ID: 976492986

View in Genome Browser
Species Human (GRCh38)
Location 4:85693519-85693541
Sequence CAGCAGGTCCCTGTGCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 369}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976492986_976492993 2 Left 976492986 4:85693519-85693541 CCCTGGGGCACAGGGACCTGCTG 0: 1
1: 0
2: 2
3: 45
4: 369
Right 976492993 4:85693544-85693566 GGCTCCATCCTGTGTACCTGGGG No data
976492986_976493001 23 Left 976492986 4:85693519-85693541 CCCTGGGGCACAGGGACCTGCTG 0: 1
1: 0
2: 2
3: 45
4: 369
Right 976493001 4:85693565-85693587 GGTTGGGCACCAGGTGTGCTGGG 0: 1
1: 0
2: 4
3: 28
4: 195
976492986_976493002 26 Left 976492986 4:85693519-85693541 CCCTGGGGCACAGGGACCTGCTG 0: 1
1: 0
2: 2
3: 45
4: 369
Right 976493002 4:85693568-85693590 TGGGCACCAGGTGTGCTGGGAGG 0: 1
1: 0
2: 4
3: 53
4: 357
976492986_976492998 14 Left 976492986 4:85693519-85693541 CCCTGGGGCACAGGGACCTGCTG 0: 1
1: 0
2: 2
3: 45
4: 369
Right 976492998 4:85693556-85693578 TGTACCTGGGGTTGGGCACCAGG No data
976492986_976493000 22 Left 976492986 4:85693519-85693541 CCCTGGGGCACAGGGACCTGCTG 0: 1
1: 0
2: 2
3: 45
4: 369
Right 976493000 4:85693564-85693586 GGGTTGGGCACCAGGTGTGCTGG 0: 1
1: 0
2: 3
3: 27
4: 269
976492986_976492996 7 Left 976492986 4:85693519-85693541 CCCTGGGGCACAGGGACCTGCTG 0: 1
1: 0
2: 2
3: 45
4: 369
Right 976492996 4:85693549-85693571 CATCCTGTGTACCTGGGGTTGGG No data
976492986_976492995 6 Left 976492986 4:85693519-85693541 CCCTGGGGCACAGGGACCTGCTG 0: 1
1: 0
2: 2
3: 45
4: 369
Right 976492995 4:85693548-85693570 CCATCCTGTGTACCTGGGGTTGG 0: 1
1: 0
2: 2
3: 12
4: 192
976492986_976492991 0 Left 976492986 4:85693519-85693541 CCCTGGGGCACAGGGACCTGCTG 0: 1
1: 0
2: 2
3: 45
4: 369
Right 976492991 4:85693542-85693564 GTGGCTCCATCCTGTGTACCTGG 0: 1
1: 0
2: 1
3: 13
4: 172
976492986_976492992 1 Left 976492986 4:85693519-85693541 CCCTGGGGCACAGGGACCTGCTG 0: 1
1: 0
2: 2
3: 45
4: 369
Right 976492992 4:85693543-85693565 TGGCTCCATCCTGTGTACCTGGG 0: 1
1: 0
2: 0
3: 17
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976492986 Original CRISPR CAGCAGGTCCCTGTGCCCCA GGG (reversed) Intronic
900211707 1:1459488-1459510 TTGCAGGTCCCTCTGCCCCTAGG + Intronic
900224516 1:1526788-1526810 TTGCAGGTCCCTCTGCCCCTAGG + Intronic
900406303 1:2494638-2494660 CGGCAGCTGCCTCTGCCCCAGGG + Intronic
901528827 1:9841246-9841268 CAGCAGGTACCAAAGCCCCAAGG + Intergenic
902452436 1:16505620-16505642 CACCATGTACCTGTGCCTCATGG + Intergenic
902617228 1:17630406-17630428 CAGCAGGGCCCCCCGCCCCAAGG - Intronic
902619966 1:17645064-17645086 GAGCTGCTCCCTGTGTCCCATGG + Intronic
902693511 1:18125322-18125344 CAACTGGTCTTTGTGCCCCATGG - Intronic
902752397 1:18526162-18526184 CAGCAGGTCTGGGTGTCCCAAGG + Intergenic
902863650 1:19263094-19263116 CAGCAGGTCTCGATGCTCCAGGG + Intergenic
903059561 1:20660635-20660657 CAGCAGGGCCCTGGGTTCCACGG + Intronic
903568367 1:24285704-24285726 AACCAGGTCCCTGTGCCACTAGG - Intergenic
903663654 1:24994072-24994094 CAGCAGGTCCCAGAGCCCCAGGG - Intergenic
903745131 1:25581695-25581717 CAGCAGGTCCCTGCCCCTCCCGG - Intergenic
903996463 1:27307990-27308012 CAGCTGGTCCTTGGGCCCCAGGG - Exonic
904598774 1:31662595-31662617 CAGGAGGTCCCGGTGGCCCAGGG + Exonic
906477089 1:46176467-46176489 CAGAAGCTCCCTGTGCCCATGGG - Exonic
906617143 1:47241237-47241259 CAGCAGGGCCCAATTCCCCAAGG - Intergenic
907320578 1:53599696-53599718 CAGCAGGGCTCTGTGGGCCATGG + Intronic
907493423 1:54825724-54825746 CAGTAGGTCCTTGGGCCCCTGGG + Intronic
907493465 1:54825918-54825940 AGGCAGGTCCCTGGGCCCCTGGG + Intronic
908157183 1:61365687-61365709 CAGCAAGTCCCTGTCTCCAAGGG + Intronic
908355388 1:63322313-63322335 CACCCGCTCCCTGGGCCCCAGGG + Intergenic
908845806 1:68323167-68323189 CATCAGGGCTCTGTGCCCCTGGG - Intergenic
909898925 1:81109091-81109113 CGGCTGATCCCTGTGCCCCAGGG - Intergenic
910437486 1:87220021-87220043 CAGCAGCTGCCTTTGCCCCAGGG - Intergenic
