ID: 976499429

View in Genome Browser
Species Human (GRCh38)
Location 4:85770430-85770452
Sequence CTTCCTAGGTTTGTTTTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 700
Summary {0: 1, 1: 0, 2: 4, 3: 65, 4: 630}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976499421_976499429 30 Left 976499421 4:85770377-85770399 CCTAAGAAAATTCCAATAGTCCT 0: 1
1: 0
2: 1
3: 18
4: 258
Right 976499429 4:85770430-85770452 CTTCCTAGGTTTGTTTTCTTGGG 0: 1
1: 0
2: 4
3: 65
4: 630
976499424_976499429 7 Left 976499424 4:85770400-85770422 CCTATTGTTCACAAAATAAATGT 0: 1
1: 0
2: 4
3: 40
4: 422
Right 976499429 4:85770430-85770452 CTTCCTAGGTTTGTTTTCTTGGG 0: 1
1: 0
2: 4
3: 65
4: 630
976499422_976499429 18 Left 976499422 4:85770389-85770411 CCAATAGTCCTCCTATTGTTCAC 0: 1
1: 0
2: 0
3: 14
4: 117
Right 976499429 4:85770430-85770452 CTTCCTAGGTTTGTTTTCTTGGG 0: 1
1: 0
2: 4
3: 65
4: 630
976499423_976499429 10 Left 976499423 4:85770397-85770419 CCTCCTATTGTTCACAAAATAAA 0: 1
1: 1
2: 2
3: 24
4: 311
Right 976499429 4:85770430-85770452 CTTCCTAGGTTTGTTTTCTTGGG 0: 1
1: 0
2: 4
3: 65
4: 630

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976499429 Original CRISPR CTTCCTAGGTTTGTTTTCTT GGG Intronic
901555818 1:10030510-10030532 CTGCTTAGGTTTATCTTCTTTGG - Intergenic
902217703 1:14945054-14945076 CTCCCTAGCTTTCTGTTCTTGGG + Intronic
902607908 1:17579441-17579463 CTTCCTAGCTGTGTGATCTTGGG + Intronic
902791432 1:18771012-18771034 CTTCCTAGCTGTGTGATCTTGGG - Intergenic
902940753 1:19799138-19799160 CTTCCTAGCTGTGTGGTCTTGGG + Intronic
903647454 1:24903822-24903844 CTTACTAGCTTTGTGTCCTTGGG + Intronic
903666829 1:25013177-25013199 CTTCCTAGCTTTGTGACCTTGGG + Intergenic
903695366 1:25202321-25202343 CGTTCTATGTTTGTTGTCTTGGG - Intergenic
904595026 1:31638539-31638561 TTTCCTAGGTGGGTTTTCCTAGG - Intronic
904608607 1:31712893-31712915 CTTCCTGGCTTTATTATCTTAGG + Intergenic
904986873 1:34558334-34558356 GTTCCTATGTTAGTTTGCTTAGG + Intergenic
905105155 1:35559464-35559486 CTGCCTGGGTCTGTTTTCTGGGG + Intronic
905610000 1:39342161-39342183 GTTCCTATGTTAGTTTGCTTGGG + Intronic
905745520 1:40414018-40414040 CTTCCTGAGTTTTGTTTCTTTGG + Intronic
905805903 1:40877485-40877507 GATCCTAGATTTGTTTTCTGAGG - Intergenic
905970723 1:42140358-42140380 CTTCTTAGGGTTGTTTTAGTGGG - Intergenic
906270447 1:44473567-44473589 CTTACTAGGCTTCATTTCTTGGG + Intronic
906298635 1:44664865-44664887 CTTCCTGGCTGTGTGTTCTTGGG - Intronic
906451227 1:45949944-45949966 GTTCCTGGGTTAGTTTACTTAGG - Intronic
906792959 1:48674603-48674625 CTTACTAGCTGTGTTGTCTTGGG + Intronic
906818701 1:48906238-48906260 CATGCTATGTTTGTTTTCATGGG - Intronic
907298797 1:53472233-53472255 CTTCCTAGCTGTGTATTGTTGGG + Intergenic
907320892 1:53601673-53601695 CTTCCTAGCTGTGTGTTCTTGGG - Intronic
907708681 1:56855628-56855650 CTTCATGGGTTTTTTTTTTTTGG + Intronic
908017423 1:59858087-59858109 CTTCCTAGCTATATTGTCTTAGG - Intronic
908404492 1:63800955-63800977 TTTGCTAGGTTTTTTTTTTTTGG + Intronic
908863293 1:68515207-68515229 CTTCCTAATTTTGTTTTGCTTGG + Intergenic
909293070 1:73909329-73909351 CTTCCTATGTTTGTGACCTTGGG - Intergenic
909386624 1:75065502-75065524 ATTTCTAGTTTTATTTTCTTGGG + Intergenic
909605619 1:77505387-77505409 TTTTCTAGTTTGGTTTTCTTTGG - Intronic
909921461 1:81386247-81386269 CTTACTAGGTTTATTCTATTAGG - Intronic
910365424 1:86460071-86460093 CTCCCTTGATTTCTTTTCTTGGG + Intergenic
910825259 1:91400245-91400267 CTCTCTAGTCTTGTTTTCTTTGG + Intronic
911048525 1:93649449-93649471 CTTCCTAAGCTAGTTCTCTTTGG - Intronic
911160095 1:94675408-94675430 CTGCCTATGTTTATTTTCATAGG + Intergenic
911942664 1:104068085-104068107 CTTCCTAGTTCTGTTTTGGTAGG + Intergenic
911971971 1:104450865-104450887 CTTCCAGGGTTTTTATTCTTTGG + Intergenic
912065678 1:105738512-105738534 CTTCTTCTGTATGTTTTCTTTGG + Intergenic
912300946 1:108516492-108516514 CTTCCTAGTTTAGTCTTCGTAGG + Intergenic
912864065 1:113241187-113241209 CTTCCCTGGTTTTTTTTTTTAGG + Intergenic
913035778 1:114964470-114964492 TTGCCTAGGTTTTTTTTCTAGGG + Intronic
