4:160718577-160718599 TTTAAATATTAAAATGAAGATGG + Intergenic
984115475 4:175675596-175675618 ATTAAAAATCTTAATTATGAAGG - Intronic
984239962 4:177206398-177206420 ATGAAAGACCTGGATGAAGAAGG - Intergenic
984412746 4:179415502-179415524 ATTAAATACCTATATGTAGAAGG - Intergenic
984487702 4:180392979-180393001 TTTAAATATCTGGATGAAGCTGG + Intergenic
984713920 4:182908742-182908764 ATTAATGATCTGAATGCAAATGG - Intronic
985956574 5:3270175-3270197 ATTCAATATCATAATGAAAAAGG + Intergenic
986158597 5:5201931-5201953 ATTAAATATATGAATAAAAAAGG - Intronic
987043183 5:14082465-14082487 GTTAAATCACTGAATGAGGATGG - Intergenic
987252504 5:16114252-16114274 ATAAAATATTAGAATTAAGAAGG - Intronic
988443176 5:31255366-31255388 TTTAAATATGTGAAAGAAGAAGG - Intronic
988519889 5:31936232-31936254 TTTAAAGACCTGAATGGAGAAGG + Intronic
988936410 5:36087378-36087400 AATAAAGACCTGAAGGAAGAGGG + Intergenic
988942326 5:36158998-36159020 ATTCACCATTTGAATGAAGAGGG + Intronic
989342125 5:40387799-40387821 ATTAAATAGTTGAATGAAACAGG - Intergenic
989521585 5:42408492-42408514 ATTAAATATATGAGTGAATAAGG + Intergenic
989664711 5:43840778-43840800 AATAAATAAGTGAATGGAGATGG + Intergenic
990094575 5:52095953-52095975 ATTAAATATCAGTATTAAAATGG - Intergenic
990140829 5:52702162-52702184 ATTAAATCTCTTTATCAAGATGG + Intergenic
990154475 5:52859814-52859836 CTGAAATATCTAAATTAAGAGGG - Intronic
990471525 5:56120546-56120568 ACTAAACATCTGAATGGAAATGG + Intronic
990568497 5:57054256-57054278 ATTTAATATCTGCATGGAGAGGG - Intergenic
991654001 5:68884699-68884721 ATGAAACATCCTAATGAAGAAGG + Intergenic
992328867 5:75695132-75695154 ATTAAATGTCCATATGAAGATGG + Intronic
992398411 5:76388685-76388707 ATGAAATAGCTGAATGAAGAAGG - Intergenic
993587980 5:89756003-89756025 ATTAAATCATTGAATGAAAACGG + Intergenic
993686626 5:90945614-90945636 AATAAATATCTGTAGGATGAAGG - Intronic
993725769 5:91364931-91364953 ATGAAATAAATGAATGAATATGG - Intergenic
993858589 5:93105630-93105652 ATGAAGTATCAGAATGAAGGGGG - Intergenic
994079854 5:95696487-95696509 ATTACATATCTGTGTGAAGCAGG - Intronic
994952133 5:106477050-106477072 ATTAAATAAATCAATGGAGAAGG + Intergenic
995104813 5:108364350-108364372 CTTAAATATCTGAATGTTTAAGG - Intronic
995742622 5:115370243-115370265 ATTCAATCTTGGAATGAAGAAGG + Intergenic
996028302 5:118676318-118676340 TTTACATATCAGAATGCAGATGG + Intergenic
996593986 5:125180296-125180318 AATAAATAAATGAATGAATACGG - Intergenic
996800028 5:127392908-127392930 ATGAAATATCTGCATGAATCTGG + Intronic
997148284 5:131462474-131462496 AATAAATTCCTGAATCAAGACGG + Intronic
998637904 5:143976889-143976911 ATAAAATATCTGACTGGAAAGGG + Intergenic
998649816 5:144105997-144106019 ATTTAAAATCCAAATGAAGATGG - Intergenic