910773351 1:90851450-90851472 AAGCAGGGCCCTCTGCCCGAGGG + Intergenic
915523488 1:156462481-156462503 CAGCCGCTCCATCTGCCCCAGGG + Intergenic
917775882 1:178333664-178333686 CAACAGGTAAATGTGCCCCATGG - Intronic
919604985 1:199670562-199670584 CAGCAGATCCTTGTGACGCATGG + Intergenic
920166801 1:204041755-204041777 CAGCAGGCCCCTCTGCACCTTGG - Intergenic
920306399 1:205020856-205020878 CAGGAGGTCACTCTGCACCAAGG - Exonic
922272136 1:224043804-224043826 CAGCACCTCCCTGTCCCCAACGG + Intergenic
922326136 1:224530142-224530164 CTGCAGTTCCCTGGGTCCCAAGG + Intronic
922731721 1:227952037-227952059 CAGCAGGTCGCAGTGGCCCCAGG + Intergenic
922752366 1:228076310-228076332 AAGCAGGACCCTGGGCTCCATGG - Exonic
922903560 1:229156931-229156953 TAGCAGGTCCATGTGCCGCATGG - Intergenic
924646461 1:245881963-245881985 CAGCAGGCCCCTGTGCGGCCTGG - Intronic
1063977803 10:11430988-11431010 CAGCAGGTCCCACGGGCCCAGGG + Intergenic
1067068706 10:43117608-43117630 CAGCAGGTGCCTGGGCCTGAAGG - Intronic
1067155427 10:43777258-43777280 CAGGAGGCCGGTGTGCCCCATGG - Intergenic
1067278572 10:44854825-44854847 GAGCAGGTCCCGGTGGCCCCAGG + Intergenic
1067988592 10:51182387-51182409 CAACAGGTTCCTGTATCCCAGGG + Intronic
1068422181 10:56808367-56808389 CAGCAGATCCTTCTGGCCCAGGG + Intergenic
1069311859 10:67047321-67047343 CAGAAATTCCCTGTGCCCCTAGG + Intronic
1069630741 10:69895618-69895640 GAGCTGGGCGCTGTGCCCCAGGG - Intronic
1069849932 10:71397835-71397857 CATCAAGTCCCTGTGCCCGCGGG + Intronic
1069890410 10:71648913-71648935 CAGCAGGACCGTGTGCCTAAAGG + Intronic
1070555620 10:77525571-77525593 CAGCTGGTGCCTGGGGCCCAGGG + Intronic
1073327739 10:102652042-102652064 CAGCAGATTCCTGTGCCTCTTGG + Intronic
1075441909 10:122486553-122486575 CCCGATGTCCCTGTGCCCCATGG + Intronic
1075519462 10:123135310-123135332 AAGCGGGTCCCTGCGCCGCAGGG + Intergenic
1075723496 10:124600317-124600339 AAGCAGGCACCAGTGCCCCAGGG - Intronic
1076563411 10:131381966-131381988 CAGCGGGTGCCTGAGCCCCTAGG + Intergenic
1076686418 10:132200287-132200309 CAGCAGTTCTCGGGGCCCCAGGG + Intronic
1076798740 10:132811098-132811120 CAGGTGGGGCCTGTGCCCCAAGG + Intronic
1076818861 10:132928214-132928236 CTTCAGCTCCCTGTGCCTCAGGG - Intronic
1077042023 11:529058-529080 CAGCGGGTGCCTGTTCCACACGG + Intergenic
1077050327 11:563500-563522 CAGGAGGGCCCGGTGCCCCAGGG - Intronic
1077226465 11:1440990-1441012 CAGATGCCCCCTGTGCCCCAAGG + Intronic
1077544590 11:3163957-3163979 CAGCAAGGCCCTGTGTACCAAGG + Intronic
1077793502 11:5466555-5466577 CAGCATGGCCCTGAGCGCCATGG + Intronic
1078315408 11:10289682-10289704 CACCGGGTTCCTGTGCCTCAGGG - Intronic
1078639207 11:13079629-13079651 CTGCAGATCCCCATGCCCCAGGG + Intergenic
1078642945 11:13113394-13113416 CACCAGGTCCCAGTGACCCATGG - Intergenic
1079007517 11:16802384-16802406 CCCCAGGTCCCTGAACCCCAGGG - Intronic
1079135231 11:17772735-17772757 CAGCATCTCCCTGGGCCCCCAGG - Intronic
1081806754 11:45895094-45895116 CAGCAGGTTCCTGTGCCTGCAGG - Intronic
1082026894 11:47579033-47579055 CAGCAGGACACGGAGCCCCAAGG - Exonic
1083530566 11:63418019-63418041 CAGCAGATCCCTGTGCCTTTGGG - Intergenic
1083763896 11:64833131-64833153 CAGCAGGTGCCAGTGACCCTGGG + Intronic
1084093783 11:66896735-66896757 CAGGAGGCCCCTGATCCCCACGG + Intronic
1084155137 11:67309043-67309065 CAGCAGGTCCCAGAAGCCCATGG - Intronic
1084160732 11:67348375-67348397 CAGCGGGTCCCTGTCACCCATGG + Intronic
1086882498 11:92165775-92165797 TAGCTGGTCCCTGTACCCCAAGG + Intergenic
1088494934 11:110423204-110423226 CAGCTGGACCCTGTGGCTCAAGG + Intergenic
1088727530 11:112652848-112652870 GGGCAAGTCACTGTGCCCCATGG + Intergenic
1088907887 11:114168774-114168796 CAGGAAGGCCCTGTGCCCAAGGG + Intronic
1089812196 11:121141377-121141399 TAGAAGGACCCTGTGTCCCAAGG - Intronic
1089957718 11:122587452-122587474 CATCATTTCCATGTGCCCCATGG + Intergenic
1090979885 11:131710394-131710416 AAGCGGGTCCATGTTCCCCATGG + Intronic
1091266059 11:134271892-134271914 CAGGAAGCCCCTGTGCTCCATGG + Intergenic