913552678 1:119931246-119931268 GTTCCTAGGTATTTTATCTTTGG - Intronic
915019910 1:152769396-152769418 CTTCTGAGGTTTGCTTTGTTCGG + Intronic
916318375 1:163475724-163475746 GTTCCTATGTTAGTTTGCTTAGG + Intergenic
916406818 1:164506295-164506317 CTTCCTAGGTTTTTGTTTTTGGG + Intergenic
916698920 1:167270365-167270387 ATTCCTTGTTTTGTTTTTTTGGG + Intronic
916786833 1:168092715-168092737 CTTCCTAAGTTCCTTTGCTTGGG - Intronic
916886257 1:169071463-169071485 CTTTCTAGCTTTATGTTCTTAGG + Intergenic
916931908 1:169587126-169587148 CTTACTAGCTGTGTTGTCTTGGG + Intergenic
917047524 1:170878311-170878333 ATTCCTTGGTTTCTTCTCTTTGG - Intergenic
918023594 1:180720011-180720033 CTTTCTAATTTTTTTTTCTTGGG + Intronic
918308836 1:183270936-183270958 CTTCCTCTGTTTATTTTCTTTGG + Intronic
918500368 1:185188106-185188128 CTTACTAGGTATGTATCCTTGGG - Intronic
919211024 1:194486512-194486534 CTTTTTACGTATGTTTTCTTTGG + Intergenic
919485189 1:198137374-198137396 ATTCTTAGGTTCGTATTCTTTGG + Intergenic
920890459 1:209979716-209979738 GTTCCTGGGTTTGTTTGCTGAGG + Intronic
921083061 1:211759187-211759209 CTTCCTAAGCTTGTTTTATCGGG - Intronic
921127537 1:212190683-212190705 CTTCTTAGATTTGTGTACTTTGG - Intergenic
921186064 1:212670550-212670572 CTTCCGGGGATTGGTTTCTTCGG - Intergenic
921806204 1:219458453-219458475 CTCCCTAGGATTTTTTTCCTAGG + Intergenic
921928346 1:220732310-220732332 TTTTCTGTGTTTGTTTTCTTTGG - Intergenic
922151664 1:223010724-223010746 CTCTAGAGGTTTGTTTTCTTAGG - Intergenic
922410391 1:225368295-225368317 CTCCCTCAGTTTGCTTTCTTTGG - Intronic
922524838 1:226292860-226292882 CTTCCTAGCTTTGAGTTCTTGGG + Intronic
922976600 1:229789731-229789753 GTTCCTATGTTAGTTTTCTGAGG - Intergenic
923446443 1:234076150-234076172 ACTCCTCGGTTTTTTTTCTTTGG + Intronic
923577986 1:235178845-235178867 CTTCCTAGCTTTTTTTTAATGGG + Intronic
923875663 1:238044200-238044222 ATTCCTAAGTTTTTTTTTTTGGG - Intergenic
924085569 1:240448103-240448125 GTTTCAAGGTTTGTTTTCTTGGG - Intronic
924093400 1:240525422-240525444 CCTCCTGGATTTGTTTTCTATGG + Intronic
924289968 1:242525930-242525952 TGTGCTAGGTTGGTTTTCTTAGG + Intergenic
924478659 1:244405867-244405889 TTTCCCAAGTTTGTTTTCTCAGG + Intergenic
924649659 1:245914068-245914090 ATTCCTAGGTGTCTTTTTTTGGG - Intronic
924787844 1:247217142-247217164 ATTCCTAGGTATTTATTCTTTGG + Intergenic
924848901 1:247803483-247803505 CTGCCTAGTCTTATTTTCTTTGG + Intergenic
924874811 1:248090550-248090572 GTTCCTTGGTTGGTTTGCTTAGG + Intronic
1062976752 10:1689374-1689396 CTTCCTCTGTTTCTTTTCCTTGG + Intronic
1063754141 10:8986822-8986844 ATTTCCAGGTTTGTTTTATTGGG + Intergenic
1063789325 10:9424029-9424051 TTCCCTAGGTTTGTCTGCTTGGG + Intergenic
1064274765 10:13895347-13895369 CTTCCTATGTTAGTTTGCTAAGG + Intronic
1065329995 10:24585846-24585868 TTTCCTAGTGCTGTTTTCTTTGG + Exonic
1065547734 10:26838825-26838847 CTTCCTAGCAGTGTTATCTTGGG - Intronic
1065670531 10:28111963-28111985 CTTCCTGGAAGTGTTTTCTTTGG - Intronic
1066753242 10:38681797-38681819 ATTCCTAAGTTAGTTTGCTTGGG - Intergenic
1067116323 10:43437816-43437838 TTTACTAAGTTTGTATTCTTTGG + Intronic
1067316508 10:45170542-45170564 CTTCCTAGGTGTTATTTCCTAGG - Intergenic
1067963538 10:50883384-50883406 CTCCCTAGGTTTGTGACCTTGGG - Intronic
1067969649 10:50954905-50954927 TTTCCTAGGTTTATGTTCCTCGG + Intergenic
1068264760 10:54632159-54632181 CTTCCTGTGTTAATTTTCTTAGG - Intronic
1068977625 10:63027759-63027781 CTTTCTTGGTTTGCTTTCTTTGG - Intergenic
1069131011 10:64702655-64702677 CTTTTTTGGTTTGTTTTGTTTGG - Intergenic
1069195757 10:65549249-65549271 CTTCCTGTGTTAGTTTTCTAAGG - Intergenic
1069282101 10:66667845-66667867 CTTGCTCTGTTTGTTTTCATGGG + Intronic
1069864643 10:71494463-71494485 CTTCCTAGCTGTGTGATCTTCGG + Intronic
1070011957 10:72484067-72484089 CTTCCTAAATGTGTTTTCTGTGG + Intronic
1070556597 10:77532649-77532671 TTTTCTAGGTTTGTTTCCATGGG + Intronic
1070774549 10:79102157-79102179 CTTTCTGGGTTTGTTCCCTTGGG - Intronic
1071097843 10:81999577-81999599 CTTCTTATGTTTGTTTCTTTGGG + Intronic
1072023195 10:91426345-91426367 ATTTCTAGGTTTGTTTTGTTTGG - Intronic