998830741 5:146155622-146155644 AGTACATATATGAATAAAGAGGG - Intronic
999168667 5:149574047-149574069 ATGAAATATCTGAGTGAAAATGG + Intronic
999265737 5:150265643-150265665 AAGAAATAACTGAATGAAGCTGG + Intronic
1000774674 5:165404328-165404350 ATTGAGTACCTAAATGAAGATGG + Intergenic
1000870839 5:166575130-166575152 ATTAAAAAGCTGAATGGGGAGGG + Intergenic
1000952936 5:167506945-167506967 GGTAATTATGTGAATGAAGATGG - Intronic
1001661399 5:173396300-173396322 ATCAAAGATGTGAATGAAAATGG - Intergenic
1001863105 5:175077216-175077238 ATTAAAGTTCTCAATGAACATGG - Intergenic
1002506135 5:179680355-179680377 ATCAAATGACTGAATGATGAGGG - Intronic
1002909657 6:1480114-1480136 ATTAAATGAATGAGTGAAGATGG - Intergenic
1003852422 6:10238881-10238903 ATTAGATAACTTATTGAAGAAGG + Intergenic
1003856763 6:10284236-10284258 TTTAAATCTCTGAAGGAAGGTGG - Intergenic
1004435282 6:15586627-15586649 ATTAAATATTTAAATGAATGAGG - Intronic
1004492781 6:16131861-16131883 ATTTTGTTTCTGAATGAAGATGG + Intronic
1004783814 6:18943102-18943124 ATTAAATATGTGAATGTTCATGG - Intergenic
1005240893 6:23824660-23824682 ATTAAGTATCTGGAAGAATAAGG + Intergenic
1005476051 6:26208969-26208991 ATTAAATATCTTAAGAAAGAAGG + Intergenic
1007543444 6:42671657-42671679 ATTGAGTTTCAGAATGAAGAAGG - Intronic
1008068903 6:47079500-47079522 AGTAATTCTCTGAAGGAAGAAGG + Intergenic
1008255187 6:49290389-49290411 ATTAAAAATCTCAATGAAAGAGG - Intergenic
1008860055 6:56138380-56138402 ATAAAATCTCTTAATGAGGAAGG + Intronic
1008877744 6:56348098-56348120 AATAAATGAATGAATGAAGAGGG - Intronic
1009641286 6:66340599-66340621 ATTAGATAATTGAATGCAGATGG + Intergenic
1010684984 6:78843814-78843836 ATGAAATTTCTCAATAAAGAAGG + Intergenic
1010776875 6:79897016-79897038 ATTAAAATTTTGAATAAAGATGG + Intergenic
1011424973 6:87217691-87217713 TTTAAGTAACTGAATGTAGAGGG - Intronic
1011562458 6:88634805-88634827 ATTTAATATGTGAGTGAAAATGG + Intronic
1011940243 6:92833992-92834014 CATAAATAACTGAATGAAGAAGG + Intergenic
1012080131 6:94747495-94747517 CATCAATATCTTAATGAAGATGG + Intergenic
1012295470 6:97516395-97516417 ATAAAATGTGTGCATGAAGATGG + Intergenic
1012305283 6:97648521-97648543 AATAAATATCTCACTGAAAAAGG - Intergenic
1012684676 6:102231186-102231208 ATAAAATATTTGGATTAAGAAGG - Intergenic
1012841873 6:104339247-104339269 ATGAAATATCTCCATGTAGAAGG - Intergenic
1013145910 6:107391556-107391578 ATTCAATAGCTGTATGAGGAGGG + Intronic
1013378353 6:109541035-109541057 ATTAAATGTAAGAAGGAAGAGGG - Intronic
1013951035 6:115782067-115782089 TATAAATATCTGAATGAATTAGG + Intergenic
1014320428 6:119922152-119922174 ATTCAAAATGTGAAGGAAGAAGG - Intergenic
