ID: 976499425

View in Genome Browser
Species Human (GRCh38)
Location 4:85770416-85770438
Sequence TAAATGTCTCCCTACTTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 194}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976499423_976499425 -4 Left 976499423 4:85770397-85770419 CCTCCTATTGTTCACAAAATAAA 0: 1
1: 1
2: 2
3: 24
4: 311
Right 976499425 4:85770416-85770438 TAAATGTCTCCCTACTTCCTAGG 0: 1
1: 0
2: 2
3: 21
4: 194
976499422_976499425 4 Left 976499422 4:85770389-85770411 CCAATAGTCCTCCTATTGTTCAC 0: 1
1: 0
2: 0
3: 14
4: 117
Right 976499425 4:85770416-85770438 TAAATGTCTCCCTACTTCCTAGG 0: 1
1: 0
2: 2
3: 21
4: 194
976499420_976499425 30 Left 976499420 4:85770363-85770385 CCAATGCTTTCTCACCTAAGAAA 0: 1
1: 0
2: 0
3: 33
4: 312
Right 976499425 4:85770416-85770438 TAAATGTCTCCCTACTTCCTAGG 0: 1
1: 0
2: 2
3: 21
4: 194
976499421_976499425 16 Left 976499421 4:85770377-85770399 CCTAAGAAAATTCCAATAGTCCT 0: 1
1: 0
2: 1
3: 18
4: 258
Right 976499425 4:85770416-85770438 TAAATGTCTCCCTACTTCCTAGG 0: 1
1: 0
2: 2
3: 21
4: 194
976499424_976499425 -7 Left 976499424 4:85770400-85770422 CCTATTGTTCACAAAATAAATGT 0: 1
1: 0
2: 4
3: 40
4: 422
Right 976499425 4:85770416-85770438 TAAATGTCTCCCTACTTCCTAGG 0: 1
1: 0
2: 2
3: 21
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976499425 Original CRISPR TAAATGTCTCCCTACTTCCT AGG Intronic
902811018 1:18887945-18887967 GAAATTTCTCCCTGCTTCATTGG - Intronic
904907790 1:33910952-33910974 TACATTTCTCCTTATTTCCTAGG + Intronic
905829375 1:41052852-41052874 GAAATGTCTTCCATCTTCCTTGG + Intronic
906030067 1:42711797-42711819 TAAAAGTCTCCCTACTGGCCAGG - Intergenic
906716974 1:47977626-47977648 TGACTGTCTAGCTACTTCCTGGG + Intronic
907294406 1:53440161-53440183 TGAGTGTCCCCATACTTCCTAGG - Intergenic
913463288 1:119112419-119112441 TAAATGTCTCCCTCTCTGCTGGG - Intronic
916884235 1:169051660-169051682 TAAATGACTTCATCCTTCCTGGG - Intergenic
918474174 1:184905444-184905466 TCAATGTTTCCCTATTGCCTAGG + Intronic
919215677 1:194550236-194550258 TAAAAGTCTCCATACTACATGGG - Intergenic
920247844 1:204601828-204601850 CAAACGACTCCCTACCTCCTGGG + Intergenic
1063220834 10:3966246-3966268 TAGATATCACCATACTTCCTTGG + Intergenic
1063758412 10:9042600-9042622 GAAATGTCTCCCGATTTCCTGGG + Intergenic
1064895800 10:20234883-20234905 TAAATGAATCCCTGCTTCCTTGG + Intronic
1066002135 10:31114608-31114630 GCAATGTGTCCCCACTTCCTGGG + Intergenic
1066232419 10:33449284-33449306 TGAGTTTCTCCCTACCTCCTTGG + Intergenic
1066371215 10:34819734-34819756 CAAATATCTCCCTCCTTCCCAGG + Intergenic
1067395563 10:45913804-45913826 AAATTCTCTCCCTACCTCCTAGG - Intergenic
1067863886 10:49882928-49882950 AAATTCTCTCCCTACCTCCTAGG - Intronic
1068087904 10:52398042-52398064 TAAATGGCTGCCTACTTTCTAGG - Intergenic