1072115144 10:92363759-92363781 ATTCCTATGTTAGTTTGCTTAGG - Intergenic
1072883009 10:99247284-99247306 CTTACTAAGATTGTTTTCCTGGG - Intergenic
1073676854 10:105657432-105657454 CTTGTTGGGTTTGTTTTGTTTGG - Intergenic
1073832314 10:107399263-107399285 CTTCCTGTGTTAGTTTGCTTAGG + Intergenic
1073989973 10:109251782-109251804 TTGCCTAGGTTTTTTTTCTAGGG + Intergenic
1074013678 10:109510291-109510313 GTTCCTATGTTAGTTTGCTTAGG + Intergenic
1074093585 10:110287239-110287261 TTCCCTGGGTTTGTTTTCCTTGG + Exonic
1074165890 10:110872761-110872783 CTTCCCGGCTTTGTTTTCTCTGG - Intronic
1074201152 10:111236576-111236598 GTTCCTGTGTTTGTTTGCTTAGG + Intergenic
1074950716 10:118332277-118332299 CTCACCTGGTTTGTTTTCTTAGG + Intronic
1075291065 10:121231326-121231348 CTCCCCAAGTTTCTTTTCTTAGG - Intergenic
1076042934 10:127266908-127266930 CTTCCTAGGCTGGTTAACTTGGG + Intronic
1077795241 11:5484716-5484738 CTTCCTGGCTTTGTGTCCTTGGG - Intronic
1077859851 11:6168082-6168104 CTTCCTACATTTCATTTCTTGGG - Intergenic
1078172658 11:8940547-8940569 CTTCCTAGCTATGTGTCCTTAGG + Intergenic
1078223497 11:9371417-9371439 CTTTCAAGATTTATTTTCTTTGG - Intergenic
1078295935 11:10070253-10070275 CTGCCTAGGTTTTTCTTCTAGGG + Intronic
1078467848 11:11563256-11563278 CTTCCTGGCTTTGTTCTCATAGG + Intronic
1078857001 11:15214457-15214479 CTTCTTAGTTTTGTTTTTTAGGG - Intronic
1079021156 11:16910289-16910311 CTTTCTAGGTGTGTGATCTTGGG - Intronic
1079306950 11:19331744-19331766 ATCCCTAAGTTTGATTTCTTAGG - Intergenic
1079359649 11:19759653-19759675 CTTACTAGCTATGTTTTCTTGGG + Intronic
1079479658 11:20865944-20865966 CTTCCTAGCTGTGTGCTCTTGGG + Intronic
1080480473 11:32644213-32644235 GTTCCTGTGTTAGTTTTCTTAGG - Intronic
1082755321 11:57069487-57069509 GTTCCTGTGTTAGTTTTCTTAGG - Intergenic
1085191838 11:74633054-74633076 GTCACTAGGATTGTTTTCTTTGG + Intronic
1085349189 11:75787722-75787744 CTTCCTGTGTTTGGTTTCTGGGG + Intronic
1085979085 11:81700649-81700671 ATTCTGATGTTTGTTTTCTTAGG - Intergenic
1086009658 11:82085346-82085368 CTTCCTGGGTTTGATTACATTGG - Intergenic
1086195522 11:84134329-84134351 CTTCCTTGGACTATTTTCTTAGG + Intronic
1086392551 11:86380419-86380441 ATTCCTAGGTATCTTTTTTTGGG + Intronic
1087902033 11:103651672-103651694 CTTTCTAGCTGTGTGTTCTTGGG + Intergenic
1087907200 11:103712305-103712327 TTTCCTAGTTTTGTGATCTTAGG - Intergenic
1088073419 11:105817093-105817115 CTTACTAGCTTTGTTGTATTAGG + Intronic
1088481299 11:110298350-110298372 CTTCCTAGTTTTGTTACATTGGG - Intergenic
1088875007 11:113928145-113928167 CTTCCTATGTTAGTTTGCTGAGG + Intronic
1090413375 11:126524121-126524143 CTTCCTAGCTCTGCTGTCTTGGG + Intronic
1090716455 11:129436158-129436180 CTTCCTAGTTACGTTATCTTAGG + Intronic
1091071178 11:132565111-132565133 CTTCCTATTTTTGTTTTTTAAGG - Intronic
1091391782 12:130400-130422 CTTCCTAGGACTGTGTCCTTGGG - Intronic
1091510052 12:1113377-1113399 CTTACTAGCTGTGTTTTCCTAGG - Intronic
1091616776 12:2055511-2055533 CTTACTCTGGTTGTTTTCTTTGG + Intronic
1091738350 12:2941743-2941765 CTTCCCAGGTTTGTTCTTGTTGG + Intergenic
1091981865 12:4871159-4871181 CTTCCTAGGCATGCTTTCTGGGG + Intergenic
1092026599 12:5245976-5245998 CTTCCTAGGTGTGTAACCTTGGG + Intergenic
1092561334 12:9616998-9617020 CCTCCTATATTTGTTTTCTAGGG - Intergenic
1092600169 12:10052211-10052233 CTTCCTAGCTTTGTTGTTTAAGG + Intronic
1093190208 12:16065590-16065612 CTTCCTAGGCCTCTTTTCTTGGG - Intergenic
1093214976 12:16351506-16351528 CCCCCTATTTTTGTTTTCTTAGG - Intronic
1093472257 12:19514904-19514926 CTTCCTGGCTTTTTTTTTTTTGG + Intronic
1093475878 12:19553907-19553929 TTTCCTTGGTTTGTTTTATTGGG + Intronic
1093715375 12:22376047-22376069 CTTCCTGGGTTTAATTTCTGTGG + Intronic
1093759469 12:22891225-22891247 CTTCCTGTGTTAATTTTCTTAGG + Intergenic
1093766616 12:22970597-22970619 CTTACTAGCTTTGTGTTCTTGGG + Intergenic
1094138858 12:27159700-27159722 TTTCCTAGATTTTTTTTCTGGGG - Intergenic
1094352371 12:29541365-29541387 CTTACTAGCTGTGTTTCCTTAGG + Intronic
1094386524 12:29900353-29900375 ATTCCTGGGTTAGTTTGCTTAGG + Intergenic