1014370682 6:120603638-120603660 ATTTAAAACCTGAATGAAGGAGG + Intergenic
1015297727 6:131617112-131617134 ATTAAATATATTAATTTAGAAGG + Intronic
1015380971 6:132568604-132568626 AATGAATATCAGAATGATGAAGG + Intergenic
1015758390 6:136631466-136631488 CTCAAATATCTGCAGGAAGATGG - Intronic
1015820748 6:137257852-137257874 TGTATATATCTGAATGAAAATGG - Intergenic
1015951153 6:138553923-138553945 ATTAAATATTTGAAGGATGATGG + Intronic
1016101733 6:140110219-140110241 AGTAAGTATCTGAATGAAAAAGG - Intergenic
1016169070 6:140986253-140986275 ACTAAGTTTCTGAAAGAAGATGG - Intergenic
1016459548 6:144267749-144267771 ATTAAATAACTGACTGATAATGG - Intergenic
1016582865 6:145648904-145648926 CATAAAAATCTGAATGAAAAAGG + Intronic
1016777858 6:147924866-147924888 ATTAAAGATCTGAAAGAAATAGG - Intergenic
1016941610 6:149486929-149486951 ATTAAGTGGCTGAGTGAAGATGG + Intergenic
1017020881 6:150139390-150139412 ATGAAATATTGGAATGAAAATGG + Intergenic
1017642876 6:156511318-156511340 AGTAAATAGCTGAATGAATCGGG - Intergenic
1018425331 6:163674873-163674895 AGTAAAGATCAGAGTGAAGAGGG + Intergenic
1018515930 6:164580250-164580272 ATAAAATAGCTGTATGAAAATGG + Intergenic
1020626735 7:10590273-10590295 ATTATAATTCTGAAGGAAGACGG - Intergenic
1021662460 7:22933837-22933859 ATTAAAAATCTGAACTATGAGGG - Intergenic
1023457950 7:40362103-40362125 CTTAATCATCTGAATCAAGAAGG - Intronic
1024679177 7:51665938-51665960 GATAAGGATCTGAATGAAGAAGG - Intergenic
1024824477 7:53375006-53375028 ATTAAATATGTCACTTAAGAGGG - Intergenic
1025017131 7:55448856-55448878 ATAAAATATGTCATTGAAGAGGG - Intronic
1026569337 7:71515671-71515693 CTCAATTATCTGAATGAGGAAGG - Intronic
1027649305 7:80845711-80845733 AATAAATATTTGAACAAAGAAGG - Intronic
1028053253 7:86209816-86209838 TTTAAATATTAAAATGAAGAGGG + Intergenic
1028273743 7:88824912-88824934 ATAAAAGTTCTGAATGGAGAAGG + Intronic
1028642774 7:93061968-93061990 TTTAAAGATCTAAATGAAAAAGG - Intergenic
1030573451 7:111256492-111256514 GTGAAATATCTCATTGAAGAAGG + Intronic
1030952498 7:115808691-115808713 ATTAAAGCTCTGAATGAATATGG - Intergenic
1030962092 7:115937231-115937253 ATTAAATCTTTAAATGAAAAGGG + Exonic
1031044217 7:116869445-116869467 ATTTAGTAAATGAATGAAGATGG - Intronic
1031326111 7:120400237-120400259 TTTAAATATCTGAATGCAAAAGG + Intronic
1031403149 7:121349828-121349850 AGTAAATATATAAATGTAGATGG - Exonic
1032809431 7:135395875-135395897 GTTAGATATCTGAATAAAAAAGG + Exonic
1033518162 7:142130405-142130427 ATTAAGTATGAGAATGAAGCTGG - Intronic
1035007021 7:155672199-155672221 TTTAAAAACCTTAATGAAGAAGG - Intronic
1037499694 8:19473559-19473581 ATTAAATATCTTATTTAAGGTGG - Intronic
1037509105 8:19563692-19563714 ATTAAAGATCTGAGTGGAGGTGG - Intronic
