ID: 976499428

View in Genome Browser
Species Human (GRCh38)
Location 4:85770429-85770451
Sequence ACTTCCTAGGTTTGTTTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 1, 1: 1, 2: 4, 3: 67, 4: 497}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976499424_976499428 6 Left 976499424 4:85770400-85770422 CCTATTGTTCACAAAATAAATGT 0: 1
1: 0
2: 4
3: 40
4: 422
Right 976499428 4:85770429-85770451 ACTTCCTAGGTTTGTTTTCTTGG 0: 1
1: 1
2: 4
3: 67
4: 497
976499421_976499428 29 Left 976499421 4:85770377-85770399 CCTAAGAAAATTCCAATAGTCCT 0: 1
1: 0
2: 1
3: 18
4: 258
Right 976499428 4:85770429-85770451 ACTTCCTAGGTTTGTTTTCTTGG 0: 1
1: 1
2: 4
3: 67
4: 497
976499423_976499428 9 Left 976499423 4:85770397-85770419 CCTCCTATTGTTCACAAAATAAA 0: 1
1: 1
2: 2
3: 24
4: 311
Right 976499428 4:85770429-85770451 ACTTCCTAGGTTTGTTTTCTTGG 0: 1
1: 1
2: 4
3: 67
4: 497
976499422_976499428 17 Left 976499422 4:85770389-85770411 CCAATAGTCCTCCTATTGTTCAC 0: 1
1: 0
2: 0
3: 14
4: 117
Right 976499428 4:85770429-85770451 ACTTCCTAGGTTTGTTTTCTTGG 0: 1
1: 1
2: 4
3: 67
4: 497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976499428 Original CRISPR ACTTCCTAGGTTTGTTTTCT TGG Intronic
902791433 1:18771013-18771035 ACTTCCTAGCTGTGTGATCTTGG - Intergenic
903254549 1:22085683-22085705 TCTTGCTAAATTTGTTTTCTAGG + Intronic
903647453 1:24903821-24903843 ACTTACTAGCTTTGTGTCCTTGG + Intronic
903684154 1:25118999-25119021 ACTTCCTATGTTTATGTACTTGG + Intergenic
905105154 1:35559463-35559485 GCTGCCTGGGTCTGTTTTCTGGG + Intronic
906270446 1:44473566-44473588 ACTTACTAGGCTTCATTTCTTGG + Intronic
906725514 1:48041423-48041445 ACTTCCTAGGTTGGCCTACTTGG - Intergenic
906792958 1:48674602-48674624 ACTTACTAGCTGTGTTGTCTTGG + Intronic
906818702 1:48906239-48906261 ACATGCTATGTTTGTTTTCATGG - Intronic
907320893 1:53601674-53601696 GCTTCCTAGCTGTGTGTTCTTGG - Intronic
908478658 1:64514496-64514518 AATTCCTAGGTTTCACTTCTAGG + Intronic
908632006 1:66119585-66119607 AATTCCCAGTTCTGTTTTCTGGG + Intronic
908940098 1:69421695-69421717 ACTTCCTTGATTAGGTTTCTAGG - Intergenic
909050661 1:70763946-70763968 ACTTCCTTGGTTAGTTTTTGAGG + Intergenic
909056095 1:70822993-70823015 ACTTCCTACGATTTTCTTCTTGG + Intergenic
909907569 1:81217835-81217857 AATTACTAGTTTTGTTATCTTGG - Intergenic
910140684 1:84024281-84024303 ACTTCCTAGATTTGTGCCCTTGG - Intergenic
911037022 1:93561386-93561408 GTTTCCTAGGTTGGCTTTCTAGG - Intergenic
911578876 1:99612181-99612203 ACTTCCCAGGTTTTTTATCATGG + Intergenic
912678991 1:111716460-111716482 GGTTCCTAGTTCTGTTTTCTGGG + Exonic
912684818 1:111754186-111754208 AATTCCCAGGTTTGTGGTCTGGG + Intronic
913035777 1:114964469-114964491 ATTGCCTAGGTTTTTTTTCTAGG + Intronic
913327871 1:117643253-117643275 ACTTTCTAGCTTTGATTTCAGGG + Intergenic
914908408 1:151765468-151765490 ATTTACTATGTTTATTTTCTAGG + Intronic
914931758 1:151941033-151941055 ACTTACTAGCTTTGATTTCATGG - Intergenic
916406817 1:164506294-164506316 ACTTCCTAGGTTTTTGTTTTTGG + Intergenic
916927062 1:169533307-169533329 GTTTCCTAGGTTTTTCTTCTAGG - Intronic
916931907 1:169587125-169587147 ACTTACTAGCTGTGTTGTCTTGG + Intergenic
917569739 1:176252557-176252579 AATTTCTTGGTCTGTTTTCTAGG - Intergenic
918500369 1:185188107-185188129 ACTTACTAGGTATGTATCCTTGG - Intronic
918620812 1:186602796-186602818 ACTCCCTAATTTTTTTTTCTAGG + Intergenic
919088736 1:192952672-192952694 ACTTCCCAGAATTCTTTTCTGGG - Intergenic
919511844 1:198474862-198474884 ACTGCCTAGGTTTTTCTTCTAGG + Intergenic
919720705 1:200831406-200831428 ACTTACTAGTTTTGTGATCTTGG - Intronic
920715989 1:208340774-208340796 ACTTCAAAGGCTTATTTTCTAGG + Intergenic
920821796 1:209388413-209388435 ACTTATTAGGTGTGTGTTCTGGG + Intergenic
920953440 1:210596064-210596086 ATTGCCTAGGTTTTTCTTCTAGG + Intronic
921083062 1:211759188-211759210 ACTTCCTAAGCTTGTTTTATCGG - Intronic
921946645 1:220890340-220890362 AATCACTTGGTTTGTTTTCTCGG + Intergenic
922092111 1:222405846-222405868 ACTGAGTAGGTTTATTTTCTTGG + Intergenic
922389045 1:225119664-225119686 ACTTCCTAGGATTGTTTACTTGG + Intronic
922524837 1:226292859-226292881 ACTTCCTAGCTTTGAGTTCTTGG + Intronic
922657412 1:227398010-227398032 TTTTCTTTGGTTTGTTTTCTAGG - Intergenic
923241029 1:232085687-232085709 ACTTCTTAGGTTGGTTTTGAAGG + Intergenic
923491843 1:234491111-234491133 TCTTCCAAGGTTTGGTCTCTGGG - Intergenic
923577985 1:235178844-235178866 ACTTCCTAGCTTTTTTTTAATGG + Intronic
923882052 1:238114548-238114570 ATTTCCCACATTTGTTTTCTTGG + Intergenic
924085570 1:240448104-240448126 AGTTTCAAGGTTTGTTTTCTTGG - Intronic
924245291 1:242078038-242078060 ATTGCCTAGATTTGTCTTCTAGG + Intergenic
924403371 1:243714265-243714287 ACTGCCTAGGTTTAATTTATTGG + Intronic
924844702 1:247754227-247754249 ATTGCCTAGGTTTTTCTTCTAGG - Intergenic
1063176311 10:3553862-3553884 AATTCCTGGATTTGTTTACTGGG - Intergenic
1064706601 10:18078763-18078785 ACTTTTTGAGTTTGTTTTCTGGG + Intergenic
1064824460 10:19380845-19380867 ACATCTTAGGTTTTTCTTCTAGG + Intronic
1065667929 10:28082970-28082992 ACTTTCTAGGTTTGTTTTGAGGG - Intronic
1065805083 10:29386681-29386703 AAGTCCTTGGTTAGTTTTCTTGG - Intergenic
1066476683 10:35753724-35753746 AATGCATAGGTTTGTTTTATAGG + Intergenic