1068781405 10:60922565-60922587 AGAATGTCTCCCTACTTCCTGGG - Intronic
1069412165 10:68164966-68164988 TAGATCTCTCACTATTTCCTTGG - Intronic
1070188396 10:74088448-74088470 TAAATGCCTACCTTCCTCCTAGG - Intronic
1071008881 10:80914543-80914565 TAAATGTTTCTTTACTTCCAGGG + Intergenic
1071719430 10:88128514-88128536 TTAATGTCTCCCTACTGACAGGG + Intergenic
1072656037 10:97331197-97331219 TGAGTGTTTCTCTACTTCCTAGG - Intergenic
1072709263 10:97705314-97705336 TACCTTTCTCCCCACTTCCTGGG - Intergenic
1074665841 10:115722867-115722889 TAAATGTCTACCTACTTTCAAGG + Intronic
1075745214 10:124722792-124722814 TACACGTCTCCCTCCTTCCTGGG - Intronic
1076772229 10:132672072-132672094 TAGTTCTCTCCCTACATCCTTGG - Intronic
1076988489 11:256776-256798 TAAATGTGAGACTACTTCCTAGG + Intergenic
1078938419 11:15973636-15973658 TAAATGTCTACATATTTCCATGG + Intronic
1085117732 11:73945051-73945073 GTCCTGTCTCCCTACTTCCTGGG - Intergenic
1085316676 11:75549258-75549280 TAAAGGTCTCCCTCCTCCTTTGG + Intergenic
1085425712 11:76402906-76402928 TAAATGTCTACCTCCAGCCTAGG - Intronic
1088982882 11:114879533-114879555 TTAATGTCTTCCTACTGCCTTGG + Intergenic
1090099083 11:123774845-123774867 TAAGTGTTTCCCTACCTACTTGG - Intergenic
1091488356 12:911524-911546 TAACTGGATCCCTAATTCCTGGG + Intergenic
1094703142 12:32889758-32889780 TAAAAGTCTGCCTACATTCTGGG - Intronic
1098311978 12:69157503-69157525 TCAATGGCTCTCTAGTTCCTGGG - Intergenic
1098606924 12:72402510-72402532 TGCATGTCTTCCTACTGCCTGGG + Intronic
1099373447 12:81866301-81866323 CTGATGTCTGCCTACTTCCTGGG + Intergenic
1100445823 12:94658641-94658663 TAAATGTCTACTTATTTCCTAGG + Intergenic
1100801534 12:98236267-98236289 TACATGTTTCCCTAATTCATGGG + Intergenic
1101647887 12:106648016-106648038 TAAAGCTCTCACTACTTCCCAGG - Intronic
1102288311 12:111677828-111677850 TAAATGTCTCCCTAAATGATGGG + Intronic
1104049162 12:125184972-125184994 TAAATGAGTTCCGACTTCCTAGG + Intergenic
1104148249 12:126056022-126056044 GAAATGTGTCCCTACCTCCCTGG + Intergenic
1111456820 13:88495348-88495370 TAAATATCTCACGAATTCCTTGG - Intergenic
1112193993 13:97207040-97207062 CAACTTTCTCCCTACCTCCTTGG + Intergenic
1112929620 13:104717989-104718011 TAAGTGTCTCTCTCCTTCATTGG - Intergenic
1113051770 13:106220117-106220139 TGAATGTCTGCTTACTTCCTGGG - Intergenic
1113198945 13:107843038-107843060 TAAATGTATTTCTACTGCCTAGG - Intronic
1114317405 14:21521906-21521928 TTCATTTCTCCCTACTTCCTAGG + Exonic
1120441292 14:84543917-84543939 GAAATGTCTCTCAACTTCTTAGG + Intergenic
1122766388 14:104074061-104074083 TAGATGTCTTCCTGCTTCCCTGG + Intergenic
1123002881 14:105305731-105305753 TAAATGTTTCCAAGCTTCCTGGG - Exonic
1125325267 15:38530185-38530207 TACATGCCTCCCTGCTTCCTTGG + Intronic
1127721158 15:61701261-61701283 TAACTGTTTACCTAGTTCCTTGG + Intergenic