1091818686 12:3458377-3458399 CAGCAGGTCCATGGGCCCCAGGG + Intronic
1091838100 12:3600210-3600232 AAGCAGCTGCCTGTGCCCCGGGG - Intergenic
1092462231 12:8697444-8697466 CGGCAGGACCCTGCGCCCGAGGG + Intronic
1092531727 12:9350644-9350666 CAGCAGGCCCATGGGCCCCAGGG - Intergenic
1092744797 12:11663058-11663080 CCGCTGGTCCTAGTGCCCCAGGG + Intronic
1092887154 12:12934848-12934870 CAGCAGGTGCTTGTGCCCGCGGG + Intergenic
1094045447 12:26161332-26161354 CACCAGGTACCTATGCCCGAGGG + Intronic
1094477722 12:30853998-30854020 CTGCGGGACGCTGTGCCCCACGG - Intergenic
1094502594 12:31034457-31034479 CAGCAGGCCCATGGGCTCCAGGG - Intergenic
1095050094 12:37547147-37547169 TGGGAGGTCCCTGTGGCCCACGG + Intergenic
1095953276 12:47793216-47793238 CAGCTGTTCCATGTGCTCCATGG + Intronic
1095982803 12:47982564-47982586 CTGGAGGGCCCTGAGCCCCAGGG + Exonic
1095983863 12:47987122-47987144 CAGGAGGGCCCCGTGGCCCAGGG + Exonic
1096505286 12:52088660-52088682 CACCTGGTCCCTGTGTCCCTTGG + Intergenic
1098339607 12:69438336-69438358 ATGCAGGTTCCTGGGCCCCAGGG - Intergenic
1103702828 12:122856556-122856578 GGGCAGGGCCCTGTGCCACAAGG - Intronic
1104226325 12:126837998-126838020 GAGCAGGTCCTGGTGCCCCATGG - Intergenic
1104880592 12:132067980-132068002 CAGCAGGGCACTGGGCTCCAAGG + Intronic
1105587231 13:21756529-21756551 CAGCAGGCCCATCTCCCCCATGG + Intergenic
1106035169 13:26037620-26037642 CAGCTGGTCCTGGTGCCCCACGG - Intergenic
1106224264 13:27773344-27773366 CCTCAGGTCTCGGTGCCCCACGG - Intergenic
1106224737 13:27776291-27776313 CAGCAGGTCCCTTTGTCCGGCGG + Intergenic
1106429380 13:29665604-29665626 CCTCAGGTGCCTATGCCCCAAGG + Intergenic
1106893764 13:34275445-34275467 CAGCAGGTGCCTGTGATCCCAGG + Intergenic
1106898411 13:34330073-34330095 CTGCAGGTCCATTTGACCCAGGG + Intergenic
1106970344 13:35132745-35132767 CAACAGTTCCCTGTGCCCACTGG - Intronic
1107631886 13:42351044-42351066 CAGCAGTCCCCTGTGGCCAATGG - Intergenic
1108344317 13:49530019-49530041 CAGCATGTAACTGTGCACCATGG + Intergenic
1113439224 13:110314826-110314848 CTGCCCGTCCCTGTGGCCCATGG - Intronic
1113485636 13:110650568-110650590 CAGCAGGTAACTGTGCAGCATGG + Intronic
1113635786 13:111918140-111918162 CAGCAGGTCCCAGAACCACATGG - Intergenic
1113926872 13:113946662-113946684 GAGCCTGTCCCTGTGCCCTATGG + Intergenic
1115028659 14:28768569-28768591 CAGCACGTCCATGAGCGCCAGGG + Exonic
1116018643 14:39435189-39435211 CAGGAGGTTCCTGTGCCTCTAGG - Intergenic
1119408251 14:74411942-74411964 CAGCAGGGCCCTCAGGCCCATGG - Intronic
1119477670 14:74940419-74940441 AGGCAGGCCCCTGTGCCCCTGGG + Intergenic
1121096681 14:91222239-91222261 CAGCTGGTCCCTGTGTCTCTTGG + Intronic
1121519222 14:94574535-94574557 CAGTAGGTCTCTGTGCCCAGAGG - Intronic
1121634686 14:95445945-95445967 CAGCAGGTCTCTGTCCCTCATGG + Exonic
1122806603 14:104263061-104263083 GAGCTGGTCCCTGTCCCCAAAGG - Intergenic
1122935215 14:104952725-104952747 CCGGAGGGCCCTGTGCCCGAGGG - Exonic
1124003733 15:25780132-25780154 CAGCAGAGCCCACTGCCCCAGGG + Intronic
1124395371 15:29295931-29295953 CAGCAGTCCCCTCTTCCCCAAGG - Intronic
1127064463 15:55222521-55222543 CAGCAACTCCCTGTCCTCCAGGG + Intronic
1128708636 15:69855770-69855792 CAGCAGGGCCTGGTTCCCCAGGG + Intergenic
1128727485 15:69998830-69998852 CAGCAGGGCCCTTTGCCCCGTGG - Intergenic
1128834593 15:70799003-70799025 CAATAGGTTCCTGTGCTCCAGGG + Intergenic
1129159805 15:73740891-73740913 AAGCAGTTCCCTCTCCCCCAGGG - Intronic
1129184609 15:73898222-73898244 CAGCTGCACCCTGTGCCACACGG - Intergenic
1129301772 15:74629632-74629654 CAGCAGGTCCCCTTGCCTCTGGG - Intronic
1129313537 15:74727848-74727870 CGGCAGGGCGCTGTGCCTCATGG - Intergenic
1129378945 15:75153671-75153693 GGGCAGGTCCCTGGGCCCCCTGG + Intergenic
1129929926 15:79402253-79402275 CTGCAGGCTCCTGTGCCCCATGG + Intronic
1130545815 15:84857237-84857259 CAGCCCGTTCCAGTGCCCCAAGG + Exonic
1130563411 15:84976132-84976154 CAGCATGTCCCTGGGCCCCTGGG + Intergenic