1067963539 10:50883385-50883407 ACTCCCTAGGTTTGTGACCTTGG - Intronic
1068049579 10:51932483-51932505 ACTTCCTAGGTGGGTGTTCTTGG - Intronic
1068191474 10:53657914-53657936 ACTTCTTATGTTTGTTCTGTGGG + Intergenic
1068392081 10:56410460-56410482 ACTTACTAGTTTTGTTAACTTGG - Intergenic
1069149719 10:64944436-64944458 ATTTCCTAGTATTTTTTTCTAGG - Intergenic
1070121117 10:73578379-73578401 ACTACCTAGTTTTGTTTTTTGGG + Intronic
1070452593 10:76576882-76576904 ACTTCATAGATTTGTTTTGAAGG + Intergenic
1070556596 10:77532648-77532670 ATTTTCTAGGTTTGTTTCCATGG + Intronic
1071097842 10:81999576-81999598 ACTTCTTATGTTTGTTTCTTTGG + Intronic
1073537337 10:104289626-104289648 ACACCCTAGGTTTGTTTTACAGG + Intronic
1073989972 10:109251781-109251803 ATTGCCTAGGTTTTTTTTCTAGG + Intergenic
1074095314 10:110306228-110306250 AGTTCCTAGTTTTCTTTTCAAGG + Intergenic
1074896639 10:117783081-117783103 ACCTCCTAGTTTTTTTTTTTTGG + Intergenic
1076363839 10:129909618-129909640 CCTTCCCAGGTATGTTTTCCAGG - Intronic
1077356250 11:2120233-2120255 ACTTCCTAGAGTTGTTTTGAGGG + Intergenic
1077755175 11:5020839-5020861 AATTCGTATGTTTGTTTGCTTGG + Intergenic
1077795242 11:5484717-5484739 ACTTCCTGGCTTTGTGTCCTTGG - Intronic
1078295934 11:10070252-10070274 ACTGCCTAGGTTTTTCTTCTAGG + Intronic
1078370701 11:10742335-10742357 ACTTACTAGCTTTGTGATCTTGG + Intergenic
1078857002 11:15214458-15214480 TCTTCTTAGTTTTGTTTTTTAGG - Intronic
1078901635 11:15648115-15648137 ACTTTCTAGCTGTGTTGTCTTGG - Intergenic
1078985011 11:16585374-16585396 ACTTCTTAGGGTTGTTTTAAGGG - Intronic
1079359648 11:19759652-19759674 ACTTACTAGCTATGTTTTCTTGG + Intronic
1079479657 11:20865943-20865965 ACTTCCTAGCTGTGTGCTCTTGG + Intronic
1079610560 11:22428105-22428127 ATTGCCTAGGTTTTCTTTCTAGG + Intergenic
1080329817 11:31123235-31123257 TCTTCCTAAGTTTATTTTCAGGG - Intronic
1080954394 11:37076192-37076214 ACTTCTTAGGTTTCTATTGTAGG - Intergenic
1081009073 11:37785168-37785190 ATTGCCTAGATTTTTTTTCTAGG - Intergenic
1081254420 11:40874636-40874658 AAATCCTATGTTTGTTTTCCAGG + Intronic
1081404542 11:42681307-42681329 ATTTTCAAGGTTTGTTTACTAGG + Intergenic
1082312568 11:50670812-50670834 ACTTCCTTTGTTTTTATTCTGGG + Intergenic
1083097839 11:60269978-60270000 ATTTCCTAGGTTATTTTTCATGG + Intergenic
1083512363 11:63222398-63222420 ACTTTCTTGATTTGTTTTCCAGG + Intronic
1085006631 11:73097345-73097367 GTTTCCTAGGTTTGTTTGTTTGG + Intronic
1085349188 11:75787721-75787743 TCTTCCTGTGTTTGGTTTCTGGG + Intronic
1085851759 11:80128802-80128824 ACTTCCTAGCTTTGTGAACTTGG - Intergenic
1085876916 11:80418704-80418726 ACTTACCAGGTTTGTGATCTCGG + Intergenic
1086370705 11:86152767-86152789 ACTTCCTAGATGTGTTACCTTGG + Intergenic
1086582011 11:88410211-88410233 TCTTCTGAGGCTTGTTTTCTTGG + Intergenic
1087000909 11:93419533-93419555 ACCACCTAGTTTTATTTTCTAGG + Intronic
1087454068 11:98361479-98361501 CCTTCTTTGGTTTGTATTCTCGG + Intergenic
1087751858 11:102014809-102014831 ATTTCTTATCTTTGTTTTCTTGG - Intergenic
1087902032 11:103651671-103651693 ACTTTCTAGCTGTGTGTTCTTGG + Intergenic
1088481300 11:110298351-110298373 ACTTCCTAGTTTTGTTACATTGG - Intergenic
1088636111 11:111822049-111822071 ACTTCTAATGTTTGTTTTATGGG - Intronic
1090413374 11:126524120-126524142 ACTTCCTAGCTCTGCTGTCTTGG + Intronic
1090893540 11:130949100-130949122 ACTTCCTAGGATTGTTATAAGGG + Intergenic
1091031732 11:132195851-132195873 ATTTTCTTGGTTTGTTTTCAAGG - Intronic
1091391783 12:130401-130423 ACTTCCTAGGACTGTGTCCTTGG - Intronic
1091478047 12:796684-796706 ACTTTCTGGTTTTGTTTTTTAGG - Intronic
1091981864 12:4871158-4871180 CCTTCCTAGGCATGCTTTCTGGG + Intergenic
1092026598 12:5245975-5245997 ACTTCCTAGGTGTGTAACCTTGG + Intergenic
1092561336 12:9616999-9617021 ACCTCCTATATTTGTTTTCTAGG - Intergenic
1093190209 12:16065591-16065613 TCTTCCTAGGCCTCTTTTCTTGG - Intergenic
1093475877 12:19553906-19553928 CTTTCCTTGGTTTGTTTTATTGG + Intronic
1093766615 12:22970596-22970618 TCTTACTAGCTTTGTGTTCTTGG + Intergenic
1094138859 12:27159701-27159723 ATTTCCTAGATTTTTTTTCTGGG - Intergenic
1094725835 12:33115111-33115133 ACCTCCTAGCTTGCTTTTCTTGG - Intergenic
1095569303 12:43664894-43664916 ACTTACTAGGTGTATTTCCTAGG + Intergenic
1095577266 12:43755261-43755283 ACCTCTTTGTTTTGTTTTCTAGG - Exonic
1095599379 12:43997865-43997887 ACTTACTAGGTATGTGATCTTGG - Intronic
1096163255 12:49398538-49398560 ACTTCCTGGGTTTCTTGTTTGGG + Intronic
1096831751 12:54320021-54320043 GCTACCTAGGTTTGTTTTCAAGG + Intronic
1097796759 12:63870880-63870902 CCTTCCTAGCTTGATTTTCTTGG + Intronic
1098068950 12:66651201-66651223 AAATTCTAGGTTTCTTTTCTTGG - Intronic
1098181500 12:67851860-67851882 ACTTCCTAGATGTCTTGTCTTGG - Intergenic
1098201123 12:68056864-68056886 ATTTCCTAGGTTTTCTTTTTGGG + Intergenic
1098458621 12:70705713-70705735 ACTTCCGAGATTTTTTTTTTTGG + Intronic
1098642169 12:72852445-72852467 ATTGCCTAGGTTTTTCTTCTAGG + Intergenic
1098839540 12:75462212-75462234 ATTGCCTAGATTTTTTTTCTAGG + Intergenic
1098852926 12:75619083-75619105 ATTGCCTAGGTTTTTTTTCTAGG - Intergenic
1098878107 12:75888033-75888055 TCTTCTTATGTTTGTTTTCTAGG - Intergenic