1094478971 12:30865063-30865085 CTTACTAGCTGTGTTGTCTTTGG + Intergenic
1094774852 12:33713877-33713899 GTGCCTTGGTGTGTTTTCTTTGG + Intergenic
1095222748 12:39636707-39636729 CTTCATCAGTTTGTTTTCTTAGG - Intronic
1095269980 12:40206782-40206804 CTTACTAGGTTTGTTTTTATTGG - Intronic
1095599378 12:43997864-43997886 CTTACTAGGTATGTGATCTTGGG - Intronic
1096884722 12:54705571-54705593 GTTCCTGTGTTTGTTTGCTTAGG + Intergenic
1097796760 12:63870881-63870903 CTTCCTAGCTTGATTTTCTTGGG + Intronic
1097836498 12:64278311-64278333 TTTTTTAGGTTTGTTTGCTTGGG + Intronic
1098039036 12:66335572-66335594 CTTTATTGGTTTGTTTACTTTGG + Intronic
1098684858 12:73406540-73406562 AATCCTTGTTTTGTTTTCTTTGG - Intergenic
1098692384 12:73504580-73504602 CTTCCTACGTTTGCTTGTTTAGG + Intergenic
1098852925 12:75619082-75619104 TTGCCTAGGTTTTTTTTCTAGGG - Intergenic
1098860204 12:75700924-75700946 TTTCCTAAATTTGTTTCCTTTGG - Intergenic
1098872099 12:75827516-75827538 ATATTTAGGTTTGTTTTCTTTGG + Intergenic
1098878106 12:75888032-75888054 CTTCTTATGTTTGTTTTCTAGGG - Intergenic
1099045036 12:77706894-77706916 TTTCCTAGTTTTTTTTTTTTTGG - Intergenic
1099088193 12:78273457-78273479 CTTCCTAGGTTTTTTTCCTAGGG + Intergenic
1099189583 12:79548612-79548634 CCTGCTAGCTTTGCTTTCTTTGG - Intergenic
1100801062 12:98231133-98231155 ATTCCTCAGTTTATTTTCTTGGG - Intergenic
1101039197 12:100737012-100737034 CTTCAGAGGTTAGTTTTCTAGGG - Intronic
1101730566 12:107423891-107423913 CTTCCCTGAGTTGTTTTCTTTGG + Intronic
1102189405 12:110975343-110975365 CTTCCTAGGTTTGTAATTTGGGG + Intergenic
1102198865 12:111043774-111043796 CTTCCTAGATATGTGTCCTTGGG - Intronic
1102210704 12:111124905-111124927 GTTCCTATGTTAGTTTGCTTAGG + Intronic
1102418768 12:112787407-112787429 CTTCCTGGCTGTGTTATCTTGGG + Intronic
1102753446 12:115316808-115316830 GGTCATTGGTTTGTTTTCTTTGG - Intergenic
1102797705 12:115703214-115703236 CTTACTAGCTTTGTGTTCTTGGG - Intergenic
1103527968 12:121580130-121580152 ATTTTTTGGTTTGTTTTCTTTGG - Intronic
1105815207 13:24029887-24029909 CTTCCTAAGTTAGTTTGCTAAGG + Intronic
1106474775 13:30089151-30089173 CTGGCTTGGTTTGATTTCTTAGG + Intergenic
1106535903 13:30642695-30642717 CTTCCTATATTCTTTTTCTTGGG + Exonic
1106742038 13:32654795-32654817 CTTCCTGCATTTGTTTGCTTAGG + Intronic
1106885978 13:34184471-34184493 CTTCCCCGTTTTGTTGTCTTGGG + Intergenic
1106964431 13:35044261-35044283 CTTGCTAGGTCTATGTTCTTGGG + Intronic
1108793851 13:54006692-54006714 TCTCCTAGATTTGTTTTCATGGG - Intergenic
1109082140 13:57918162-57918184 CTTCCCACATTTGTTTTCTTAGG - Intergenic
1109088040 13:58001195-58001217 CTTTCAAGTTTTGTTTTCTGTGG - Intergenic
1109181325 13:59217346-59217368 CTTCTTCAGTTTGTTGTCTTAGG - Intergenic
1109211982 13:59545523-59545545 TTTCTTAGGTCTTTTTTCTTGGG - Intergenic
1109410426 13:61958499-61958521 CTTCTTAGTTATGTTTCCTTAGG - Intergenic
1110532001 13:76608768-76608790 CTTACTAGTTTTGTGATCTTGGG - Intergenic
1111776728 13:92672762-92672784 CTTCCTATGTTAGTTTGCTAAGG - Intronic
1111997526 13:95179420-95179442 CTTCCTAGCTTTTGTTTTTTGGG - Intronic
1112293481 13:98165630-98165652 CTTACCAGGTTTGTTTTAATGGG - Intronic
1112387449 13:98953011-98953033 CTTTCTATCTGTGTTTTCTTAGG - Intronic
1112648599 13:101365309-101365331 CTTCCTGTGTTAGTTTGCTTAGG + Intronic
1112675558 13:101697330-101697352 CTTCCTAGGTTTTGTTTCTGAGG + Intronic
1112723207 13:102270476-102270498 CTACTTAGGTTTGTTTTCTTAGG + Intronic
1112913315 13:104516683-104516705 GTTCCTACGTTAGTTTGCTTAGG + Intergenic
1113091145 13:106618489-106618511 CTTCCAAGGTTTCTATTCTCAGG + Intergenic
1113241168 13:108338993-108339015 CTCCCTAGGTAATTTTTCTTTGG + Intergenic
1114056403 14:18971448-18971470 CTTCCTATGTTAGTTTGCTAAGG - Intronic
1114106147 14:19430279-19430301 CTTCCTATGTTAGTTTGCTAAGG + Intronic
1114882599 14:26805450-26805472 CTAACTAGGTTTCCTTTCTTTGG + Intergenic
1114981717 14:28173035-28173057 TTGCCTAGGTTTTTTTTCTAGGG - Intergenic
1115074072 14:29363817-29363839 CTTCCTATGAATATTTTCTTTGG - Intergenic
1115181951 14:30637976-30637998 CTTCAAAGGTTTTTTCTCTTGGG + Intronic