1130939675 15:88497149-88497171 CCTCAGTGCCCTGTGCCCCAGGG - Intergenic
1132294163 15:100723147-100723169 CAGCTGGGCCCTGTGGACCATGG + Intergenic
1132936905 16:2485918-2485940 CCGCTGCTGCCTGTGCCCCAGGG + Intronic
1134439009 16:14286313-14286335 CTGCAGGTCTCCTTGCCCCAAGG - Intergenic
1136111141 16:28064057-28064079 CAGCAGGACCCTGTCCCAGAAGG + Intergenic
1137250194 16:46735759-46735781 CAGCAGTTTCCTGTGTCCCTTGG - Intronic
1137444883 16:48525650-48525672 CAACAGGTGCCTGAGCCTCAGGG - Intergenic
1137734188 16:50711959-50711981 CAGCAGGCCCCAGTGCTCCCGGG - Exonic
1137735755 16:50721901-50721923 CAGCACTGCTCTGTGCCCCAGGG - Intronic
1138091803 16:54180914-54180936 CTCCAGGTCCTTGTGCCCTAAGG - Intergenic
1138580996 16:57940312-57940334 CAGCAGCACCCTGTGACCCGGGG + Exonic
1138599522 16:58046435-58046457 CTCCAGCTCCCTGTGCCCCCAGG + Exonic
1139476805 16:67206937-67206959 CAGCATGTACCTTTGCCTCAGGG + Intergenic
1139527507 16:67525991-67526013 CACCAGGACCCTGTGACCCTCGG + Intronic
1139706985 16:68747559-68747581 AATCTGTTCCCTGTGCCCCAGGG - Intronic
1139910698 16:70395615-70395637 CAGCCACTCCCTGAGCCCCAGGG + Intronic
1140410424 16:74737717-74737739 CAGCAAGCCCTTCTGCCCCAGGG + Intronic
1140912229 16:79464704-79464726 CAGCAGTCCCCTCTGACCCATGG - Intergenic
1141436326 16:84001812-84001834 CTGCAGGTGCCTGTGACGCAGGG - Exonic
1141997236 16:87643349-87643371 CAGCAGCTGCCTGTGCACCTGGG - Intronic
1142113676 16:88345397-88345419 AAGCAGCTCCGTGTGGCCCAGGG + Intergenic
1142373860 16:89697001-89697023 GAGAAGGACCCTGTGCCCCAAGG - Exonic
1142979734 17:3664627-3664649 TCTCAGGCCCCTGTGCCCCATGG + Intronic
1143112094 17:4558580-4558602 GAGCAGCTACCTGTGCCCCAGGG - Exonic
1143466082 17:7137690-7137712 CAGCAGGTCCCTGGAGGCCATGG - Intergenic
1144160067 17:12549127-12549149 CAGCAGCTCTGTGTTCCCCAAGG + Intergenic
1144207174 17:12987532-12987554 GAGCAGGTGCATGTCCCCCAGGG - Intronic
1145101546 17:20081505-20081527 CAGTCGGTCCCTGTGTCCCTTGG - Intronic
1145940380 17:28740504-28740526 CAGCAGGTGCCCATGCCCCCAGG + Exonic
1146640519 17:34537245-34537267 TAGCAGTTCCTTGTGCTCCAGGG + Intergenic
1146929436 17:36767396-36767418 CTGCTGGTCCCTGTGAGCCAAGG - Intergenic
1147237501 17:39068729-39068751 CTGCAGATCCCTGGGCCACAGGG - Intronic
1149647730 17:58252370-58252392 CAGCAGCCCCCTGGGCCTCATGG + Exonic
1150294707 17:64001592-64001614 CAGGAGGGCCCTGTGCCCTCTGG + Intronic
1150612116 17:66741828-66741850 CAGCAGGTCTCTGTTCCTCCTGG - Intronic
1151171594 17:72250977-72250999 CGGCAGGTCCCAGAGACCCATGG + Intergenic
1151818248 17:76482289-76482311 GTGCTGGTCCCTGTCCCCCAAGG + Intronic
1151879029 17:76883845-76883867 CAGGAGGTCACTGTGCCCGTGGG + Intronic
1152619384 17:81354393-81354415 CACAAGGGCCGTGTGCCCCAGGG + Intergenic
1152821667 17:82440819-82440841 CAGCAGGCCCATTTGCCCCCAGG + Intronic
1152906199 17:82972085-82972107 CACCAGGTCCTTCTGGCCCATGG - Intronic
1152906227 17:82972197-82972219 CACCAGGTCCTTCTGGCCCATGG - Intronic
1152906303 17:82972507-82972529 CACCAGGTCCTTCTGGCCCATGG - Intronic
1152906331 17:82972619-82972641 CACCAGGTCCTTCTGGCCCATGG - Intronic
1153343474 18:4001778-4001800 CTGGAGGAGCCTGTGCCCCATGG - Intronic
1153842184 18:9017061-9017083 CGGCAGGGCCCTGGGCCTCACGG - Intergenic
1153942095 18:9987388-9987410 CAGCATATCTCTGTGCTCCAAGG + Intergenic
1153994028 18:10424059-10424081 AAACAGGTCCCTGAGACCCATGG + Intergenic
1155546801 18:26924133-26924155 CAGAAGATCCCTCTGCCCCCAGG - Intronic
1157896588 18:51474808-51474830 CAACAGGTCTCTGTGCCCTCTGG + Intergenic
1158227324 18:55214801-55214823 CAGCAGCTCCCAGTGCCCGAAGG + Intergenic
1158887399 18:61841057-61841079 CTGCTGCTCCATGTGCCCCATGG - Intronic
1159900633 18:74041552-74041574 CCTCAGGACCATGTGCCCCATGG + Intergenic
1160118872 18:76109158-76109180 CTGCAGCTCCTTGGGCCCCAAGG + Intergenic
1160350799 18:78176611-78176633 CTGCAGGTCCCTGTGCTACCCGG - Intergenic
1160838615 19:1136421-1136443 CAGCAGGAAGCTGTGCGCCAGGG - Intronic