1099088192 12:78273456-78273478 TCTTCCTAGGTTTTTTTCCTAGG + Intergenic
1099821435 12:87716165-87716187 ATTTCCTAGGTTTTTATTTTAGG - Intergenic
1100801063 12:98231134-98231156 AATTCCTCAGTTTATTTTCTTGG - Intergenic
1101039198 12:100737013-100737035 CCTTCAGAGGTTAGTTTTCTAGG - Intronic
1101338897 12:103823502-103823524 ATTTTTTTGGTTTGTTTTCTGGG + Intronic
1101528713 12:105555626-105555648 ACTTCCTAGCTGTGTGTCCTTGG - Intergenic
1101697535 12:107140498-107140520 ACCTCCTAGATTAGTTTCCTAGG - Intergenic
1102189404 12:110975342-110975364 GCTTCCTAGGTTTGTAATTTGGG + Intergenic
1102217296 12:111170491-111170513 ACTTCCTAGCTGTGTATCCTGGG - Intronic
1102436083 12:112925045-112925067 TCTTTTTAGTTTTGTTTTCTCGG - Intronic
1102797706 12:115703215-115703237 GCTTACTAGCTTTGTGTTCTTGG - Intergenic
1104331429 12:127850207-127850229 ACTTCCTAGGTTATCTTCCTGGG + Intergenic
1104517834 12:129444156-129444178 ACTGCCTAGGTTTTCTTCCTGGG - Intronic
1104549273 12:129741326-129741348 GCTTCCTAGGATTGTTTCATTGG + Intronic
1105341281 13:19528421-19528443 ACTTCCAAAATTTGTTTTTTTGG + Intronic
1105445368 13:20450486-20450508 GTTTCCTAGTTTTTTTTTCTAGG - Intronic
1105953601 13:25257242-25257264 ACTTCCCAGGTTTGTTCCCTGGG - Exonic
1106964430 13:35044260-35044282 ACTTGCTAGGTCTATGTTCTTGG + Intronic
1107021308 13:35755280-35755302 ACTTTCTATGTCTGTCTTCTTGG + Intergenic
1107604822 13:42047754-42047776 ACTTCCAAGGCTTTTTGTCTCGG + Intronic
1107620959 13:42229568-42229590 ACTTCCTAGGTTTCATTACGGGG + Exonic
1107739789 13:43437549-43437571 ACTTACTAGGTTTGTGACCTGGG + Intronic
1108308095 13:49158714-49158736 AATGCCTAGGTTTTTCTTCTAGG + Intronic
1109211983 13:59545524-59545546 ATTTCTTAGGTCTTTTTTCTTGG - Intergenic
1109372762 13:61445666-61445688 ACTTACTTTGTTTGTTTTCTTGG - Intergenic
1110532002 13:76608769-76608791 ACTTACTAGTTTTGTGATCTTGG - Intergenic
1110734319 13:78917760-78917782 TTTTCCTAGGTTTCTTTTTTGGG + Intergenic
1111242179 13:85489344-85489366 ACTTTTTAGGTTTGTTTTTATGG - Intergenic
1111540667 13:89663785-89663807 AATTCCTATGTTTGTTTCTTTGG - Intergenic
1111884807 13:94006675-94006697 ACCACCTAGTTTTATTTTCTAGG + Intronic
1111974729 13:94953652-94953674 ATTTCTTAGGCTTTTTTTCTAGG - Intergenic
1112191052 13:97177990-97178012 ACCTCCTATGTATGTGTTCTTGG + Intergenic
1112712218 13:102142508-102142530 ACTTCCTTGATTTGTTTTCAGGG + Intronic
1112979979 13:105371637-105371659 ATTTCCTAGTTGTGTATTCTTGG - Intergenic
1113008240 13:105732748-105732770 AGTTCATGGGTTTGTGTTCTTGG + Intergenic
1114708716 14:24754900-24754922 ATTGCCTAGGTTTTTCTTCTAGG + Intergenic
1114748647 14:25178910-25178932 ACATTCTAGGTATGGTTTCTGGG + Intergenic
1114981718 14:28173036-28173058 ATTGCCTAGGTTTTTTTTCTAGG - Intergenic
1115181950 14:30637975-30637997 ACTTCAAAGGTTTTTTCTCTTGG + Intronic
1115453487 14:33575103-33575125 ATTTCCTAGGATTTTTGTCTTGG - Intronic
1115578812 14:34738016-34738038 ATTGCCTAGGTTTTTTTTCTAGG + Intergenic
1116786160 14:49290996-49291018 ACTTACTAGGTCTGATTTCATGG - Intergenic
1116795752 14:49388526-49388548 ATTGCCTAGGTTTTTTTTCTAGG - Intergenic
1117466037 14:55995142-55995164 ATTGCCTAGGTTTATCTTCTAGG + Intergenic
1118498896 14:66337827-66337849 ATTGCCTAGGTTTTTCTTCTAGG - Intergenic
1118889520 14:69896359-69896381 ACTTTCTAGCTGTGTGTTCTCGG + Intronic
1120449613 14:84650725-84650747 ACTTCCTAGGTTTTTTTCTAGGG + Intergenic
1122394237 14:101411473-101411495 ACTTACTGTGTTTGTTTTCTCGG - Intergenic
1123674620 15:22697855-22697877 ACTTCTCAGGTTTATTTTCATGG - Intergenic
1124326634 15:28770836-28770858 ACTTCTCAGGTTTATTTTCATGG - Intergenic
1126360540 15:47841365-47841387 AGTTCCTAGATTTAATTTCTTGG - Intergenic
1127391736 15:58511127-58511149 ACATCCTATGTTTTTCTTCTCGG + Intronic
1127684271 15:61326687-61326709 ACTTCCTAGCTGTGTGGTCTTGG - Intergenic
1129512388 15:76134147-76134169 AGTTCCTATTTTTGTTTTCAGGG + Exonic
1129962767 15:79702976-79702998 CCCACCTAGGTTTGCTTTCTGGG - Intergenic
1130718311 15:86359329-86359351 ACTTCCTCAGTTTTATTTCTGGG + Intronic
1131946526 15:97628167-97628189 ACTTGCTAGCTGTGTATTCTTGG + Intergenic
1132005323 15:98221331-98221353 ACTTGCTAGGCTTCTTTTCAAGG + Intergenic
1133442498 16:5832397-5832419 ACTTCCTAGCTGTGTGATCTTGG + Intergenic
1133718828 16:8475054-8475076 ACTTCCTGGGATGGTTGTCTGGG - Intergenic
1134374556 16:13659789-13659811 ACTGCCAAGGTGTATTTTCTAGG - Intergenic
1135227375 16:20673509-20673531 CCATGCTGGGTTTGTTTTCTTGG - Intronic
1135894410 16:26385826-26385848 ACTCCCTGGATTTGTGTTCTGGG + Intergenic
1135905668 16:26509627-26509649 ACTTTTTAGGTTTTTTTTGTTGG - Intergenic
1138159274 16:54737865-54737887 CCCTCCAAGGTTTGTTTTATTGG + Intergenic
1138376674 16:56568958-56568980 ACTTCCCAGGTTTCTCTCCTTGG - Intergenic
1138866356 16:60825267-60825289 GCTTCCTAGGTTTTCTATCTTGG - Intergenic
1139127839 16:64102249-64102271 ACTTTCTAAACTTGTTTTCTTGG - Intergenic
1140188935 16:72797890-72797912 ACTTAAAAGGTTTGTTGTCTGGG + Exonic
1140706339 16:77633853-77633875 ACTTCCTAGCTTTGTGATCTTGG - Intergenic
1140778096 16:78268612-78268634 ATTTCCTAGGTCTGGTTTCTTGG + Intronic
1141425876 16:83944098-83944120 ACTTCCTAGCTGGGTGTTCTTGG - Intronic
1141571878 16:84939098-84939120 CCTTCAGAGGTTTGTTCTCTGGG - Intergenic