1115453486 14:33575102-33575124 TTTCCTAGGATTTTTGTCTTGGG - Intronic
1115578813 14:34738017-34738039 TTGCCTAGGTTTTTTTTCTAGGG + Intergenic
1115715038 14:36094167-36094189 CTTACTAGATTTGGTTTCTCTGG + Intergenic
1116508982 14:45719978-45720000 CTACCTAGGTTTATTTACTATGG - Intergenic
1116536640 14:46040039-46040061 GTTCTTATGTTTGTTTGCTTAGG + Intergenic
1116584240 14:46682270-46682292 ATTCCTAGGTTTTTCTTTTTTGG + Intergenic
1116795751 14:49388525-49388547 TTGCCTAGGTTTTTTTTCTAGGG - Intergenic
1117398719 14:55338594-55338616 CTACCTTGGTTTCTTTTCTTAGG + Intronic
1117972247 14:61263501-61263523 CTTCCTAGCTGTGTGTCCTTAGG - Intronic
1118416229 14:65539397-65539419 CTTCCTGGTTTTGTGATCTTAGG + Intronic
1119044412 14:71305225-71305247 CTTTTTAGGCATGTTTTCTTAGG - Intergenic
1119075313 14:71632380-71632402 TTTTCTAAGTTTGTTTTTTTTGG - Intronic
1119109891 14:71961525-71961547 CTTCCTAGCTGTGTGATCTTAGG - Intronic
1119112774 14:71990438-71990460 CTTCCAAGGTTTGTGTCCTTTGG + Intronic
1119167759 14:72509437-72509459 CTTCCTAGCTGTGTATTCTTAGG + Intronic
1119714240 14:76847418-76847440 CTTCCTATGTTAGTTTGCTAAGG - Intronic
1120090538 14:80327577-80327599 CTTCCTAGGTTGAATTGCTTGGG + Intronic
1120303245 14:82735106-82735128 CTTACTGACTTTGTTTTCTTAGG + Intergenic
1120820291 14:88905909-88905931 GTTCCTGTGTTTGTTTGCTTAGG + Intergenic
1121550335 14:94794803-94794825 CTTATTAGGTTTGTTAACTTTGG + Intergenic
1123499011 15:20862794-20862816 CTTCCTATGTTAGTTTGCTAAGG + Intronic
1123556245 15:21436413-21436435 CTTCCTATGTTAGTTTGCTAAGG + Intronic
1123592485 15:21873759-21873781 CTTCCTATGTTAGTTTGCTAAGG + Intergenic
1123793489 15:23747856-23747878 TTCCCTAATTTTGTTTTCTTTGG + Intergenic
1125561479 15:40637055-40637077 TTTCCCCAGTTTGTTTTCTTGGG + Intronic
1125901970 15:43356934-43356956 TTTCCTAAGTTTGTTCTCTATGG - Intergenic
1126285486 15:47006097-47006119 CTTCCTATGTTAGTTTGCTGAGG + Intergenic
1126672944 15:51132942-51132964 GCTCCTAAGTATGTTTTCTTTGG + Intergenic
1126727006 15:51641893-51641915 CTTCCTTGTTTTCTTCTCTTAGG + Intergenic
1127039467 15:54958302-54958324 CTTTCTAGTTGTATTTTCTTGGG - Intergenic
1127101171 15:55566334-55566356 CTTCCTATGTTAATTTGCTTAGG + Intronic
1127684270 15:61326686-61326708 CTTCCTAGCTGTGTGGTCTTGGG - Intergenic
1128365517 15:66998489-66998511 GTTCCTAGGTTAGTTTGCTAAGG - Intergenic
1128485085 15:68077207-68077229 CGTTTTAGGTTTGTTTTATTTGG - Intronic
1128577783 15:68788198-68788220 CTTACTGGGTTTGTCTTCTGCGG - Intronic
1128797218 15:70474751-70474773 GTTCCTCGTTTTGTTCTCTTCGG + Intergenic
1128951452 15:71887551-71887573 CTTCCCAGTTTTGTTACCTTTGG + Intronic
1131384976 15:91997906-91997928 TTTCCTAGGTTTCTTTCCCTAGG - Intronic
1131791928 15:95974295-95974317 CATCCTAGGTTTTTTTTTCTAGG + Intergenic
1132018403 15:98339201-98339223 CATCCTAGGGTGGTTTTCTGAGG - Intergenic
1202964586 15_KI270727v1_random:163616-163638 CTTCCTATGTTAGTTTGCTAAGG + Intergenic
1132596654 16:754292-754314 CTTCCTGGGCTTGTTTTCCCTGG + Intronic
1133442499 16:5832398-5832420 CTTCCTAGCTGTGTGATCTTGGG + Intergenic
1134297889 16:12962832-12962854 CTTCCTAGGTGTATCTTGTTGGG + Intronic
1134817843 16:17220792-17220814 CTTCCTGGGCTTGTTTGCCTGGG + Intronic
1134823804 16:17268252-17268274 CTTCCTAAATTTGTTTTCGTTGG + Intronic
1135933068 16:26755996-26756018 CTTACTAGATTGGTTTCCTTGGG - Intergenic
1136549318 16:30974175-30974197 CTTCCCAAGTTTCTTTTCCTGGG - Intronic
1136729462 16:32395216-32395238 ATTCCTAAGTTGGTTTGCTTGGG + Intergenic
1140266137 16:73422823-73422845 CCTCCTGGGTTAGTTTGCTTGGG + Intergenic
1140609823 16:76584530-76584552 GTTCCTATGTTAATTTTCTTAGG + Intronic
1140706338 16:77633852-77633874 CTTCCTAGCTTTGTGATCTTGGG - Intergenic
1140939979 16:79712441-79712463 CTTCAGTGGCTTGTTTTCTTTGG + Intergenic
1141228951 16:82146385-82146407 CCTCCTTATTTTGTTTTCTTAGG - Intergenic
1141425875 16:83944097-83944119 CTTCCTAGCTGGGTGTTCTTGGG - Intronic
1141881736 16:86864691-86864713 GTTCCTGTGTTTGTTTGCTTAGG + Intergenic
1202996933 16_KI270728v1_random:122077-122099 ATTCCTAAGTTGGTTTGCTTGGG - Intergenic