1161162006 19:2767031-2767053 CCTCAGCTCCCTGGGCCCCAGGG + Intronic
1161162007 19:2767039-2767061 CAGCTGGTCCCTGGGGCCCAGGG - Intronic
1161516227 19:4698118-4698140 CAGCAGGTGCCTGGACCCAAAGG + Intronic
1161988214 19:7669377-7669399 TAGCAAGACCCTGTGCTCCATGG + Exonic
1162913900 19:13864389-13864411 CAGCAGGTCCCAGAGCCACAGGG - Intronic
1165406545 19:35634250-35634272 CTGCAGGTCCCAGAGCCCCTGGG + Exonic
1165826784 19:38710144-38710166 CTGCAGGTCCCTCTCCCCCAAGG + Intronic
1165956358 19:39504180-39504202 CAGCAGCTGCCTCAGCCCCAGGG + Exonic
1166364450 19:42271541-42271563 CAGCAGGTGTCTGTTCCCCAAGG + Intronic
1166568890 19:43780994-43781016 CAGCAGAGCCCTGTGCCCTCTGG + Exonic
1166852165 19:45766222-45766244 TGGCAAGTCCCAGTGCCCCAAGG - Intronic
1167096600 19:47377881-47377903 CAGCAGAGCCATGGGCCCCATGG + Intronic
1167112033 19:47468251-47468273 CAGCAGGTGCCAGGGCTCCAAGG - Intronic
1167265363 19:48480442-48480464 CGGCAGGTGCCTGTGGCCAAGGG - Intronic
1167851400 19:52205218-52205240 CAGCAGTTCCCACTGCCTCAGGG + Intronic
1168398539 19:56068912-56068934 CTTCAGGTTCCTGAGCCCCACGG + Intergenic
1202713178 1_KI270714v1_random:28392-28414 GAGCAGGTCACTGTCCTCCATGG - Intergenic
925272448 2:2622024-2622046 CAGCAGCTCACTGTGCGGCAGGG - Intergenic
927485322 2:23484878-23484900 CAGCGGGACCAAGTGCCCCAAGG - Intronic
928233961 2:29523994-29524016 CAGCTGCTTCCTGAGCCCCAGGG + Intronic
928483733 2:31708715-31708737 CAGCAGGAAGCTGTGCCCCTGGG - Intergenic
936527801 2:113253570-113253592 CAGCATGTGCAAGTGCCCCAAGG - Intronic
937304294 2:120861675-120861697 CAGCAGGCCCCGGTTCCCCCAGG - Intronic
937857671 2:126684364-126684386 CAGCAGGTCCCTGGAGCCCATGG + Intronic
937879931 2:126857484-126857506 CACCAGGTCCCTGTGCTCCTTGG + Intergenic
938160261 2:128979284-128979306 CAGCACAACTCTGTGCCCCACGG + Intergenic
938344460 2:130557240-130557262 CTGCAGGTCACTGTGCCACTGGG - Intergenic
938345373 2:130563482-130563504 CTGCAGGTCACTGTGCCACTGGG + Intergenic
938380812 2:130835614-130835636 AAGCATGTCCCTGAGGCCCATGG - Intergenic
940014786 2:149092762-149092784 GAGCAGGGCCCTCTGCCTCATGG - Intronic
942326583 2:174781463-174781485 AACCATGTGCCTGTGCCCCACGG + Intergenic
944665137 2:201953502-201953524 CAGCAGTGCCTTGTGCTCCAGGG + Intergenic
945948041 2:216013307-216013329 CAGCCAGTCCCTCAGCCCCATGG + Exonic
946578888 2:221105015-221105037 CTTCAGGTCCTTGAGCCCCATGG - Intergenic
947799717 2:232921237-232921259 GAGGAAGTCCCTGTGTCCCAAGG - Intronic
947875414 2:233464499-233464521 CAACAGGTCCCTGGTCCTCAAGG - Intronic
948747852 2:240108995-240109017 CGGCTGGTCCCTGTGCTCCATGG + Intergenic
1169478091 20:5950412-5950434 CAGCCGGTCGCCGTGCTCCACGG + Exonic
1170451571 20:16489216-16489238 CAGCAGGTACCTCTTCTCCAAGG - Intronic
1170763781 20:19273601-19273623 CAGCAGATCCCTGGGCACCCTGG - Intronic
1171175843 20:23050331-23050353 CACCAGCGCCCTCTGCCCCATGG + Intergenic
1171344084 20:24452599-24452621 CCACAGTTCCCTCTGCCCCAGGG + Intergenic
1172098171 20:32470742-32470764 CCGCATGGCCCTGGGCCCCAAGG + Intronic
1172299879 20:33841870-33841892 CAGCAGTTCCCCGTGCCATAAGG - Intronic
1173126684 20:40342575-40342597 AAGCAGGTCCCTGTGGACCCAGG + Intergenic
1173737987 20:45375201-45375223 CAGCTGCTTCATGTGCCCCATGG + Exonic
1174343027 20:49909769-49909791 CAGCGGGACCCTCAGCCCCAAGG + Intronic
1175182286 20:57157148-57157170 CAGCAGGTGCCTGTGCACCGTGG + Intergenic
1175383183 20:58577530-58577552 TAGCAGGTCCCTGTGCCTTCTGG - Intergenic
1175646942 20:60682798-60682820 TAGCAGCTCCCTGTTCCTCAAGG + Intergenic
1175785400 20:61708668-61708690 CAGCATTTCTCTGAGCCCCAAGG - Intronic
1175892818 20:62322930-62322952 CTGCAGGTCCCTCGGGCCCAGGG - Intronic
1175952439 20:62590675-62590697 CAGCAAGTCCCTGGGCCCCCAGG - Intergenic
1175959737 20:62629841-62629863 CAGCAGGTGCCTGTTCCACTTGG + Intergenic
1175990635 20:62786768-62786790 CAGCACCTGCCTGTGTCCCAAGG + Intergenic
1176145099 20:63562018-63562040 CTGTGGGTCCCTGTGGCCCAAGG + Intronic