1127759896 15:62128598-62128620 TAATTGTCTCTCTACTTTTTAGG - Intergenic
1130879559 15:88043444-88043466 TAACTTTCCCCCAACTTCCTGGG + Intronic
1131667115 15:94582166-94582188 TAAATGTCGCCATACTTCACGGG + Intergenic
1134032669 16:11004980-11005002 AAAATGTCTGCCTAATCCCTAGG + Intronic
1135657813 16:24266935-24266957 TAATTATTTCCCTAGTTCCTTGG - Intronic
1136650172 16:31662378-31662400 TGCCTGTCTCCTTACTTCCTGGG + Intergenic
1137463750 16:48689496-48689518 AACCTGTTTCCCTACTTCCTTGG + Intergenic
1140349638 16:74249692-74249714 TAAAAGTCTCACTACTTGCAGGG + Intergenic
1140877601 16:79167435-79167457 TAAATGTCTCCCTGTCTCCAAGG - Intronic
1146818558 17:35965153-35965175 TAAATAACTCCCTGCTTCATTGG - Intergenic
1147483433 17:40789091-40789113 TAAATCTGTCCTTCCTTCCTTGG - Intergenic
1147507992 17:41039449-41039471 TAAATGTTTCCCTGAGTCCTGGG - Intergenic
1147609763 17:41794560-41794582 CAAATGACCCCCTACTGCCTGGG + Intergenic
1150261423 17:63795037-63795059 TATTTCTTTCCCTACTTCCTTGG - Intronic
1151321984 17:73358021-73358043 TCATTATCTCCCTTCTTCCTGGG - Intronic
1151590599 17:75041704-75041726 TAAATGTTTGCCCACCTCCTGGG - Intronic
1154118754 18:11634415-11634437 AAAATGTCTCCCTCTGTCCTGGG + Intergenic
1154253054 18:12760284-12760306 TAACTCTCTCCTTTCTTCCTTGG + Intergenic
1155358193 18:24974043-24974065 TATATGTCTCTCATCTTCCTTGG - Intergenic
1156114849 18:33775451-33775473 TAATTGTCCTCCTGCTTCCTAGG + Intergenic
1156854067 18:41761713-41761735 TAAATGATTCTTTACTTCCTCGG + Intergenic
1158498540 18:57979086-57979108 TAAATGTCACCCTCCAGCCTGGG + Intergenic
1158643653 18:59223739-59223761 CAAATGCATCACTACTTCCTGGG + Intronic
1158780218 18:60640200-60640222 TATATATGTCCCTATTTCCTAGG + Intergenic
1159805571 18:72953943-72953965 TACATTTCTCCAGACTTCCTTGG - Intergenic
1159848251 18:73492949-73492971 TAAATGTCTTATTTCTTCCTAGG + Intergenic
1162865494 19:13542984-13543006 TCAATTTCTCCCTAAGTCCTTGG - Intronic
1164889839 19:31814030-31814052 TAAATGTCTCCCAAAGTTCTTGG + Intergenic
1165107974 19:33485613-33485635 ATAATGTCCCTCTACTTCCTGGG + Intronic
1167003738 19:46761722-46761744 TAAACATCTGCCTACCTCCTTGG + Intronic
927496333 2:23554092-23554114 GAAATGCCTCCCTGCCTCCTGGG - Intronic
927924914 2:27005165-27005187 TAAATCTGTGACTACTTCCTTGG - Intronic
928663408 2:33526889-33526911 TACATGTCTGCCTACCTACTAGG - Intronic
929703264 2:44183632-44183654 TAATTCTCTCCCTTCCTCCTGGG - Intronic
930269227 2:49236282-49236304 TCAATCTCACCCTAGTTCCTAGG + Intergenic
931227245 2:60342227-60342249 AAAATGTCTCTCTTCTTGCTAGG - Intergenic
933615060 2:84475210-84475232 TTCCTGTCTCCCTACTTCCTGGG - Intergenic
933646854 2:84820134-84820156 TAATGGTCTGCCTGCTTCCTCGG + Intergenic
936282059 2:111150604-111150626 GCAATGGCTCCCTGCTTCCTCGG - Intronic
938581037 2:132646776-132646798 TAAATGTATCCCTACTGAATGGG + Intronic