1203023620 16_KI270728v1_random:434419-434441 ATTCCTAAGTTGGTTTGCTTGGG - Intergenic
1142467559 17:144957-144979 CTTCTTAGCTTTGCTTTTTTGGG - Intergenic
1145176803 17:20707643-20707665 CTTCCAAGATTTGTGTGCTTGGG + Intergenic
1145212283 17:21023055-21023077 GTTCCTATGTTAGTTTTCTAAGG - Intronic
1145941845 17:28746862-28746884 CCCCCTAGGTTAGTTTTCATTGG - Intronic
1146010984 17:29194263-29194285 CTTCCTTTGTTCCTTTTCTTGGG - Intergenic
1146376806 17:32300121-32300143 CTTTCTAGCTGTGTCTTCTTGGG - Intronic
1146749177 17:35362032-35362054 CTTTCTGGGGTTGCTTTCTTGGG - Intronic
1146782996 17:35692984-35693006 TTTTTTATGTTTGTTTTCTTTGG + Intronic
1147007331 17:37414061-37414083 CTTCCTGTGTTAGTTTGCTTAGG + Intronic
1147014110 17:37476602-37476624 CTTCCTGGGTGTGTGTCCTTAGG + Intronic
1147200066 17:38795304-38795326 CTTCATTGGTATCTTTTCTTTGG - Intronic
1147220137 17:38923827-38923849 CGGCCTAGTTTTGTTTTCTTTGG - Intergenic
1147478388 17:40735949-40735971 CTTTCTAGCTGTGTTTTCTTGGG - Intergenic
1147606715 17:41777772-41777794 CTACCCGGGTTTGTTTGCTTTGG - Intronic
1147640219 17:41992985-41993007 ATTCATAAGTTTGTTTTGTTTGG - Intronic
1148112875 17:45156563-45156585 GTTTCGAGGTTTGTTTTTTTGGG + Intergenic
1148283549 17:46368212-46368234 CTTTTGAGGTTTGTTTTCTTAGG + Intergenic
1148305767 17:46586137-46586159 CTTTTGAGGTTTGTTTTCTTAGG + Intergenic
1148495402 17:48050684-48050706 CTCCTAAGGTTTATTTTCTTTGG - Exonic
1149175909 17:53869728-53869750 CTATCTTGGTATGTTTTCTTAGG + Intergenic
1149258225 17:54851108-54851130 CTTGCTGCCTTTGTTTTCTTAGG + Intergenic
1149419070 17:56490930-56490952 CTTCCTTGCTTTTTTTTCTCTGG - Intronic
1149894517 17:60419242-60419264 GTTCCTATGTTAGTTTTCTAAGG - Intronic
1151060729 17:71090685-71090707 ATTCCTATGTTAGTTTGCTTAGG + Intergenic
1151917224 17:77127248-77127270 GTTCCTGGGTTAGTTTTCTGAGG + Intronic
1152033365 17:77857205-77857227 CTTCCTGCATCTGTTTTCTTAGG + Intergenic
1153500822 18:5747899-5747921 CTTCCTGGCTTTGTGTACTTGGG + Intergenic
1153754776 18:8269984-8270006 CTTTGTTTGTTTGTTTTCTTAGG + Intronic
1154457054 18:14539540-14539562 CTTCCTATGTTAGTTTGCTAAGG + Intronic
1156063180 18:33106292-33106314 CTTCCTTTCTTTATTTTCTTGGG - Intronic
1156139772 18:34093136-34093158 TTTTCTAGCTTTGATTTCTTGGG - Intronic
1156439852 18:37173917-37173939 TTTCCTAGGTTTGGCTTCTGTGG - Intronic
1156575866 18:38314243-38314265 CTTCATAGGTCTGTTTTACTAGG + Intergenic
1156598642 18:38577587-38577609 CTTTCTAGTTTTGATTTCTTTGG - Intergenic
1156654122 18:39263225-39263247 CTTCCTAGATTAGTTTTGTGAGG - Intergenic
1156812581 18:41270640-41270662 AGTCCTAGGTTGGTTTTCCTTGG - Intergenic
1156862300 18:41852002-41852024 CTTGCTAGATTTATGTTCTTTGG - Intergenic
1157744183 18:50120488-50120510 CTTCGTAGGTGTGCTTCCTTAGG - Intronic
1158671046 18:59474000-59474022 CTTCCTATGTTAGTTTGCTTAGG + Intronic
1158822900 18:61181311-61181333 TTTCCTAGGTTTTTTTTCAATGG - Intergenic
1159217001 18:65405508-65405530 CTTCCTGAGTTAGTTTACTTAGG - Intergenic
1159483541 18:69023183-69023205 CTTCCTAGTTATGTGATCTTGGG + Intronic
1159498671 18:69239563-69239585 CTTCTCAGGTTTGTATTTTTCGG - Intergenic
1160172236 18:76564708-76564730 CTTCCTAGCTCTGTTACCTTGGG + Intergenic
1160817013 19:1040792-1040814 GTGCCTGGGTTTGCTTTCTTGGG + Intronic
1161689428 19:5722477-5722499 CTTACTAGGTATGTGTTGTTAGG - Intronic
1162334494 19:10052127-10052149 CTTCCTAGCTGTGTGTCCTTGGG - Intergenic
1163200711 19:15766981-15767003 ATTCCTAGGTATTTTATCTTTGG + Intergenic
1163753064 19:19090007-19090029 TTTCCAAAGATTGTTTTCTTAGG + Intronic
1164138529 19:22436516-22436538 CTTCCTGTGTTTGTTTGCTGAGG + Intronic
1164279445 19:23756521-23756543 CTTCCTGTGTTAGTTTTCTGAGG - Intronic
1165290107 19:34876482-34876504 TTTGCTATGTTTATTTTCTTAGG - Intergenic
1165965766 19:39578517-39578539 CTTCCAGGGTTTTTTTTTTTGGG + Intergenic
1167006514 19:46779540-46779562 CTTCCTGGGTTGGTTTGCTATGG + Intronic
1167102101 19:47409947-47409969 CTTCCTAGCTGTGTGATCTTGGG + Intronic
1167874920 19:52404227-52404249 CTTCTTTTGTTTGTTTTTTTAGG + Intronic
925463783 2:4088366-4088388 CATGCTAGGTTGGATTTCTTTGG - Intergenic