1037665348 8:20964328-20964350 ATTAAATTTCGGAATGAAGTTGG - Intergenic
1037867465 8:22457314-22457336 AATAAATAAATAAATGAAGATGG - Intronic
1038175996 8:25182858-25182880 ATTTAATATGTGTGTGAAGAAGG + Intergenic
1040674870 8:49736481-49736503 ATTTAATATCATAATGTAGATGG - Intergenic
1040878861 8:52182117-52182139 CTTTAATATCTGAATGACGTAGG - Intronic
1041022775 8:53655416-53655438 ACTATATATCTGCATGAAGCTGG + Intergenic
1041577482 8:59416023-59416045 ATTGAATATATAAATGAAGCAGG - Intergenic
1041894668 8:62909299-62909321 ATTAAATATATCAAAGAAGATGG + Intronic
1041920273 8:63174754-63174776 ATGAAATATCTAAATAAAGAGGG - Intronic
1042495311 8:69449084-69449106 ATAAAATATCAGAATGAGAATGG + Intergenic
1042713029 8:71740677-71740699 ATCATATATCTGTTTGAAGAGGG + Intergenic
1043210278 8:77505331-77505353 GTAAAAAATCTGAAAGAAGAGGG - Intergenic
1045047763 8:98295361-98295383 AATAAATATCTGAAGGAAAAAGG + Intergenic
1045450097 8:102315374-102315396 ATTAAATAACTCATTAAAGAGGG - Intronic
1045542790 8:103102473-103102495 ATAAAATCTTTGAATGAACAGGG + Intergenic
1045630342 8:104112093-104112115 ATTAATTCTTTTAATGAAGAGGG - Intronic
1045670533 8:104546845-104546867 AATAATTATAAGAATGAAGAGGG - Intronic
1045837430 8:106538653-106538675 ATTAAATATCTGTATAGAAAGGG + Intronic
1045883646 8:107070174-107070196 TTTAAATAACTGCAAGAAGATGG + Intergenic
1045970479 8:108074566-108074588 ATTAAATAACTGAAGGCTGAGGG - Intronic
1046204402 8:110973508-110973530 ATTAAATATCTCAAGAGAGATGG - Intergenic
1047336123 8:123938357-123938379 ATTCAACACCTGAATGAAAAGGG - Intronic
1048196727 8:132337560-132337582 CATGAATATATGAATGAAGAAGG + Intronic
1048410076 8:134163375-134163397 GTTAAATAGATGAATAAAGATGG - Intergenic
1048622540 8:136150421-136150443 ATAAAATTTCAGAATCAAGAAGG - Intergenic
1050051767 9:1609499-1609521 AATAAATATTTAAATGAAAATGG - Intergenic
1051012522 9:12435654-12435676 ATTTAATATTTGAATACAGAAGG - Intergenic
1051391360 9:16567911-16567933 ATTAAAAATCTGTACGAAAAGGG + Intronic
1051444269 9:17123897-17123919 ACTAAATATATAAATGTAGAAGG - Intergenic
1051652121 9:19338338-19338360 CTTAAAAATCTGAAGGAATAAGG - Intronic
1051896133 9:21990879-21990901 ATAAAATAGCTGAATGAAAGTGG + Intronic
1052428350 9:28334182-28334204 ATGAAATATAAGAAAGAAGATGG + Intronic
1054869027 9:70032169-70032191 ATTAAAGTTCTGAGTAAAGATGG - Intergenic
1055812627 9:80167102-80167124 ATTAAAAATCTTAATGAGGAAGG + Intergenic
1055990179 9:82097327-82097349 ATTAAAAAACTGACTCAAGATGG - Intergenic
1056023511 9:82466461-82466483 CTAAAAGGTCTGAATGAAGATGG + Intergenic
1056163847 9:83923183-83923205 ATGAAATATAGGAATGAAGGTGG + Intergenic
1056833776 9:89937452-89937474 ATTATTTATCTGAAAGAAGAAGG + Intergenic