938831845 2:135057989-135058011 AAGCTTTCTCCCTACTTCCTAGG + Exonic
940376546 2:152964893-152964915 TAAATGCCTACCAACTTCCTTGG - Intergenic
940494663 2:154410684-154410706 TAAATGTCTCCCCAATATCTTGG - Intronic
941462375 2:165787025-165787047 TTAATGTCTGCCTCCTTCGTGGG + Intronic
943774855 2:191754207-191754229 TAATTCTCTCCCCACTTTCTTGG + Intergenic
943941166 2:193999688-193999710 TACATGTGTCCCTTCTACCTTGG - Intergenic
944410416 2:199435911-199435933 TAAAAATCTACCTACTTCCTTGG - Intronic
945158950 2:206868957-206868979 TAAATATCTGCCTTCTTCATTGG + Intergenic
948451459 2:238076868-238076890 TATATGTCTACATACATCCTAGG - Intronic
948784372 2:240344226-240344248 TAAATCTCTTTGTACTTCCTAGG - Intergenic
1168890782 20:1294367-1294389 TAAATGGCTCACTGCCTCCTGGG - Intronic
1172785283 20:37464578-37464600 TCAAAGTCCCCCTCCTTCCTGGG + Intergenic
1173854996 20:46244582-46244604 TAAATGTATCCCTATTTTCCAGG + Intronic
1174879012 20:54256742-54256764 AAAAAGTCTCCAAACTTCCTTGG + Intergenic
1176964810 21:15200307-15200329 CAATTTTCTCCCTATTTCCTAGG - Intergenic
1183008437 22:34924222-34924244 TTCATGCCTCCCTACTCCCTAGG - Intergenic
949340657 3:3027044-3027066 AAAAGCTCTCCCCACTTCCTAGG + Intronic
950988953 3:17410422-17410444 GAAATGACTCCCCACTTCATGGG - Intronic
951253322 3:20419241-20419263 TAACAGTCTCCCAACCTCCTTGG - Intergenic
951602728 3:24394425-24394447 TGAGGGTTTCCCTACTTCCTGGG + Intronic
955096850 3:55807212-55807234 TAAAAGTTTCTCTTCTTCCTAGG + Intronic
955650249 3:61186426-61186448 TAACTGTATTCCTCCTTCCTGGG - Intronic
956259244 3:67319313-67319335 TAAATGTCTCTCTTTGTCCTTGG + Intergenic
960355448 3:116647176-116647198 TTTATGTCTCCTTTCTTCCTTGG + Intronic
960788714 3:121402301-121402323 TAATTGTCTCTCAACTTCCACGG - Intronic
961173493 3:124815705-124815727 TGAATGTCACCCTCTTTCCTGGG - Intronic
962235411 3:133702344-133702366 GGAATGTCACCCTACTTCCTGGG - Intergenic
963511680 3:146255572-146255594 TCTGTGTCTCCCTACTTTCTGGG + Intergenic
963614031 3:147511784-147511806 CTATTGTTTCCCTACTTCCTGGG - Intergenic
964661377 3:159123901-159123923 TAAATGTTTCTCTCCTTCCTAGG + Intronic
965509797 3:169555742-169555764 TTAATATGGCCCTACTTCCTGGG + Intronic
967753936 3:193147469-193147491 TAAATAACTCTCTACTTTCTTGG + Intergenic
971763103 4:30794590-30794612 TAAATGTCTCCCTTCTTATAAGG - Intronic
971826545 4:31630790-31630812 TTGATGTCTACCTTCTTCCTAGG - Intergenic
972701047 4:41493756-41493778 CAAATGTCTCCCTGGTGCCTAGG + Intronic
972798212 4:42444293-42444315 TTAAAGTCTCACCACTTCCTGGG + Intronic
974117812 4:57601735-57601757 TAAACTTCTACCAACTTCCTTGG + Intergenic
976036864 4:80834325-80834347 TAAGTGACTCCCTACTTCTTGGG + Intronic
976499425 4:85770416-85770438 TAAATGTCTCCCTACTTCCTAGG + Intronic
977899677 4:102405173-102405195 TAAATCTTTCTTTACTTCCTAGG + Intronic