1142578461 17:925219-925241 TATTCCTAGGTTTGCTTTCCGGG - Intronic
1144552760 17:16255868-16255890 CCTTCCCTGGTTTCTTTTCTAGG - Intronic
1144611333 17:16719537-16719559 AATTCTTAGGTTTGAGTTCTGGG + Intronic
1146376807 17:32300122-32300144 ACTTTCTAGCTGTGTCTTCTTGG - Intronic
1146407352 17:32550599-32550621 TCTTTGTAGATTTGTTTTCTAGG + Intronic
1147025957 17:37583638-37583660 ACCTATTAGGTATGTTTTCTTGG + Intronic
1147215606 17:38897357-38897379 ACTGCCTGGGTTTGTGTCCTGGG + Intronic
1147478389 17:40735950-40735972 CCTTTCTAGCTGTGTTTTCTTGG - Intergenic
1148581316 17:48745999-48746021 ACCTGCTAGGTTGGCTTTCTAGG + Intergenic
1149021345 17:51968866-51968888 ACCTTATAGGTTTGTTTTCAAGG - Intronic
1149510204 17:57234689-57234711 ACTTCTTTGATTTATTTTCTGGG + Intergenic
1149579524 17:57739613-57739635 ACTTCCTAGGCTTGTTTAAGAGG - Intergenic
1149703825 17:58677406-58677428 GCTTCCTTGGTGTTTTTTCTTGG - Intronic
1150802869 17:68295543-68295565 TCAGCCTGGGTTTGTTTTCTAGG - Intronic
1203191687 17_KI270729v1_random:196264-196286 AATGCCTAGGATTTTTTTCTAGG - Intergenic
1153496923 18:5709052-5709074 ATTTACTAGGATTGTTTTCCAGG - Intergenic
1153500821 18:5747898-5747920 ACTTCCTGGCTTTGTGTACTTGG + Intergenic
1153651928 18:7248491-7248513 ACTTCCTTGGTGTGTTTGCTGGG + Intergenic
1154214356 18:12405078-12405100 ACTTCCTAGCTGTGTGTTCTTGG + Intergenic
1155891668 18:31278076-31278098 ATTTCCTAGGATTCTTTTTTGGG + Intergenic
1156139773 18:34093137-34093159 ATTTTCTAGCTTTGATTTCTTGG - Intronic
1158314590 18:56197054-56197076 TCTTCCTATGTTTTTTTACTGGG + Intergenic
1159483540 18:69023182-69023204 ACTTCCTAGTTATGTGATCTTGG + Intronic
1159628916 18:70726655-70726677 ACTTGCTATGGTTGATTTCTTGG + Intergenic
1161158452 19:2747698-2747720 ACTGCTTAGGTTTGGTTTCTTGG + Intergenic
1161633516 19:5371719-5371741 ACTTCCTTTTTTTGTTTTTTGGG - Intergenic
1161877525 19:6923237-6923259 ACTTTCTAGCTGTGTTTTCTTGG + Intronic
1163402171 19:17100833-17100855 TCTTCCTAGGTTGGGTTTCAAGG + Intronic
1166888886 19:45977787-45977809 GCTTTCTAGCTTTGTTTTCTGGG + Intergenic
1167321463 19:48799500-48799522 CCTTCCATGGTTTGTTTTCAGGG + Intronic
925273185 2:2629864-2629886 ACTTGCGTGTTTTGTTTTCTTGG + Intergenic
925498166 2:4475921-4475943 TCTTCCTGGGTTTATTATCTTGG + Intergenic
925795203 2:7533694-7533716 ACTTCCTAGCTTTGTGAACTTGG + Intergenic
926543341 2:14208123-14208145 ACCTCCTAGGCTTGCTTCCTGGG + Intergenic
926686977 2:15705422-15705444 ACTTACTATGTGTGTTTACTAGG + Intronic
927416045 2:22881600-22881622 ACTTCCTAGCTGTGTAATCTTGG - Intergenic
927657111 2:24958541-24958563 ACTTACTAGTTTTGTGATCTTGG + Intronic
928160298 2:28917871-28917893 ACTTGCTGGTTTTGTTATCTAGG + Exonic
929034580 2:37678518-37678540 AATTCTTACCTTTGTTTTCTAGG - Intronic
929984719 2:46716796-46716818 ACTTTCAAGTTTTGTTTTCAGGG + Intronic
930380367 2:50620512-50620534 GCTTCCTAGGTTAGTTTTGCTGG + Intronic
930517561 2:52427654-52427676 ATTCACTAGCTTTGTTTTCTGGG - Intergenic
930552165 2:52849474-52849496 AGGTCCTGGGTTTTTTTTCTTGG + Intergenic
930775883 2:55170023-55170045 AATACCTATGTTTGGTTTCTTGG + Intergenic
930857350 2:56033160-56033182 TCTGCCTAGGTCTGTTTTTTTGG + Intergenic
930927351 2:56834652-56834674 ACTTCCTTTTTTTATTTTCTGGG - Intergenic
931836167 2:66100172-66100194 ACTTCCTAGCTGTGTGGTCTTGG - Intergenic
932431057 2:71673713-71673735 ACTTCCTAGCTATGTGGTCTTGG + Intronic
932655012 2:73602841-73602863 ACTTACTAGGTATGTCATCTTGG - Intronic
932944327 2:76209742-76209764 GCTTCCTAGGACTGCTTTCTAGG + Intergenic
933093614 2:78150807-78150829 ACTTGGTAGGTGTATTTTCTTGG + Intergenic
933193452 2:79363026-79363048 ACTTCCTAGCTGTGTGGTCTTGG + Intronic
934136582 2:89001530-89001552 ACCTCCTAGGTTTCTTTTTCAGG + Intergenic
935412569 2:102781073-102781095 ACTTCTTATGCTTGTTTTATAGG + Intronic
935902956 2:107812108-107812130 ACTTACTAGCTCTGTGTTCTTGG - Intergenic
936534263 2:113299643-113299665 ACTGCCTGTGTTAGTTTTCTAGG + Intergenic
938954622 2:136286361-136286383 ATTTCCCTGTTTTGTTTTCTGGG + Intergenic
939242442 2:139578578-139578600 ATTTCCTAGATTTTTTTTCTGGG - Intergenic
939628161 2:144504020-144504042 CTTTACCAGGTTTGTTTTCTTGG - Intronic
940066033 2:149630686-149630708 ACTCTATAGGTTTGTATTCTAGG - Intergenic
940418673 2:153453164-153453186 GTTTCCTAGGTCTTTTTTCTGGG - Intergenic
941189274 2:162357019-162357041 AGTTCCTTTGTTTGTTTTCAAGG + Intronic
941603932 2:167572558-167572580 ACTTCCAATCTTTGTTTTGTTGG - Intergenic
941647635 2:168058304-168058326 ACTTCCTCTATTTGTTTTTTAGG + Intronic
942331444 2:174828965-174828987 ACTTACAAGGTTGCTTTTCTTGG - Intronic
942350073 2:175043132-175043154 ATTGCCTAGGATTTTTTTCTAGG + Intergenic
942368938 2:175260006-175260028 AATTACTGGGTTTTTTTTCTAGG - Intergenic
942700041 2:178696931-178696953 TCTGCCTGGGTTTGTTTTCCTGG + Intronic
942862591 2:180634094-180634116 TCTTCCTGGGTTAGGTTTCTTGG + Intergenic
943347073 2:186751739-186751761 AGATACTAGTTTTGTTTTCTGGG + Intronic
944739740 2:202600257-202600279 ACAACCTATATTTGTTTTCTAGG + Intergenic
944887003 2:204073094-204073116 ACTTCCTAGCTGTGTGATCTTGG + Intergenic
945279672 2:208024267-208024289 ACTTCCTAGTTGTGTAATCTTGG - Intronic
945574215 2:211509492-211509514 ATTTCCTAGATTTTTTTGCTAGG - Intronic