1056982261 9:91326104-91326126 ATTAACAATCTGAAAAAAGATGG + Intronic
1058195814 9:101973778-101973800 ATTAAATATGCAAATGCAGAAGG - Intergenic
1059051717 9:110933893-110933915 AAAAAATATTTGAATGGAGATGG + Intronic
1186382544 X:9075973-9075995 ATTCATCATCTGAATCAAGAAGG + Intronic
1186549635 X:10489363-10489385 ATTATATATCTAAATGTAAAAGG - Intronic
1186927045 X:14345284-14345306 AGCAAATATCTCAATGAAGGTGG + Intergenic
1187019579 X:15366501-15366523 AATGAATCTCTGAATGAAAATGG - Intronic
1187188092 X:17006985-17007007 TTTAAAAATCTGTATGAAAAAGG + Intronic
1187254691 X:17631542-17631564 ATTAAATAACTGAATGAAGGTGG + Intronic
1187678307 X:21740310-21740332 AGTGGATATTTGAATGAAGAAGG + Intronic
1187802308 X:23077381-23077403 AGTAAATATATAAATGTAGATGG + Intergenic
1187987518 X:24830391-24830413 ATTAAATGAGTGAATGAATAAGG + Intronic
1188458664 X:30396913-30396935 GTTAAATATATGAAAAAAGACGG - Intergenic
1188906473 X:35798207-35798229 ATTCAATATCGGAGTGAACAGGG + Intergenic
1190051216 X:47150482-47150504 ATTAAAGATCTGAATGCAAAAGG - Intronic
1190461377 X:50679452-50679474 ATTAAATATCTGACTGCTAATGG - Intronic
1190809321 X:53868360-53868382 GTGAAATATCTGAATAGAGAAGG - Intergenic
1190860107 X:54336802-54336824 ATTTACTGTCTGAATGAATATGG + Intronic
1191077479 X:56470372-56470394 TTTTTATATCTTAATGAAGAAGG + Intergenic
1191078091 X:56477813-56477835 ATGAAATTTCAGAATGAGGAGGG + Intergenic
1192284739 X:69723086-69723108 ATTAAAGTTCTCAAGGAAGAAGG + Intronic
1192608683 X:72545900-72545922 AATAAATAACTGCATGAAAATGG - Intronic
1193051792 X:77109580-77109602 ATCAAATATATGAAAGCAGAGGG + Intergenic
1193198824 X:78664459-78664481 AATAAATATTTGAAGAAAGAAGG - Intergenic
1193609735 X:83615763-83615785 ATTAAATCTATGAATTAATATGG - Intergenic
1194032487 X:88833861-88833883 ATTAAATATCATAATGATCAGGG + Intergenic
1194107215 X:89785562-89785584 ATTACAAATTTGAATGAAGCTGG - Intergenic
1196520891 X:116669339-116669361 ATTTTATATCTTAATGAGGAAGG - Intergenic
1196552039 X:117040188-117040210 AGTTAGTATATGAATGAAGAAGG - Intergenic
1196643044 X:118085922-118085944 AATAAACATATGCATGAAGATGG + Intronic
1197437583 X:126451627-126451649 ATTTAATATCTGGATAAATAAGG + Intergenic
1197604669 X:128571409-128571431 AATAAATGAATGAATGAAGAAGG + Intergenic
1197950366 X:131889356-131889378 ATTAAAAAACTAACTGAAGATGG + Intergenic
1199581464 X:149364678-149364700 ATAAAACAGCTGAAAGAAGATGG + Intergenic
1200254954 X:154575677-154575699 AGTAAATATATGAATGATGTAGG + Intergenic
1200262815 X:154628731-154628753 AGTAAATATATGAATGATGTAGG - Intergenic
1200459174 Y:3433413-3433435 ATTACAAATTTGAATGAAGCTGG - Intergenic
1201887789 Y:18904905-18904927 ATTAAAGCTCTGTATGAACATGG - Intergenic