979286550 4:118931860-118931882 TAAATGTTTGTCTATTTCCTGGG + Intronic
979691676 4:123565641-123565663 TATATTTCTACCTACTTCCCTGG + Intergenic
980793327 4:137648583-137648605 TAACAGTCTCACAACTTCCTAGG + Intergenic
981459983 4:145001978-145002000 TACATGTCTTCCTACTGCCATGG + Intronic
982402051 4:154978865-154978887 TAAATGTCAGTCTGCTTCCTGGG + Intergenic
982447269 4:155507469-155507491 TAAATCTCTCCCTTCTTTCTTGG - Intergenic
982583792 4:157211438-157211460 TAAGTGTCTCTCTATTGCCTAGG + Intronic
984472575 4:180194870-180194892 TAAATGTTTCCCCACTCCTTTGG - Intergenic
984665048 4:182418159-182418181 GAAATGTTTCCCTACTTTTTTGG - Intronic
988334501 5:29888508-29888530 CAAAGGTCTCCTTACTTCCCTGG - Intergenic
989400424 5:41002142-41002164 TAAATGTCTCTCTACCTTTTTGG - Intronic
989736775 5:44716942-44716964 AAAATGTCTTCGTATTTCCTAGG - Intergenic
990795483 5:59535167-59535189 GAAATGCATCCCTACTTGCTCGG - Intronic
992664724 5:78996128-78996150 TCAATGTCTCCCTCCTTATTGGG + Intergenic
992894594 5:81235194-81235216 TAAATATCTCCTTCCTGCCTAGG + Intronic
994762152 5:103868319-103868341 TAAATATGTCCCTATTTTCTGGG + Intergenic
995584515 5:113634032-113634054 TGAAAGTCTCCCTAATTCATTGG + Intergenic
997698191 5:135878030-135878052 TCAATGTCTCCCTATGGCCTAGG - Intronic
997905322 5:137810978-137811000 TAAATGTCACTTTACTTACTTGG + Intergenic
999517420 5:152315076-152315098 TAAAAGTCAAACTACTTCCTGGG - Intergenic
999673402 5:153976615-153976637 GAAATGTCTCCCTCCTTCTGTGG - Intergenic
1002442864 5:179273359-179273381 TGAATGTCTCCCTGCTTCTCTGG - Intronic
1004004432 6:11626166-11626188 TCAAGGTCACCCTCCTTCCTGGG - Intergenic
1008064027 6:47028277-47028299 AAAATTTCTCACTACTTCCGTGG - Intronic
1008120683 6:47613364-47613386 TAAATGTCTCCTTGATTCATGGG + Intronic
1008328551 6:50217423-50217445 TAAATTTATCCCATCTTCCTTGG + Intergenic
1011964905 6:93143520-93143542 TAAATGTCTTCCCACCTCTTTGG + Intergenic
1012953358 6:105542271-105542293 TAGAGGTATCGCTACTTCCTGGG + Intergenic
1016940454 6:149479037-149479059 TGAATGTTTCCCTGCTCCCTAGG + Intronic
1018200944 6:161395077-161395099 AAAATGTCTCCTTTCCTCCTTGG + Intronic
1018736357 6:166689705-166689727 TAAATGTCCCCCTATTTCATAGG + Intronic
1022156378 7:27665203-27665225 TAAATGTTTCCTTTCTTGCTAGG - Intergenic
1025156478 7:56611740-56611762 TTAATGTTACCCTCCTTCCTAGG - Intergenic
1025760404 7:64384008-64384030 TTAATGTTACCCTCCTTCCTAGG + Intergenic
1025810845 7:64874628-64874650 TCACTGTCTCCCTACATCCTGGG - Intronic
1030760377 7:113342746-113342768 TAAATGCCACCCTCATTCCTTGG + Intergenic
1031494549 7:122430764-122430786 TAAATGTCTTCTTTCTTTCTTGG - Intronic
1032097067 7:128944543-128944565 AAAAAGTCTCCCTCCTTCCCTGG + Intronic
1032855753 7:135832388-135832410 CAAATCACTCCCTACTGCCTGGG - Intergenic