945631517 2:212284006-212284028 ACTTCCAAAATTTTTTTTCTGGG + Intronic
945756606 2:213855371-213855393 ACTTCCTAGCTTTGTGACCTCGG + Intronic
946467072 2:219921404-219921426 ACTAACTAGTTTTGTTTTCTGGG - Intergenic
947483032 2:230520732-230520754 ACTTTGTTGGTGTGTTTTCTTGG - Intronic
1169742136 20:8906480-8906502 TCATCCTATGTTTGTTTTCTGGG + Intronic
1171868938 20:30511197-30511219 ACTTCCTCCTTTTGTTTTTTTGG - Intergenic
1171955957 20:31463936-31463958 ACTTCCTAGGTTTATGACCTGGG + Intergenic
1172493032 20:35356646-35356668 ACTTACTAGGTTTGTATCATTGG - Intronic
1173345441 20:42195177-42195199 CCTGCATAGGTTTATTTTCTGGG - Intronic
1173620182 20:44430406-44430428 CCAACCTGGGTTTGTTTTCTCGG - Exonic
1174180936 20:48673982-48674004 ACTTCCTAGGTTAGTGACCTTGG - Intronic
1174217151 20:48924817-48924839 ACTTGCTACGTTTGTGATCTTGG + Intronic
1174406706 20:50307446-50307468 ACTTCCTAGCTGTGTGATCTGGG + Intergenic
1174657256 20:52181874-52181896 ACTTATTAGATTGGTTTTCTGGG - Intronic
1178532094 21:33384243-33384265 TCATCCTAGTTTTGTTTTTTGGG + Intergenic
1181769083 22:25112539-25112561 ACTTCCCCGGTTTGATGTCTGGG - Intronic
1182840441 22:33385131-33385153 TCTTCCTTGGTATCTTTTCTTGG + Intronic
1182945849 22:34321057-34321079 ATTCCCAAAGTTTGTTTTCTGGG - Intergenic
1182989954 22:34757982-34758004 ACTTCCTAGCTTTGTTACCCTGG + Intergenic
1183321625 22:37168485-37168507 ACTTCCTAGCTGTGTGATCTTGG + Intronic
1183405470 22:37628478-37628500 ACTTTCTAGCTGTGTGTTCTCGG + Intronic
949620449 3:5805521-5805543 ACTTCCTAGGAATGTTTCCCTGG - Intergenic
950004566 3:9683440-9683462 AGTTCTTAATTTTGTTTTCTAGG - Intronic
950162893 3:10773184-10773206 ACTTCCTAGCTGTGTGATCTTGG + Intergenic
951766915 3:26210011-26210033 ATTTCCTAGGTTTCCTTTCAGGG + Intergenic
952603965 3:35121468-35121490 ACTTCCTCTGTTTGTGCTCTAGG - Intergenic
952998343 3:38906819-38906841 ACTCTCTAGCTTTGTTTTCGAGG + Intronic
953594852 3:44301070-44301092 ATTTCTTAGTTTTGTTATCTCGG - Intronic
953963896 3:47287280-47287302 ACTGCCTACGTTTGAGTTCTGGG + Intronic
956125989 3:66011364-66011386 ACTTCCCAGATGTGTGTTCTTGG + Intronic
956477500 3:69638126-69638148 ATTTCCTAGGTTTTTCTCCTAGG + Intergenic
957594461 3:82244418-82244440 ACTGCCTCTTTTTGTTTTCTTGG + Intergenic
957687805 3:83525584-83525606 AATTTCTAGGTCTATTTTCTAGG - Intergenic
957711704 3:83868851-83868873 ATTTCCTAGGTTTTTCTTCTAGG + Intergenic
959182212 3:102995722-102995744 GTTTCCTAGTTTTTTTTTCTAGG - Intergenic
959332166 3:105020323-105020345 ACTCCCTAGGCTTGTCATCTGGG - Intergenic
959974354 3:112441604-112441626 ATTTCCTAGTATTTTTTTCTAGG - Intergenic
960320049 3:116223097-116223119 ACTTCCTTAATTTGCTTTCTTGG - Intronic
960531573 3:118771454-118771476 ACTTCCTAGCTGTGTGATCTTGG - Intergenic
960537901 3:118833416-118833438 ACATCACTGGTTTGTTTTCTGGG + Intergenic
961131999 3:124477562-124477584 ACTTCCTAGGTTTGGTGTGGAGG - Intronic
961794494 3:129399949-129399971 ACTACCTTGCTTTGTTTTGTTGG + Intergenic
962960281 3:140304822-140304844 ACTTACTAGGTGTGTCATCTTGG + Intronic
963348751 3:144127320-144127342 ACTTGCTAGTTCTGTTATCTTGG - Intergenic
964459785 3:156911597-156911619 ATTTCCTAGGTTTTTTTTCTAGG + Intronic
964750190 3:160047303-160047325 ACTTCTTAGTGTTGATTTCTTGG - Intergenic
964971499 3:162568818-162568840 ACTTACTATTTTGGTTTTCTTGG - Intergenic
965648710 3:170910554-170910576 ACTTACTAGCTTTGTAATCTGGG - Intergenic
967354557 3:188553536-188553558 ATTTCCTAGATCTGTTTTGTGGG - Intronic
967485494 3:190025445-190025467 ATTTAGTAGGTTTGTTTTCTTGG + Intronic
967670861 3:192233642-192233664 ATTTCCTAGATTTTTTTTCTAGG + Intronic
968216741 3:196898206-196898228 ACGTCCTGGGTTTATTTCCTGGG + Intronic
969352926 4:6608580-6608602 ACTTCCTAGATGTGTGATCTTGG + Intronic
970004142 4:11394838-11394860 ACTTCCTAGGGTTGTTATATAGG + Exonic
971494833 4:27252556-27252578 ACTTTCTAGCTGTGTTTCCTTGG + Intergenic
971607875 4:28681965-28681987 ACTTTCTAGTTTTGTGGTCTTGG - Intergenic
971968799 4:33595295-33595317 TCTTCTTAGGTTTGTTTTACTGG + Intergenic
972053219 4:34766766-34766788 ATTTCCTTGGCTTGTTTACTGGG + Intergenic
972068461 4:34982932-34982954 ACTTTGTTGGTGTGTTTTCTTGG + Intergenic
973577674 4:52307353-52307375 TTTTTCTAGGTTTTTTTTCTAGG + Intergenic
974165853 4:58200856-58200878 ACCTCCTATGTATTTTTTCTGGG - Intergenic
974301769 4:60078324-60078346 ATTTCCTAGGTTTTCTTCCTAGG + Intergenic
974514095 4:62885753-62885775 ATTTTCTAGCTTTGTTATCTGGG - Intergenic
974773175 4:66442660-66442682 ACTTCCTAATTTTGTCATCTTGG + Intergenic
974914542 4:68163235-68163257 ATTTCCTAGGTTTTCTTTCAAGG - Intergenic
975303883 4:72825010-72825032 ATTGCCTAGGTTTTTTTTCTAGG + Intergenic
976155587 4:82140670-82140692 ACTTGCTAAGTTTGCTTTATGGG - Intergenic
976477507 4:85501817-85501839 ATTGCCTAGTTTTTTTTTCTAGG + Intronic
976499428 4:85770429-85770451 ACTTCCTAGGTTTGTTTTCTTGG + Intronic
977445732 4:97129507-97129529 ATTTCCTGGGTTTTCTTTCTGGG - Intergenic
977650680 4:99465057-99465079 CCTTCCTCGTTGTGTTTTCTTGG + Intergenic
978423656 4:108560272-108560294 AATCCCTGGGCTTGTTTTCTGGG - Intergenic
978839848 4:113198599-113198621 AATTCCTAGGTTTCTTTGCAAGG + Intronic
978962866 4:114705383-114705405 AATTCCCAGGTTTGTATTATTGG - Intergenic