925571467 2:5316842-5316864 CTTCCCAGGTATGTTATCATGGG - Intergenic
926907100 2:17816151-17816173 TGCCCCAGGTTTGTTTTCTTTGG + Intergenic
927410257 2:22816884-22816906 TTTCCTAGGTTTTGTTTCTTTGG - Intergenic
927416044 2:22881599-22881621 CTTCCTAGCTGTGTAATCTTGGG - Intergenic
927657112 2:24958542-24958564 CTTACTAGTTTTGTGATCTTGGG + Intronic
927762377 2:25770823-25770845 TTTTTCAGGTTTGTTTTCTTTGG - Intronic
927840087 2:26435678-26435700 GTTCCTATGTTAGTTTGCTTAGG + Intronic
929162712 2:38848945-38848967 CTGCCTGGATTTGGTTTCTTTGG - Intronic
930148919 2:48038366-48038388 ATTTCAAGATTTGTTTTCTTTGG + Intergenic
930192184 2:48471319-48471341 CCTCCTACATATGTTTTCTTAGG + Exonic
930461988 2:51693052-51693074 CTTCCTGTGTTAGTTTGCTTAGG - Intergenic
930552166 2:52849475-52849497 GGTCCTGGGTTTTTTTTCTTGGG + Intergenic
931680316 2:64741611-64741633 CTTCCTAAATTTGTTATATTAGG + Intronic
932172554 2:69570616-69570638 CTTGCTAGTTTTATTTTCTTTGG - Intronic
932655011 2:73602840-73602862 CTTACTAGGTATGTCATCTTGGG - Intronic
933193453 2:79363027-79363049 CTTCCTAGCTGTGTGGTCTTGGG + Intronic
933985522 2:87588956-87588978 GTTCCTGGGTTAGTTTTCTGAGG - Intergenic
934185764 2:89673253-89673275 ATTCCTAAGTTGGTTTGCTTGGG + Intergenic
935164810 2:100561290-100561312 TTTCCTGGGTCTGTTGTCTTAGG + Intergenic
935679121 2:105620748-105620770 CTTCCTTGGTTTGTTTCCTCAGG + Intergenic
936308321 2:111361844-111361866 GTTCCTGGGTTAGTTTTCTGAGG + Intergenic
936838604 2:116740793-116740815 CTTCCTCTGTTTGTTTGTTTTGG - Intergenic
937479022 2:122240256-122240278 CTGGCTGGGTTTGTTTTCTTTGG - Intergenic
938336543 2:130505179-130505201 CTTCCTATGTTAGTTTGCTAAGG + Intronic
938353275 2:130615483-130615505 CTTCCTATGTTAGTTTGCTAAGG - Intronic
938474523 2:131595473-131595495 CTTCCTATGTTAGTTTGCTAAGG - Intergenic
938800990 2:134763183-134763205 CTTCCTAGCTGTGTGTCCTTAGG - Intergenic
938908038 2:135858011-135858033 CTTCTTAGGCTTGATTTGTTTGG - Intronic
939001554 2:136741320-136741342 CTGCCTGGGTTTGTTTTTCTTGG - Intergenic
939097336 2:137848946-137848968 CTTCTTGGGTTTTTTTTTTTTGG - Intergenic
939137304 2:138312816-138312838 CTGCCAAAGTTTGTTTTGTTTGG - Intergenic
939242441 2:139578577-139578599 TTTCCTAGATTTTTTTTCTGGGG - Intergenic
939628160 2:144504019-144504041 TTTACCAGGTTTGTTTTCTTGGG - Intronic
940767892 2:157809720-157809742 CTTTCTACCTTTGTGTTCTTGGG - Intronic
940773834 2:157866420-157866442 CTCCCTTGGCTTGTTTGCTTAGG - Intronic
942331443 2:174828964-174828986 CTTACAAGGTTGCTTTTCTTGGG - Intronic
942427228 2:175872867-175872889 TTTCTTAGGTTAGTTTTCATAGG + Intergenic
942700042 2:178696932-178696954 CTGCCTGGGTTTGTTTTCCTGGG + Intronic
942793245 2:179785460-179785482 CTTTCCAGATTTATTTTCTTTGG - Intronic
943254015 2:185569635-185569657 CTTCCCATGTCTTTTTTCTTTGG + Intergenic
943398945 2:187380184-187380206 CTTTTAAGGTATGTTTTCTTTGG + Intronic
944162106 2:196674219-196674241 CTTGCTGTGTGTGTTTTCTTAGG + Exonic
944857538 2:203782748-203782770 CTTCATAGGTTTGGATACTTGGG - Intergenic
944879250 2:203994647-203994669 CTTCCTAGGATTGTGTCCTTTGG - Intergenic
944887004 2:204073095-204073117 CTTCCTAGCTGTGTGATCTTGGG + Intergenic
945279671 2:208024266-208024288 CTTCCTAGTTGTGTAATCTTGGG - Intronic
945924043 2:215785581-215785603 CTTCCAGGGTTTGTTTTCTAAGG - Intergenic
946467071 2:219921403-219921425 CTAACTAGTTTTGTTTTCTGGGG - Intergenic
947146584 2:227072417-227072439 GATTCTGGGTTTGTTTTCTTGGG - Intronic
947333775 2:229058343-229058365 CTTCCTCTGTTTGTTTGTTTTGG + Intronic
947483031 2:230520731-230520753 CTTTGTTGGTGTGTTTTCTTGGG - Intronic
1170547535 20:17447646-17447668 CTTTGTATGTTTATTTTCTTAGG - Intronic
1170922262 20:20690359-20690381 CTTACTGAGTTTGGTTTCTTAGG - Intronic
1172115681 20:32572181-32572203 CTTCCCAGCTTTGTGCTCTTGGG + Intronic
1172197801 20:33104073-33104095 CTTCCTAGCTCTGTTGCCTTGGG - Intronic
1172493031 20:35356645-35356667 CTTACTAGGTTTGTATCATTGGG - Intronic
1173345440 20:42195176-42195198 CTGCATAGGTTTATTTTCTGGGG - Intronic
1173620181 20:44430405-44430427 CAACCTGGGTTTGTTTTCTCGGG - Exonic