1034783475 7:153903494-153903516 TAATTTTCTACCTACTACCTAGG - Intronic
1039944944 8:42120887-42120909 TAAATGTTTCCCTTCCTCCTGGG + Intergenic
1040610082 8:48975588-48975610 TAAAGGACACCCTACTTCCAGGG + Intergenic
1040731209 8:50449236-50449258 TAAAGGTCTCTCTACTTCCTTGG + Intronic
1043126506 8:76403312-76403334 ATAATGTCTCCCTTCATCCTGGG + Intergenic
1043403517 8:79907018-79907040 AAAATGTCTGCTTCCTTCCTTGG + Intergenic
1044222571 8:89686463-89686485 GAAATGTCTCTCTACTTCGCTGG - Intergenic
1044489704 8:92799011-92799033 TAAAAGTGGCCCTACTTCTTAGG - Intergenic
1045877198 8:106996095-106996117 TAAATTTCTCCCTTCTTCCCTGG - Intergenic
1046488968 8:114922377-114922399 CAGATGTCCCCCCACTTCCTTGG + Intergenic
1047004747 8:120608833-120608855 TCTATGTCCCACTACTTCCTTGG - Intronic
1051703223 9:19847470-19847492 TAAATCTCTCCCTCTCTCCTGGG + Intergenic
1054860325 9:69945791-69945813 TAACTCTCTCCTTCCTTCCTTGG + Intergenic
1055794930 9:79965442-79965464 TAAATCTCTCCACTCTTCCTGGG - Intergenic
1056682824 9:88734088-88734110 TATATGTCTCACAAATTCCTAGG + Intergenic
1057399887 9:94714053-94714075 TAAATGCCTGCATACTCCCTGGG - Intergenic
1059544980 9:115167086-115167108 GAAAAGTCTCCCTTATTCCTTGG + Intronic
1187666333 X:21614602-21614624 TAATTTTCTCACTACTTTCTAGG - Intronic
1188330573 X:28866130-28866152 TAAATTTCTCCCTCTTTCTTTGG - Intronic
1189275587 X:39783179-39783201 TAAATATCTCTCTAGATCCTGGG + Intergenic
1193411146 X:81164584-81164606 TCAATGTCTCTCTAATTTCTTGG + Intronic
1195737407 X:108027858-108027880 TAAATATATCCCTCTTTCCTGGG - Intergenic
1196231105 X:113222750-113222772 TACATCTCACCCTACTTTCTAGG + Intergenic
1197224630 X:123944710-123944732 TATATATTTACCTACTTCCTTGG + Intergenic
1197559722 X:128003120-128003142 ACAATGTCTACCTACTTCTTAGG + Intergenic
1197604837 X:128573478-128573500 GTAATGTCACTCTACTTCCTGGG - Intergenic
1199751236 X:150820961-150820983 TACATGTCTTTATACTTCCTTGG - Intronic
1200697212 Y:6371516-6371538 TAACTGCCTCCCTTCATCCTGGG + Intergenic
1200702918 Y:6417430-6417452 TCACTGTCTCCCTTCATCCTGGG + Intergenic
1200903985 Y:8462477-8462499 TTAATGTAACCCTATTTCCTAGG + Intergenic
1200915369 Y:8566707-8566729 TCACTAACTCCCTACTTCCTGGG - Intergenic
1200923352 Y:8632473-8632495 TCACTGCCTCCCTTCTTCCTGGG - Intergenic
1200963864 Y:9018978-9019000 TCACTGTCTCCCTTCATCCTGGG + Intergenic
1201031192 Y:9747267-9747289 TCACTGTCTCCCTTCATCCTGGG - Intergenic
1201036901 Y:9793183-9793205 TAACTGCCTCCCTTCATCCTGGG - Intergenic
1201038078 Y:9803038-9803060 TCAATGCCTCCCTTCATCCTAGG - Intergenic
1201774238 Y:17646352-17646374 TCACTCTCTCCCTTCTTCCTAGG + Intergenic
1201827319 Y:18259637-18259659 TCACTCTCTCCCTTCTTCCTAGG - Intergenic
1202177606 Y:22112182-22112204 TCACTGTCTCCCTTCATCCTGGG + Intergenic
1202213755 Y:22474213-22474235 TCACTGTCTCCCTTCATCCTGGG - Intergenic