979580683 4:122355455-122355477 ACATTCTAGCTTTGGTTTCTGGG - Intronic
980026354 4:127771962-127771984 ACTTGCTAGATTTGATTGCTGGG + Intronic
980047008 4:128000218-128000240 ATTTCCTAGGTTTTTCTTCTGGG + Intronic
980390099 4:132133772-132133794 ATTGCCTAGGTTTTTTTTCTAGG - Intergenic
980417930 4:132517652-132517674 ACTTACTAGCTTTGTGTCCTTGG + Intergenic
980540117 4:134182496-134182518 ACTTCCTAGGTTATTTTCCAGGG - Intergenic
980837212 4:138210289-138210311 ACTTCCTAGGTTTTCTTCTTGGG - Intronic
981823247 4:148910418-148910440 ACTTACTAGCTTTGTAATCTTGG + Intergenic
982226193 4:153169390-153169412 GTTCCCTACGTTTGTTTTCTGGG + Intronic
982378224 4:154718428-154718450 CCTTCCTAGGTTCTTTTGCTGGG - Intronic
982503371 4:156187861-156187883 ACATCTTTGGTTTTTTTTCTGGG + Intergenic
982821119 4:159940946-159940968 ACTTTATAGCTTTGTATTCTTGG - Intergenic
982839716 4:160168412-160168434 ATTGCCTAGGTTTTTCTTCTAGG + Intergenic
983395580 4:167190707-167190729 TGTTCATATGTTTGTTTTCTAGG + Intronic
983396811 4:167208525-167208547 ACTTACTAGCTATGTTATCTTGG + Intronic
983614977 4:169693495-169693517 ACTTACTAGGTATGTAGTCTCGG - Intronic
983849146 4:172558678-172558700 ACTCCCTATGTTAGTTTGCTAGG - Intronic
984449973 4:179887339-179887361 ATTTCCTAGGTTTTTTTTCTAGG - Intergenic
984619112 4:181932063-181932085 ATTGCCTAGGTTTTTCTTCTAGG - Intergenic
984692626 4:182745370-182745392 ACTTGCTGGTCTTGTTTTCTTGG + Intronic
984816674 4:183844292-183844314 AGTTCTCAGGTTTTTTTTCTAGG - Intergenic
985310188 4:188589177-188589199 ACTTCCTAGGTGCATTTTCCTGG + Intergenic
985984046 5:3498832-3498854 ACTGCCTAGATTTTTCTTCTAGG - Intergenic
986447079 5:7831100-7831122 ATTTTCTAGATTTGTGTTCTAGG - Exonic
986654248 5:9995132-9995154 ACTTCGTAAGTTGGATTTCTGGG - Intergenic
987932014 5:24413980-24414002 ATTTGCTAGGTTTGTGTCCTTGG - Intergenic
989235480 5:39143255-39143277 CCCTACTAGGTTTCTTTTCTTGG + Intronic
989269912 5:39520927-39520949 CCTTCCTAGCTTTAATTTCTTGG - Intergenic
989403754 5:41037824-41037846 GCTTCCTAGAGTTGTTTTCTAGG - Intronic
989494726 5:42099727-42099749 ATTTCCTAGGTTTATTCTGTCGG + Intergenic
989495598 5:42108221-42108243 CATTCCTAGGTATTTTTTCTTGG + Intergenic
990016469 5:51068390-51068412 ATTGCCTAGGATTTTTTTCTAGG - Intergenic
990614432 5:57492948-57492970 ACTTCCTAGGTTTGTAAAGTGGG + Intergenic
990818797 5:59814534-59814556 GCTTCCTAGGTTTCTTCTGTTGG - Intronic
990871863 5:60440872-60440894 ACTTCCTAGTTTTGTAACCTTGG - Intronic
991464432 5:66895069-66895091 ACTTTCTGGGTTTGATTTTTTGG + Intronic
992101109 5:73408950-73408972 ACTCCCTATGTTTGTTTCCTAGG + Intergenic
992241776 5:74777797-74777819 AGTACCTATGTTTGTTTTCTTGG - Exonic
992520859 5:77549531-77549553 TGTACCTAGGTTTGTTTTTTTGG - Intronic
992911488 5:81399907-81399929 ACTTCCTAGTTATGTGGTCTTGG - Intergenic
993932571 5:93958745-93958767 ATTTCCTGGGTTTTTTTTTTTGG - Intronic
994056883 5:95427071-95427093 ACTTCCTAGGTTTATGATCTGGG - Intronic
995498469 5:112775224-112775246 ATATTCTGGGTTTGTTTTCTGGG + Intronic
996043505 5:118843573-118843595 TCATCCTAGGTATGTTTCCTGGG - Intronic
997053179 5:130407512-130407534 ATTGCCTAGGTTTGTTTCCAGGG + Intergenic
997143164 5:131404989-131405011 TCTTTCTTGGTTTGTTTTTTGGG - Intergenic
997217393 5:132124533-132124555 ATTGCCTAGGTTTTTCTTCTAGG + Intergenic
997713574 5:136026513-136026535 ACTTCCTAGCTGTGTGGTCTTGG - Intergenic
998063018 5:139133940-139133962 ACTTCCTAGCTATGTGATCTTGG + Intronic
999271507 5:150298876-150298898 ACTTCCTAGCTGTGTGATCTTGG - Intronic
1000354687 5:160382826-160382848 CTTTCCTAAGTTTATTTTCTTGG - Intergenic
1000737904 5:164928485-164928507 AATGCCTAGGTTTTTTTTCTAGG + Intergenic
1001337179 5:170808847-170808869 AGTTCCAAGAGTTGTTTTCTTGG + Intronic
1004566882 6:16806537-16806559 ACTTCCTAGCTGTGTGTCCTTGG - Intergenic
1007962998 6:45978046-45978068 ACTTACTAGGGTTGTAATCTTGG + Intronic
1008141946 6:47842114-47842136 CTTTCCTAGGTTTGTGATCTTGG + Intergenic
1008857297 6:56105266-56105288 ACTTCATAGATTTGTTTTTTAGG + Intronic
1008904034 6:56656617-56656639 ACTTACCAGATTTGTGTTCTTGG - Intronic
1008927676 6:56904352-56904374 ACTTACTAGGTGTGTGGTCTTGG + Intronic
1009317122 6:62233750-62233772 TGTTCCTGGGTTAGTTTTCTAGG + Intronic
1009445341 6:63736181-63736203 ATTGCCTAGGTTTTTCTTCTAGG + Intronic
1009580650 6:65528882-65528904 AACTTCTAGGTTTCTTTTCTTGG + Intronic
1009620209 6:66065204-66065226 ACTTCCTACTTTAGTTTTGTGGG + Intergenic
1009870443 6:69446624-69446646 AGTTGCTAGTTTTATTTTCTTGG - Intergenic
1010313928 6:74422695-74422717 ATTGCCTAGGTTTTTTTTCTAGG - Intergenic
1011406491 6:87020806-87020828 ACTTCTTAGCTTTCTATTCTTGG + Intergenic
1012008142 6:93742995-93743017 TGTTCCTATGTTTGTTTGCTAGG - Intergenic
1012169984 6:96004526-96004548 ATTTCCTAGGTTACTTTTCAGGG - Intergenic
1012521352 6:100124831-100124853 ATTTTCTAGGTAAGTTTTCTAGG - Intergenic
1012871341 6:104676110-104676132 ATGTCCTAGGTTTTTTTCCTAGG - Intergenic
1013291063 6:108719242-108719264 AGTTCCCAAGTTTGTTTTCAGGG - Intergenic
1013433154 6:110074034-110074056 ACTTCCAAAATTTATTTTCTTGG - Intergenic
1013572619 6:111444980-111445002 ACTGCCTAGGTTAGTTCTCTGGG - Intronic
