ID: 976499422

View in Genome Browser
Species Human (GRCh38)
Location 4:85770389-85770411
Sequence GTGAACAATAGGAGGACTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976499422_976499428 17 Left 976499422 4:85770389-85770411 CCAATAGTCCTCCTATTGTTCAC 0: 1
1: 0
2: 0
3: 14
4: 117
Right 976499428 4:85770429-85770451 ACTTCCTAGGTTTGTTTTCTTGG 0: 1
1: 1
2: 4
3: 67
4: 497
976499422_976499425 4 Left 976499422 4:85770389-85770411 CCAATAGTCCTCCTATTGTTCAC 0: 1
1: 0
2: 0
3: 14
4: 117
Right 976499425 4:85770416-85770438 TAAATGTCTCCCTACTTCCTAGG 0: 1
1: 0
2: 2
3: 21
4: 194
976499422_976499429 18 Left 976499422 4:85770389-85770411 CCAATAGTCCTCCTATTGTTCAC 0: 1
1: 0
2: 0
3: 14
4: 117
Right 976499429 4:85770430-85770452 CTTCCTAGGTTTGTTTTCTTGGG 0: 1
1: 0
2: 4
3: 65
4: 630

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976499422 Original CRISPR GTGAACAATAGGAGGACTAT TGG (reversed) Intronic
901744224 1:11361959-11361981 GTGAAGAAGTGGATGACTATGGG + Intergenic
906488852 1:46252021-46252043 GTGCACAACAGGAGACCTATGGG + Intronic
907391842 1:54163264-54163286 GTGAACAGTAGGAGGCCCAGGGG - Intronic
909823393 1:80094937-80094959 ATCAACAATAGGAGGAATTTTGG - Intergenic
909903621 1:81169585-81169607 ATGTACAATATGAGGACTATAGG - Intergenic
910206037 1:84749628-84749650 GTGAACAACATGAGAACTACAGG + Intergenic
910727368 1:90353101-90353123 GTGACCTATAGAAGGCCTATAGG + Intergenic
911047924 1:93643711-93643733 ATGGACAACATGAGGACTATAGG + Intronic
918418019 1:184332451-184332473 GTGAACCAAAGGAGGAATAAAGG - Intergenic
918598970 1:186330436-186330458 GTGAACAAAAGGTGAACTACAGG - Intronic
919224939 1:194685369-194685391 GTGAACAATAGTAGGAGAATTGG - Intergenic
1063723077 10:8604378-8604400 GTGAACAATCGTTGGAATATGGG - Intergenic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1077310154 11:1884886-1884908 CTGAATAATTGGAGGAGTATTGG - Intronic
1080729847 11:34938141-34938163 GTGAACAGAAGGACGACTAGAGG + Intronic
1080930306 11:36803160-36803182 GTGATCATTAGAAGGACTGTTGG + Intergenic
1082710477 11:56548480-56548502 ATGAACAACATGAGGACTAGGGG - Intergenic
1098126806 12:67305012-67305034 GGGAACATTAGCAGTACTATAGG + Intronic
1098711134 12:73763808-73763830 ATCAACAATAGGAGGAATACTGG - Intergenic
1098795545 12:74884011-74884033 ATGTACAACATGAGGACTATTGG + Intergenic
1101529378 12:105560162-105560184 CTGAAAAATAGAAGGACTCTAGG + Intergenic
1104283448 12:127400006-127400028 GTGCACAGTAGAAGGGCTATTGG + Intergenic
1106095398 13:26638981-26639003 GTGGAAAATAGGAGGACAGTGGG - Intronic
1106168131 13:27266913-27266935 GTGAACAAGAGGAGGACCCTTGG + Intergenic
1109192638 13:59344065-59344087 GTGAACAAAAGGGAGACTAAAGG + Intergenic
1110739832 13:78981760-78981782 GGGAAAAATAGGAGGAGTCTTGG + Intergenic
1111290023 13:86154690-86154712 GTGAACAATCAGTGGAGTATTGG - Intergenic
1116585125 14:46693951-46693973 GGGAACAAAAGGAAGACTACTGG - Intergenic
1120246638 14:82014099-82014121 GTGAACAATAGGTCTACTTTAGG - Intergenic
1121757709 14:96416984-96417006 GTGAACCATAAGAGAACCATAGG - Intronic
1123386873 15:19820387-19820409 GTGGACAATTGGAGCACTTTGGG - Intergenic
1124686124 15:31783475-31783497 GTGAAGAATATGAAGACTACTGG - Intronic
1129573851 15:76719473-76719495 ATGTACAACAGGAGGGCTATAGG + Intronic
1129805293 15:78451577-78451599 GTAAACAATACGAGTACTACAGG + Intronic
1130334063 15:82943722-82943744 CAGAACAAAAGGAGGACTAAAGG + Intronic