1176381023 21:6111962-6111984 GAGCAGGTCCCTGCGTCCCGTGG + Intronic
1178507238 21:33171876-33171898 CAGCAGGTGCCAGGGACCCAAGG + Intergenic
1178695909 21:34792665-34792687 CAGCTCTTCCCTCTGCCCCAGGG + Intronic
1178830708 21:36054182-36054204 CAGCTGTTCCCTGTGAGCCAAGG + Intronic
1179319479 21:40276103-40276125 CAGCAAGTCCATGTACCTCACGG - Exonic
1179713031 21:43273950-43273972 CAGCAGGTCCCATTCCACCAGGG - Intergenic
1179742449 21:43426278-43426300 GAGCAGGTCCCTGCGTCCCGTGG - Intronic
1179890308 21:44331792-44331814 CAGCCCATCCCTGTCCCCCAGGG - Intronic
1180148507 21:45935378-45935400 CAGTGGGTCCCTCTGCCCAAAGG - Intronic
1180231701 21:46430341-46430363 CAGCAGGGCGCGGTGCCCCTGGG - Intronic
1180791259 22:18576943-18576965 CAGCAAGTCACTGCCCCCCAGGG + Intergenic
1181230479 22:21418371-21418393 CAGCAAGTCACTGCCCCCCAGGG - Intronic
1181248171 22:21516498-21516520 CAGCAAGTCACTGCCCCCCAGGG + Intergenic
1181461810 22:23090153-23090175 CAGCAGGGTCCTGTACCACAGGG + Intronic
1182447557 22:30398321-30398343 AAGCAGCTCCCAGTGCACCAGGG - Intronic
1182517561 22:30867653-30867675 AAGCATGTCCCTGTGTCCCTGGG + Intronic
1182678063 22:32055640-32055662 CAGCCTCTCCCTGTGCCCCTGGG + Intronic
1183255580 22:36759473-36759495 CAGCCTGTCCCTGTGCACCCTGG - Intronic
1183713083 22:39518018-39518040 CAGCAGGTCTCTGGGCCTCAGGG - Exonic
1183988030 22:41579989-41580011 CAGCAGGTAGGTGGGCCCCAGGG + Intronic
1183988838 22:41584510-41584532 AAGCAGGTCAGTGTCCCCCAGGG - Exonic
1184254044 22:43276977-43276999 CAGCGGGTCCTTGTGTCCAAGGG + Intronic
1184259259 22:43305426-43305448 GAGCAGGTCCCTCTGCCCGGGGG + Intronic
1184270273 22:43377082-43377104 CAGCAGGTCCCAGAGGCCCCTGG - Intergenic
1184426183 22:44410532-44410554 CAGCAGGTCCCTGGGACGCCTGG - Intergenic
1184583329 22:45431229-45431251 CAGCAGTGACCTGTGGCCCATGG - Intronic
1184609915 22:45596309-45596331 TGGCAGGTCCCTGTCCCACATGG + Intronic
1184610760 22:45601806-45601828 CAGGGGCTCCCTGTGCCCCAGGG + Intergenic
1185119044 22:48954892-48954914 CATCAGGTCCCCCTGCCCCTGGG + Intergenic
1185128397 22:49024361-49024383 CAGCAGGCGCCTCTGACCCACGG - Intergenic
949361610 3:3238053-3238075 CAGTAGCTCTCTGTGGCCCAGGG - Intergenic
950580206 3:13857076-13857098 GAGCCTGTTCCTGTGCCCCATGG - Intronic
952446476 3:33385609-33385631 CAGCAGCTGCCTGGGCCCAAGGG + Exonic
952692673 3:36228084-36228106 CAGCTGCTCCTTCTGCCCCATGG - Intergenic
954807862 3:53230731-53230753 CTGCAGGACCTTGTGCTCCAGGG - Intronic
954873894 3:53788198-53788220 CAGCAGGTCACTGTTACACAAGG - Intronic
957255006 3:77825564-77825586 GAGCAGATCCTGGTGCCCCAAGG - Intergenic
961169816 3:124789140-124789162 CAGCAGCAACCTGAGCCCCAAGG + Intronic
961476996 3:127153215-127153237 CCCCAGGTCCCAGTGGCCCAGGG + Intergenic
961648924 3:128407867-128407889 CAGCAGGGCACTGTGCCTCTTGG - Intronic
961796479 3:129412554-129412576 CAGCAGGGCCTTGTAGCCCAGGG - Intronic
961941451 3:130641684-130641706 CAGGAGGTCCTGGTTCCCCAGGG - Exonic
966877900 3:184333941-184333963 TAGCAGGTGACTGTGCCCCTAGG + Intronic
967219402 3:187236174-187236196 CTGCAGGAGCCTGTGCCCCTGGG - Exonic
967999660 3:195196085-195196107 CAGCAGAACCCTGTGCCTGATGG + Intronic
968516731 4:1018690-1018712 CACCAGGTGCCTGTGCCCTCAGG + Intronic
968628324 4:1637863-1637885 AAGCAGGTCCCAGGGACCCAGGG + Intronic
968858547 4:3148092-3148114 CACCAGGGCCCGGTCCCCCAGGG - Exonic
968933769 4:3598434-3598456 CAGCAGGTGCATGTGCCCTGTGG - Intergenic
971004346 4:22356998-22357020 CAGGACATCCCAGTGCCCCAGGG + Intronic
972933675 4:44105051-44105073 CAGCAGATCCCTGATCCTCATGG - Intergenic
974329814 4:60463900-60463922 GAGCAGGTCCTGGTGCCCCAAGG + Intergenic
975212919 4:71722129-71722151 AAGCAGGTCCCTGACCCCCAGGG - Intergenic
975261959 4:72313389-72313411 AAGTAGGTCACTGTGCCCTAAGG - Intronic
976492986 4:85693519-85693541 CAGCAGGTCCCTGTGCCCCAGGG - Intronic
979495690 4:121380369-121380391 GAGCAGGTCACTGAGCGCCAAGG + Exonic