1013574117 6:111463294-111463316 ACTTCCTAGCTTTGTTCACTTGG - Intronic
1013949078 6:115757702-115757724 TCTTCCTAGGTTCACTTTCTCGG - Intergenic
1014124500 6:117760512-117760534 ACTTCCTACTTTTGGTTTCAAGG - Intergenic
1014199581 6:118593810-118593832 ACCTTCCAGTTTTGTTTTCTGGG + Intronic
1014354183 6:120383527-120383549 AATTCCTAGGTTTATATTTTTGG + Intergenic
1014509171 6:122299635-122299657 ACTTACTAACTTTGATTTCTAGG + Intergenic
1014623608 6:123699613-123699635 ACTTACTAGCTTTGTTAACTTGG + Intergenic
1014725431 6:124966001-124966023 ACTTCCTAGCCTTGGTTTCTGGG - Intronic
1014868682 6:126563479-126563501 ATTGCCTAGGTTTATCTTCTAGG - Intergenic
1014872154 6:126610095-126610117 ATTGCCTAGGTTTATCTTCTAGG + Intergenic
1017465683 6:154691618-154691640 AATTCCTGGGTGTGTTTTATTGG + Intergenic
1017486185 6:154903669-154903691 ACTTTCTAGGTGTGTCATCTTGG + Intronic
1018836943 6:167492300-167492322 ACTTCCGAGGTTTTGTTCCTGGG + Intergenic
1019199674 6:170304411-170304433 TCTTCCTAGGTTTGTTGTGCTGG + Intronic
1019229758 6:170549964-170549986 ACTTACTAGGTATGTGATCTTGG + Intronic
1020463750 7:8452945-8452967 ACTTCCTAGTTTGCTTTTCTGGG + Intronic
1020578569 7:9965933-9965955 AATTACTAAGTTTATTTTCTAGG - Intergenic
1020716859 7:11685270-11685292 ACTTCCTAGTTTTTTTTTGTAGG - Intronic
1020771198 7:12397466-12397488 ACTTCCTAGGGTTTTTTCCTAGG - Intronic
1021354093 7:19632872-19632894 ACTTCTTTGGTTTAATTTCTAGG - Intergenic
1021766452 7:23954485-23954507 ACTTCCTAGGATAATTTCCTAGG - Intergenic
1022925507 7:35052471-35052493 TCTGCCTAGGTCTGTTTTCCAGG - Intergenic
1023339353 7:39203370-39203392 ACTTGGTAGCTTTGTTTCCTTGG - Intronic
1025789361 7:64673665-64673687 ATTTCCTAGGTTAGTCTTCCAGG + Intronic
1026024606 7:66734348-66734370 ACCTCCTAGCTGTGTATTCTGGG + Intronic
1026361409 7:69604167-69604189 ACTTCCTGGCTCTGTTTTCAGGG + Intronic
1027534113 7:79374571-79374593 ACTTGCTGTATTTGTTTTCTAGG - Intronic
1027728770 7:81842487-81842509 AATTCCTAGTTTTATTTACTCGG - Intergenic
1027862461 7:83602244-83602266 ATTTCCTAGCTTTGTCTTATTGG - Intronic
1028021596 7:85782631-85782653 ACTTACTAGTTTTGTTTTCTTGG - Intergenic
1028846116 7:95482222-95482244 ATTTGCTTTGTTTGTTTTCTTGG + Intronic
1029303585 7:99602615-99602637 ACTTCCTAGCTGTGTGATCTTGG - Intronic
1030610870 7:111687431-111687453 ACTTCCTAGGAGAGATTTCTAGG + Intergenic
1031240584 7:119233393-119233415 ACTTCCTGGGATAGTTCTCTAGG - Intergenic
1031481004 7:122278561-122278583 GTTTCCTAGGTTTTTTTTCTAGG + Intergenic
1032650178 7:133869354-133869376 ACTTACTAGTTGTGTTCTCTTGG + Intronic
1032880559 7:136085610-136085632 ACTTCTTTTGTTTTTTTTCTTGG + Intergenic
1032915496 7:136484487-136484509 TCTTCCTTTCTTTGTTTTCTAGG + Intergenic
1034295398 7:149967860-149967882 ACTTCCCAGGCTTTTCTTCTTGG + Intergenic
1034537846 7:151737032-151737054 GCTTCCAAAGTTTGTTTTATTGG - Intronic
1034810660 7:154129070-154129092 ACTTCCCAGGCTTTTCTTCTTGG - Intronic
1035142176 7:156773747-156773769 ATTTCCTAGGTTTTTTTTCCAGG - Intronic
1036558463 8:9881596-9881618 ATTGCCTAGGTTTTTCTTCTAGG - Intergenic
1036591015 8:10168068-10168090 ACTTACTAGCTTTGTGTCCTTGG + Intronic
1037388733 8:18369882-18369904 ATTTCCTAGGTTTTCTTTCAGGG - Intergenic
1037621432 8:20566815-20566837 ACTTCCCAGGTTTGTTTCCCAGG - Intergenic
1038236363 8:25761132-25761154 ATTGCCCAGGTTTTTTTTCTAGG - Intergenic
1038967752 8:32594282-32594304 TTTGCCTGGGTTTGTTTTCTGGG + Intronic
1038971831 8:32645288-32645310 AATTCCTATGCTTATTTTCTAGG - Intronic
1039335550 8:36585350-36585372 GTTTCCTAGGTTTTTCTTCTAGG + Intergenic
1039335672 8:36586615-36586637 ACTTACTAGATTTGTAATCTTGG + Intergenic
1040283058 8:46078023-46078045 TCTTTCTAGTTTTTTTTTCTAGG - Intergenic
1040538124 8:48327283-48327305 ATTTCCTAGGTTTTATTTCACGG - Intergenic
1041482730 8:58341805-58341827 ACTTTCTAGTCTTATTTTCTAGG + Intergenic
1042036214 8:64537081-64537103 ATTGCCTAGGTTTTTCTTCTAGG + Intergenic
1042711213 8:71719553-71719575 ACTTCCTATGTTAGTTTCCTAGG + Intergenic
1043891135 8:85654117-85654139 ACTTACTAGGTTTGTAATATTGG - Intergenic
1043892211 8:85660954-85660976 ACTTACTAGGTTTGTAATATTGG - Intergenic
1043893352 8:85716386-85716408 ACTTACTAGGTTTGTAATATTGG + Intergenic
1043896035 8:85737835-85737857 ACTTACTAGGTTTGTAATATTGG + Intergenic
1043896644 8:85743973-85743995 ACTTACTAGGTTTGTAATATTGG - Intergenic
1043898967 8:85762340-85762362 ACTTACTAGGTTTGTAATATTGG - Intergenic
1043900578 8:85774534-85774556 ACTTACTAGGTTTGTAATATTGG - Intergenic
1043902542 8:85789809-85789831 ACTTACTAGGTTTGTAATATTGG - Intergenic
1043904152 8:85802002-85802024 ACTTACTAGGTTTGTAATATTGG - Intergenic
1043905764 8:85814196-85814218 ACTTACTAGGTTTGTAATATTGG - Intergenic
1043907372 8:85826383-85826405 ACTTACTAGGTTTGTAATATTGG - Intergenic
1043996426 8:86823395-86823417 AGTTTGTAGGTTTGTGTTCTTGG + Intergenic
1044276512 8:90306488-90306510 ACTTCCAATTTTTGTTTTTTAGG - Intergenic
1044543584 8:93434868-93434890 CCCTCCTAGGTTTAATTTCTAGG - Intergenic
1047147361 8:122218338-122218360 ATTTCCTAGGTTTGTTTTCTAGG - Intergenic
1048274497 8:133056023-133056045 GCTTCCTAGGTGTGTGCTCTTGG - Intronic
1049155041 8:141061162-141061184 AATTCCAAGCATTGTTTTCTTGG + Intergenic