1136425341 16:30166394-30166416 GTGAACAATAGGAGTGAAATAGG + Intergenic
1139173635 16:64662047-64662069 ATGAACAATATTAGAACTATAGG + Intergenic
1143121199 17:4608102-4608124 GGGAAGAACAGGAGGACTTTGGG - Exonic
1144383994 17:14731741-14731763 GTGAAAAACAGGAAGACTACTGG - Intergenic
1149097192 17:52857028-52857050 CTGAACAATAGCAGAACAATGGG + Intergenic
1152847341 17:82609713-82609735 GTGAACAATAAGGGGCCTATGGG + Intronic
1156040810 18:32820112-32820134 GTCAATCTTAGGAGGACTATAGG + Intergenic
1158007424 18:52688559-52688581 ATGCACAACATGAGGACTATAGG + Intronic
1158514277 18:58118554-58118576 ATGAACAAGAGGAGGAATACAGG - Intronic
1159306220 18:66646505-66646527 GTGTACAACATGAGGACTATAGG - Intergenic
925239226 2:2308153-2308175 GTGAAGAGTAGGTGGAGTATGGG - Intronic
925239247 2:2308377-2308399 GTGAAGTATAGGTGGAGTATGGG - Intronic
926256972 2:11212587-11212609 GTAGAAAATAGGAGGAGTATTGG - Intronic
926619960 2:15038658-15038680 GTGAACAGTAGGAGGACTTCTGG + Intergenic
926848561 2:17169402-17169424 TTGAACATTTGGAGGATTATTGG + Intergenic
929034552 2:37678161-37678183 TTGAAAAATAAGAGGAATATAGG - Intronic
934934460 2:98454605-98454627 GTGAAAAATAAGAGTACTGTGGG - Intronic
938368503 2:130754896-130754918 TTTAACAAGAGGAGGACTGTGGG + Intergenic
939440300 2:142240019-142240041 GGGAACAACATGAGGACTATAGG + Intergenic
939456703 2:142446368-142446390 TGGAACAATAGGAGCACTAAGGG + Intergenic
948087469 2:235263529-235263551 GTAAAGGAGAGGAGGACTATGGG - Intergenic
948659500 2:239498402-239498424 GTAAACAATTGGAGGACTTCGGG + Intergenic
1169475181 20:5924485-5924507 ATGAACAATAAGAGGACCAAGGG - Intronic
1171728363 20:28650085-28650107 GTGGATAATAGGAGTACTTTGGG + Intergenic
1174628396 20:51935101-51935123 GTGAACCCTGGGAGGACAATGGG + Intergenic
1176475712 21:7203010-7203032 GTGGATAATAGGAGTACTTTGGG - Intergenic
1179020029 21:37631557-37631579 GTTCACAATAGCAGGACGATTGG + Intronic
1181790813 22:25264652-25264674 GTGAACAAGAGGGGCAATATGGG + Intergenic
1181826629 22:25521693-25521715 GCGAACAAGAGGAGCAATATGGG + Intergenic
1182175172 22:28278522-28278544 CTGAAAAATAGGAAGCCTATAGG - Intronic
1183804564 22:40197229-40197251 GTGCAGAATAGGAGGTCTTTGGG + Intronic
957656466 3:83084184-83084206 CTGCAGAATAGGAGGAATATTGG - Intergenic
958594602 3:96205361-96205383 GTCAAAAATAAGATGACTATAGG - Intergenic
958918947 3:100081206-100081228 GTGAAGATTAGAAGGACTCTTGG - Intronic
959676994 3:109047168-109047190 ATGTACAATATGAGGACTGTAGG - Intronic
960010660 3:112831421-112831443 GTGAAGAATACAATGACTATTGG + Intronic
960906461 3:122606590-122606612 GTCAACTATAGGAGGAATATAGG - Intronic
963835475 3:150054431-150054453 GAGAACAAGATGAGGGCTATGGG - Intergenic
964249458 3:154694791-154694813 GTGAACAATACAATGGCTATCGG + Intergenic
964335269 3:155648206-155648228 GGGAACAATAGTAGTAGTATTGG + Intronic
964920123 3:161885849-161885871 GTTAAGATTTGGAGGACTATTGG + Intergenic
965492857 3:169361217-169361239 GTGCACAGGAGGAGGACTAGGGG - Intronic
971733514 4:30416763-30416785 GTGTACAATAGGGGGACCCTGGG - Intergenic
971744431 4:30560646-30560668 GTGAAGGATAGGAAGACAATGGG + Intergenic
974220601 4:58965005-58965027 ATGTACAACAGGAGGACTATAGG + Intergenic
974909665 4:68101901-68101923 ATGTACAACATGAGGACTATAGG - Intronic
975448300 4:74493912-74493934 ATGAACAACATGAGGACTATAGG - Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
977376070 4:96205614-96205636 GTGAACAGTAGGGGACCTATGGG - Intergenic