980097286 4:128504470-128504492 CAGGGGGTACCTGTGACCCATGG + Intergenic
980764545 4:137284000-137284022 CATCAGGTACCTGTTCCCCAAGG + Intergenic
982184782 4:152784913-152784935 CAGTATGTCACTGTTCCCCAGGG - Intronic
985843866 5:2329896-2329918 CAGCCCCTCCCTCTGCCCCAGGG + Intergenic
988737346 5:34035656-34035678 CAGGAGGGCCCGGTGGCCCAGGG + Exonic
990437555 5:55808752-55808774 AAGCGGGTCCCTGACCCCCAAGG - Intronic
994401433 5:99285230-99285252 CAGCCCATTCCTGTGCCCCAGGG + Intergenic
994701003 5:103135444-103135466 CAGCAAGACCCTGTCCTCCAGGG - Intronic
997422112 5:133778046-133778068 CAGCTGGTCAGTGGGCCCCAAGG + Intergenic
998819208 5:146042964-146042986 CCTCAGGTGCCTGTGCCACAAGG - Intronic
999230203 5:150057338-150057360 AAGCAGGTCCCGGAGCTCCAGGG + Exonic
999772348 5:154785168-154785190 CAGGAGGCACCTGGGCCCCAGGG - Intronic
1001221184 5:169902428-169902450 CAGCAGGGCCTTGTGCTCCAGGG + Intronic
1001651253 5:173317900-173317922 CGGAAGGTCCCTGAGCCCCAAGG + Exonic
1001710086 5:173771579-173771601 CAGCATTTCCCGGTGCTCCACGG + Intergenic
1001761885 5:174214335-174214357 CAGGTGGACCCTGTTCCCCAGGG + Intronic
1002066661 5:176655231-176655253 CAGCAGGACCCTGGGGCACAGGG + Intronic
1002280076 5:178124667-178124689 CAGCAGCTCCCTGGGCCTCTTGG + Exonic
1002536327 5:179878233-179878255 GAGCAGGTCCCTGTGGTCCCAGG - Intronic
1002937722 6:1687777-1687799 GAGCAGGTGTCAGTGCCCCAAGG + Intronic
1003122926 6:3333014-3333036 CAGCTGGTGCCTGTGCGTCACGG + Intronic
1003560029 6:7172605-7172627 AAGCAGCTCACGGTGCCCCATGG + Intronic
1004917205 6:20342991-20343013 CATCAGGTGCTTGAGCCCCAAGG - Intergenic
1005880757 6:30058264-30058286 CAGCAGGGCCATTTCCCCCATGG + Intergenic
1005943344 6:30577908-30577930 CAGCAGGTACAAGTGCCACAGGG + Exonic
1007127972 6:39443248-39443270 CAACAGGACCCTGTGAACCATGG - Intronic
1008208746 6:48694582-48694604 AAGCAGGTCCTGGTGCTCCAGGG + Intergenic
1011545490 6:88478087-88478109 CAGCCGGGTCCTGAGCCCCATGG - Intergenic
1011836320 6:91435800-91435822 CAGAAGTTCCATGTGACCCAAGG - Intergenic
1013288589 6:108700596-108700618 CAGAAGGCCCCTGTGCTCCGTGG + Intergenic
1015858710 6:137653065-137653087 CAGCAGCTGCCTGAGCCCCAAGG + Intergenic
1018905094 6:168071444-168071466 CAGCAGAGCCCTGTGGCCCCAGG - Intronic
1019149151 6:169992896-169992918 CAGGTGGGCCCTCTGCCCCAGGG + Intergenic
1019260864 7:81297-81319 CAGCAGTTCCCTTTTCCCCATGG + Intergenic
1019512871 7:1426757-1426779 CAGCAGGACCCTGTCCCCCCAGG - Intergenic
1019672532 7:2289230-2289252 CAGCACCTCCCTGTTCCACACGG + Intronic
1019698429 7:2460660-2460682 CAGCTGGTCGCTGTGCCCATTGG + Intergenic
1020105176 7:5419518-5419540 CAGATGGTCTCTGTACCCCAGGG + Intronic
1024236211 7:47401060-47401082 CTGCAGGCGCCTGTGCCCCAGGG - Intronic
1024249059 7:47492542-47492564 GGGCAGGTGCCTGTGCCTCAAGG + Intronic
1024626336 7:51211094-51211116 CAGTAGGTCACTGTGCCACTGGG + Intronic
1025095138 7:56090721-56090743 CAGCAGGACCCTGAGCCAAAGGG - Intronic
1029306600 7:99624315-99624337 AAGCAGCTCCTCGTGCCCCATGG - Intronic
1030058759 7:105606749-105606771 CACCAAGTCCCTGTGGCCCAGGG + Exonic
1030440630 7:109584181-109584203 GAGTTGGTCCCCGTGCCCCAGGG + Intergenic
1030756722 7:113294945-113294967 CAGCAGCTGCATGTGCCACAGGG + Intergenic
1034989485 7:155538976-155538998 CAGCAGGAATCTGAGCCCCAAGG + Intergenic
1035370926 7:158378437-158378459 CCGCAGGTCCCAGTGACTCATGG + Intronic
1035471166 7:159109678-159109700 CAGCTGTTCCCTGACCCCCAGGG + Intronic
1035605326 8:926605-926627 GAGCAGCTCCCTGTGCCACCCGG - Intergenic
1035699974 8:1631035-1631057 CGGGAGGTCCGGGTGCCCCAAGG + Intronic
1035729522 8:1844415-1844437 CAGCAGGCCCCGGTGACCCCTGG - Intronic
1037770749 8:21798055-21798077 CAGCAGGTGCCTGTACCCCTGGG - Intronic
1038432973 8:27514722-27514744 CAGGAGGTTCCTGTGACCCCCGG + Intronic
1039577048 8:38632115-38632137 CAGCAGAGCCCTGGGGCCCACGG - Intergenic
1039611333 8:38921617-38921639 CAGCAGGTTCCCCTGGCCCAGGG + Intronic
1039965612 8:42281515-42281537 CGGCAGGCCACTGTGCCCCTTGG + Intronic