1049917437 9:331999-332021 ACTTCCTACGTATGTCTCCTGGG + Intronic
1050161367 9:2722935-2722957 ACTTCATAAGTTTCTTTTCATGG + Intronic
1050576592 9:7002790-7002812 ACTTACTAGCTTTGTGATCTAGG - Intronic
1050609966 9:7341865-7341887 ACTTACTAGCTTTGTTAGCTTGG + Intergenic
1050665591 9:7932763-7932785 ACTTTCTTGGTTAGTTTTGTGGG + Intergenic
1051438337 9:17056226-17056248 ATTGCCTAGGCTTTTTTTCTAGG + Intergenic
1051866535 9:21689577-21689599 ACTTCCTAGGTTGGATTTCGTGG + Intergenic
1051968525 9:22859751-22859773 ACTTCCTAGGTTATCTTTCAGGG - Intergenic
1051999140 9:23255200-23255222 ATTTCCTAAGTTGGTTATCTTGG + Intergenic
1052682956 9:31717601-31717623 CCTTCCGAGGTTTCTCTTCTTGG + Intergenic
1053612265 9:39726600-39726622 ACTTCATAGTTTTGTGTTTTGGG - Intergenic
1053785921 9:41652878-41652900 ATTTAATTGGTTTGTTTTCTTGG - Intergenic
1053870300 9:42484593-42484615 ACTTCATAGTTTTGTGTTTTGGG - Intergenic
1054085989 9:60744555-60744577 ACTTCATAGTTTTGTGTTTTGGG + Intergenic
1054241251 9:62615792-62615814 ACTTCATAGTTTTGTGTTTTGGG + Intergenic
1054449494 9:65395871-65395893 ATTTAATTGGTTTGTTTTCTTGG - Intergenic
1055484215 9:76741390-76741412 AATTCCTAGATATGCTTTCTGGG - Intronic
1055874464 9:80925331-80925353 ACTGCCTGGGTTAGTGTTCTAGG - Intergenic
1056370002 9:85944173-85944195 ACTTACTAGTTTAGTTTCCTTGG + Intronic
1056831409 9:89920141-89920163 ACTTCCTAGCTATGTGATCTCGG - Intergenic
1057967469 9:99518086-99518108 ACTTCCTCTATTTGTTTTCTAGG - Intergenic
1058580249 9:106448276-106448298 ACTTCCTAAGTTTTTTGTTTGGG - Intergenic
1058739883 9:107932378-107932400 AGTTCCTAGGTTTGTGAGCTTGG - Intergenic
1058874164 9:109228037-109228059 TATTCCTAATTTTGTTTTCTTGG + Intronic
1059003437 9:110375338-110375360 TCTTTCATGGTTTGTTTTCTTGG - Intronic
1059677902 9:116557313-116557335 ACTTCCTAGATATGTTATTTGGG + Intronic
1060192464 9:121601689-121601711 ACCTCATGGGTTTGTTTTATGGG - Intronic
1060640541 9:125234719-125234741 CCTACCTAGGTTTGTATTGTTGG - Intergenic
1061970083 9:134040206-134040228 TCTTCTTTGGTTTGTTTACTGGG + Exonic
1186200496 X:7151163-7151185 ACTTCCTTAGTTTGTTGTCCTGG + Intergenic
1186263241 X:7803926-7803948 TCTTCCAAGGTTTGGTTTCAAGG + Intergenic
1186523407 X:10225688-10225710 ATTGCCTAGATTTTTTTTCTAGG + Intronic
1187666181 X:21612534-21612556 ACTTCCTATTTTTAATTTCTTGG - Intronic
1188066389 X:25665701-25665723 AATTCCTAGTTTTGTTTGCATGG + Intergenic
1188083953 X:25880847-25880869 ACTTACTAGGTTTGTGTCTTTGG + Intergenic
1188416492 X:29941468-29941490 ACTTTCTAGCTCTGTTTCCTTGG - Intronic
1188633249 X:32395085-32395107 ACTTCCTAGTTATGTTACCTTGG - Intronic
1188788919 X:34384294-34384316 ACTTCAGAGGTTTATTATCTAGG - Intergenic
1188936399 X:36181427-36181449 ACTTCCAAGGTTTCCTTTCCTGG - Intergenic
1189539655 X:41972543-41972565 ACTTCCTCCCTTTGTTTCCTCGG - Intergenic
1189653531 X:43216125-43216147 ATTTCCTAGGTTTTTTTCCTAGG - Intergenic
1190236623 X:48621279-48621301 ATGTCTTAGGTTTGTTTCCTTGG + Intergenic
1190359431 X:49635088-49635110 ACTGCCTGTGTTGGTTTTCTGGG + Intergenic
1190605031 X:52132436-52132458 ATTTCCTAGGTTTTTTTTCCAGG - Intergenic
1190802941 X:53808998-53809020 TCTTGGTAGGTTTGTTTTCTAGG - Intergenic
1191046167 X:56139672-56139694 ACTTCCTAGGTTTTCTTTTAGGG - Intergenic
1191169872 X:57432788-57432810 ACCTCCTAGTTTTGTTATCTTGG + Intronic
1191270080 X:58454393-58454415 AATGCCTAGGTTTTTCTTCTAGG + Intergenic
1191734269 X:64372972-64372994 ACTTCCTAGATTGGTGTTATTGG - Intronic
1191790590 X:64968285-64968307 ACTTCCTGAATTTGTCTTCTTGG - Intronic
1192084821 X:68085769-68085791 GCTTGCTAGGTTTCTTTTCTTGG - Intronic
1192734256 X:73833445-73833467 ACTTCCTAGGTTTTTTTCATTGG - Intergenic
1193387520 X:80888704-80888726 ATTGCCTAGGTTTTTTTCCTAGG + Intergenic
1194235465 X:91378217-91378239 ATTTCCTAGGTTATTTTTCCAGG - Intergenic
1194279367 X:91929478-91929500 ACTTCCTAGGCTGGTGATCTTGG - Intronic
1194919450 X:99747356-99747378 GTTTCTTAGGTTTTTTTTCTAGG - Intergenic
1194927402 X:99841926-99841948 AATGCCTAGGTTTTTCTTCTAGG - Intergenic
1194930829 X:99885533-99885555 ACTGCCTAGATTTGCTTTGTAGG - Intergenic
1195762710 X:108264059-108264081 CCTTCCTGGGTTTTGTTTCTAGG + Intronic
1197220518 X:123908620-123908642 TCTACCTACATTTGTTTTCTTGG + Exonic
1197261768 X:124327530-124327552 ACTTCCTAGCTGTGTGATCTTGG + Intronic
1197294617 X:124703204-124703226 ACTTATTAGGTGTGTTTCCTTGG - Intronic
1197625498 X:128797611-128797633 ATTTCCTAGGTTTTCTTTCAAGG - Intergenic
1197675449 X:129325044-129325066 ACTTGCTAGGTGTGTGATCTTGG + Intergenic
1198652971 X:138884000-138884022 ACTTGCTAGCTTTGTGATCTTGG + Intronic
1198884620 X:141320918-141320940 GCTTCCTAGCTTTGTGCTCTTGG - Intergenic
1200508285 Y:4043119-4043141 ACTTCCTGGTTTTGTTGTCAAGG + Intergenic
1200596845 Y:5152972-5152994 ACTTCCTAGGCTGGTGATCTTGG - Intronic
1201301523 Y:12509203-12509225 ATTGCCTAGATTTTTTTTCTAGG + Intergenic
1201504734 Y:14685750-14685772 ACTGGCTAGCTCTGTTTTCTTGG + Intronic
1201553598 Y:15245038-15245060 GCTTCCTTAGTATGTTTTCTAGG - Intergenic
1201737291 Y:17282040-17282062 ATTTACTAGGTTTGTGGTCTGGG - Intergenic
1202112608 Y:21439272-21439294 ATTGCCTAGGTTTATCTTCTAGG + Intergenic
1202590896 Y:26482045-26482067 ACTTCCAAAATTTGTTTTTTTGG - Intergenic