980453659 4:133010030-133010052 GTGAACATTAGGAAGATCATTGG - Intergenic
982146199 4:152395847-152395869 GTGAAAAATAGGTGGTCTATGGG + Intronic
982212965 4:153055835-153055857 ATAAACAATAGGAGGAGTAGGGG + Intergenic
984745366 4:183210368-183210390 ATGTACAACATGAGGACTATAGG + Intronic
984813413 4:183816146-183816168 GTGAAGAGTAAGAGGAATATTGG + Intergenic
992488208 5:77215988-77216010 GTGACCAATCGGAGGGCTGTAGG + Intronic
993582864 5:89684611-89684633 TAGCACAATAGGATGACTATAGG + Intergenic
995976454 5:118041867-118041889 GTGAAAAAAATGAAGACTATAGG + Intergenic
998553113 5:143096717-143096739 GTGAAGAATACAATGACTATTGG + Intronic
999993938 5:157073924-157073946 TTGAACAATATGAGGGCTAGTGG - Intergenic
1004306142 6:14503540-14503562 GTGATCATTAGGAGGATTAAAGG - Intergenic
1006435223 6:34022620-34022642 GTGAGCAACAGGAGGACGAGGGG - Exonic
1008220768 6:48851596-48851618 GTTAAGACTAGGCGGACTATTGG - Intergenic
1009328197 6:62380444-62380466 GGGAACAATAAGAAGAGTATGGG + Intergenic
1012502063 6:99899189-99899211 ATGTACAACATGAGGACTATAGG - Intergenic
1013960705 6:115896387-115896409 GTGACCAAAAGCAGCACTATAGG + Intergenic
1017127581 6:151080275-151080297 GTGAACGATTTGAGGACTTTTGG + Intronic
1020705329 7:11537096-11537118 GTTAGCACTAGGAGGAATATGGG - Intronic
1021938358 7:25653780-25653802 GTGATGAAAAGGAGGACAATTGG + Intergenic
1024819101 7:53306055-53306077 GTGAACCCTCGGAGGACTAAGGG + Intergenic
1025572262 7:62589377-62589399 GTGAGCAATTTGAGGCCTATGGG - Intergenic
1028951927 7:96645795-96645817 GTGACTAATAGGAGAACTAGGGG + Intronic
1031453872 7:121955954-121955976 GTGAAAGATAGGAGGACTTTGGG + Intronic
1032695468 7:134332222-134332244 ATGTACAACATGAGGACTATAGG - Intergenic
1032949764 7:136894023-136894045 GTGAATAATACTAGGACTCTAGG - Intronic
1044049073 8:87476967-87476989 ATGTATAACAGGAGGACTATAGG + Intronic
1046960207 8:120103607-120103629 GTGAGAAATAGGAGAACAATTGG + Intronic
1047867025 8:129035966-129035988 GGGAGAAATAGGAGGACTAATGG + Intergenic
1048434811 8:134406331-134406353 ATGTACAACAGGAGGACTGTAGG - Intergenic
1050338670 9:4614240-4614262 GTGAACAATGGGAGTACTAAAGG - Intronic
1050455941 9:5834075-5834097 GTGGGCAAGAGCAGGACTATAGG - Intergenic
1051436606 9:17040323-17040345 ATGAACAACATGAGGACTACAGG - Intergenic
1052984706 9:34478298-34478320 GTGTACAATAGGAAGACCAGAGG + Intronic
1053711674 9:40817385-40817407 GTGGACATTTGGAGGACTTTTGG + Intergenic
1054422137 9:64949263-64949285 GTGGACATTTGGAGGACTTTTGG + Intergenic
1055870153 9:80867438-80867460 ATATACAACAGGAGGACTATAGG - Intergenic
1058453759 9:105120382-105120404 GTGAAGAAAATGAGGTCTATAGG + Intergenic
1058733360 9:107871605-107871627 ATGTACAACATGAGGACTATAGG - Intergenic
1059845427 9:118270199-118270221 GTGAAAAAGAGCAGGACTAGGGG - Intergenic
1185601339 X:1341763-1341785 GTGAGCCAAAGGAGGACCATCGG - Exonic
1187377158 X:18765379-18765401 GTGTACAACACGAGGACTATAGG + Intronic
1187621125 X:21056410-21056432 GTGTACAACATGAGAACTATAGG - Intergenic
1190124548 X:47692141-47692163 ATGTACAACATGAGGACTATAGG + Intergenic
1190969111 X:55331732-55331754 GTGAACATTAGGAAGACAAAAGG + Intergenic
1201798826 Y:17931116-17931138 GTGAACTATTGGTGAACTATTGG - Intergenic
1201802727 Y:17974841-17974863 GTGAACTATTGGTGAACTATTGG + Intergenic
1202360129 Y:24099732-24099754 GTGAACTATTGGTGAACTATTGG - Intergenic
1202510648 Y:25570382-25570404 GTGAACTATTGGTGAACTATTGG + Intergenic