1040817449 8:51523760-51523782 CAGGAGGTCCCTCAGGCCCAGGG + Intronic
1040898150 8:52389757-52389779 GAGCAGCTTCCTGTGACCCAGGG - Intronic
1042210124 8:66371711-66371733 AAGCACCTCCCTATGCCCCAGGG - Intergenic
1044169156 8:89027300-89027322 GAGCTGGTTCCTGTGCCTCAGGG + Intergenic
1048204810 8:132406991-132407013 GAGCCAGCCCCTGTGCCCCAAGG + Intronic
1048445924 8:134493295-134493317 CACCAGGTCCCTGGGCCTGAGGG + Intronic
1049099802 8:140570627-140570649 CGTCCGGTGCCTGTGCCCCACGG - Intronic
1049431833 8:142568986-142569008 CAGCAGCTCCCTGCCCCACACGG + Intergenic
1049546746 8:143235595-143235617 CAGCAGGTCCCTCGGGCTCAGGG + Intergenic
1049601609 8:143510348-143510370 CAGCAGGGTCGTGTCCCCCACGG + Intronic
1050358311 9:4804218-4804240 CAGCAGTTCCTTGGGACCCAGGG + Intronic
1050391554 9:5148720-5148742 GAGCAGGTCCTGGTGCCCCAGGG - Intronic
1051170002 9:14312895-14312917 CAGCAGGTCACTATGGACCAGGG + Intronic
1051707518 9:19896026-19896048 CAGCAGGTCCCCTTGCCTCTGGG + Intergenic
1053133656 9:35635602-35635624 CAGCAGGTTCCTCTGCCCTCTGG + Intronic
1053185411 9:36012200-36012222 AAGTAGGCCCCTGTGCCCCATGG - Intergenic
1053351813 9:37418216-37418238 CAGCAAGTCCCTGGGCCACCTGG + Intergenic
1054456375 9:65433382-65433404 CAGCAGGTGCATGTGCCCTGTGG + Intergenic
1055391383 9:75825783-75825805 AAGCGTTTCCCTGTGCCCCAAGG + Intergenic
1055717665 9:79135875-79135897 CACCAGGTCACTGTGTCACAAGG + Intergenic
1057719852 9:97523324-97523346 CAGCAGGACCCTGGGGACCAGGG - Intronic
1058646044 9:107132366-107132388 CAGCAGGTCCCTGTCCTCAGAGG + Intergenic
1058694473 9:107547792-107547814 CAGCAGGCTCCTGGCCCCCATGG - Intergenic
1059657372 9:116368774-116368796 CAGTAGCTCCCTGGGCTCCATGG - Intronic
1059691089 9:116687077-116687099 GAGCAGGTCCCTTTCGCCCATGG + Intronic
1060111711 9:120911304-120911326 AGGCAGGTCTCTGTGCCCCTGGG + Intronic
1060410301 9:123395646-123395668 CAGCTGGGCCCTCGGCCCCAGGG - Intronic
1060792676 9:126496869-126496891 CTCCAGGCCCCTGTCCCCCAGGG + Intronic
1060815160 9:126631329-126631351 CTGATGCTCCCTGTGCCCCAAGG - Intronic
1061100275 9:128486841-128486863 CAGCAGGGCCCTGAGCACCCTGG - Intronic
1061185128 9:129048545-129048567 CAGCAGGTGCCAGGGCTCCAGGG + Intronic
1061841457 9:133360723-133360745 AATCAGGTCCCTGTGCCCAGGGG - Intronic
1062002546 9:134223999-134224021 CAGCAGGCGCCGGTCCCCCATGG - Intergenic
1062052582 9:134455290-134455312 CAGCACGTCCCTGAGCCTGAGGG + Intergenic
1062127217 9:134870252-134870274 CAGCAGGTCTCGCAGCCCCACGG + Intergenic
1062281033 9:135751730-135751752 CAGCAGGGCCCTGCGGCCCTCGG + Intronic
1062396083 9:136353443-136353465 AAGCAGGACCCTGGGCCCCAAGG - Intronic
1203669280 Un_KI270754v1:37102-37124 CAGGAGGTCCCCCTACCCCACGG - Intergenic
1187244856 X:17545050-17545072 CAGCAGGTCCCTGCCCAGCAGGG - Intronic
1188212760 X:27443922-27443944 CAGCTGCTGCCTGGGCCCCAGGG - Intergenic
1189200515 X:39191849-39191871 CACCATGTCCCTGTGTCCCCAGG + Intergenic
1190619953 X:52277094-52277116 CAACAGGACACTGTGGCCCATGG - Intergenic
1190774977 X:53545354-53545376 CAGCAGATCCCTGTGGCCATAGG - Intronic
1193251770 X:79299151-79299173 GAGCAGGTCCTTGTTACCCAGGG + Intergenic
1193440849 X:81537887-81537909 CAGCTGGGCCCTGTGCCTCTTGG + Intergenic
1194760193 X:97787384-97787406 CAGCATGTGCCTGTGACCCAAGG + Intergenic
1195017626 X:100794785-100794807 CAGCTGGACCCTGTGGCTCAAGG + Intergenic
1195702658 X:107716579-107716601 CCGCCGGTCCCTGTTCCCCGCGG - Intronic
1197064328 X:122220745-122220767 CAGCTGCTGCCTGGGCCCCAAGG + Intergenic
1198035609 X:132798331-132798353 CAGGAGGTCCCTGTTCCTCTTGG - Intronic
1198277770 X:135112707-135112729 GAGCAGGTCCTGGTGCACCAAGG - Intergenic
1198583807 X:138096748-138096770 GTGCATGTCCCTGGGCCCCAGGG - Intergenic
1199683010 X:150240403-150240425 CAGGGGCTCACTGTGCCCCAGGG + Intergenic
1199743906 X:150759981-150760003 CAGCAGGGTCCTGAGCCTCACGG + Intronic
1200022627 X:153225028-153225050 CAGAAGGTCCCTGTGAGTCATGG + Intergenic