1174605152 20:51756065-51756087 CTTTCTACGTTAGTTTCCTTGGG + Intronic
1174763891 20:53233612-53233634 CTTGCTAGCTATGTGTTCTTAGG - Intronic
1177202658 21:17975196-17975218 GTTCCTATGTTAGTTTGCTTAGG - Intronic
1177984619 21:27959108-27959130 GTTCCTATGTTAGTTTTCTAAGG + Intergenic
1178974343 21:37208763-37208785 CTTCCCAGCTTCGTTTTCCTCGG - Intergenic
1180474889 22:15694059-15694081 CTTCCTATGTTAGTTTGCTAAGG - Intronic
1180543013 22:16469844-16469866 ATTCCTAAGTTGGTTTGCTTGGG - Intergenic
1181099384 22:20529146-20529168 CTTCCTGGTTTTTTTTTCTGTGG + Intronic
1182579573 22:31297957-31297979 CTTCCTAGCTATGTCATCTTAGG + Intergenic
1182989955 22:34757983-34758005 CTTCCTAGCTTTGTTACCCTGGG + Intergenic
1184327514 22:43800464-43800486 ATTCCTTGCTTTGTTTGCTTGGG - Intronic
950162894 3:10773185-10773207 CTTCCTAGCTGTGTGATCTTGGG + Intergenic
950234290 3:11305097-11305119 CTTCCTAGTTTAGTTTCCTATGG - Intronic
950351576 3:12359298-12359320 CTTCCTCATTTTATTTTCTTTGG - Intronic
951195289 3:19816819-19816841 CTTCCTAGTTATGTGATCTTTGG + Intergenic
952037519 3:29220833-29220855 CTTCCTTTTTTTTTTTTCTTCGG + Intergenic
952779691 3:37084023-37084045 CTGCTTAATTTTGTTTTCTTGGG - Intronic
953152018 3:40333413-40333435 CCTCCTAGGTATGTCCTCTTGGG - Intergenic
953249180 3:41227985-41228007 ATTCCTATGTTAGTTTGCTTAGG + Intronic
954049651 3:47963455-47963477 CCTACTAGCTTTGATTTCTTAGG - Intronic
954168924 3:48783944-48783966 TTTCCTAGGTTTTTTTCCTTTGG - Intronic
955471633 3:59292579-59292601 GTTCTTAGGTTAGTTTGCTTAGG + Intergenic
956257484 3:67299103-67299125 CTCCCTATTTTTATTTTCTTAGG - Intergenic
957350579 3:79018662-79018684 ATTCCAAGGTTTGTCTTCTCCGG + Intronic
957500153 3:81045356-81045378 CTTCCTAGGAATGTTTGCATGGG + Intergenic
958254544 3:91310284-91310306 CTTCCTAGGTTAGTTTGCTAAGG - Intergenic
959005872 3:101019279-101019301 CTTGGTAGTTTTGTTTTCTAAGG + Intergenic
959221010 3:103519869-103519891 CTTCCTTGATTTATTTTTTTTGG - Intergenic
959361091 3:105392619-105392641 GTTTCTGGGTTTGTTTGCTTTGG + Intronic
959567407 3:107846646-107846668 GTTCCCAGGGTTGTGTTCTTTGG - Intergenic
959920278 3:111860971-111860993 CTTCCTAGTTTGGTTTAATTTGG + Intronic
960138798 3:114132285-114132307 CTTCCTATGTTAGTTTGCTGAGG - Intronic
960531572 3:118771453-118771475 CTTCCTAGCTGTGTGATCTTGGG - Intergenic
960930632 3:122845228-122845250 GTTCCTGTGTTAGTTTTCTTAGG + Intronic
960977139 3:123186330-123186352 CTTCCTAGTTTTGTGACCTTGGG + Intronic
961232833 3:125334694-125334716 CTTACTACTTTTGTATTCTTTGG - Intronic
961713646 3:128844998-128845020 CTTCCTAGTCCTGTTCTCTTGGG + Intergenic
962960282 3:140304823-140304845 CTTACTAGGTGTGTCATCTTGGG + Intronic
963019881 3:140863023-140863045 CTTCCTGTGTTAGTTTTCTTAGG - Intergenic
963106269 3:141650242-141650264 CTTCCTAGGTTCCCTTTCCTGGG - Intergenic
963861777 3:150318295-150318317 CTTCATTGGTATATTTTCTTTGG - Intergenic
963935006 3:151043359-151043381 TTTCCCTGTTTTGTTTTCTTTGG + Intergenic
964727407 3:159828223-159828245 CTTATTAGGTGTGTTTCCTTGGG - Intronic
965087876 3:164122920-164122942 GTTCCTTTGTTAGTTTTCTTAGG - Intergenic
966273349 3:178135289-178135311 CTTCCTGTGTTAGTTTTCTGAGG - Intergenic
969160152 4:5250019-5250041 GTTCCTGGGTTAGTTTGCTTAGG + Intronic
969352927 4:6608581-6608603 CTTCCTAGATGTGTGATCTTGGG + Intronic
969460517 4:7326514-7326536 TTGCCGAGGTCTGTTTTCTTAGG + Intronic
969848670 4:9939586-9939608 CATCCTTGGTTTTTTTTTTTAGG + Intronic
970252982 4:14136114-14136136 CTTGCTAGCTTTGTGATCTTGGG + Intergenic
970729420 4:19085635-19085657 CTTCCAATGTGTGTCTTCTTCGG + Intergenic
970871731 4:20823989-20824011 CCTCCTAGCTATGTGTTCTTTGG + Intronic
971152296 4:24046278-24046300 CTTCCTAGGTTTCCTCTCTTAGG + Intergenic
971494834 4:27252557-27252579 CTTTCTAGCTGTGTTTCCTTGGG + Intergenic
971569501 4:28193200-28193222 GTTCATTGGTATGTTTTCTTTGG - Intergenic
972068462 4:34982933-34982955 CTTTGTTGGTGTGTTTTCTTGGG + Intergenic
972565945 4:40269099-40269121 CTTTCCAGGTTTTTTTTTTTTGG + Intergenic
972703678 4:41518845-41518867 CTTCCTAGGTTAGTTTGGTGAGG + Intronic
972877668 4:43384164-43384186 CTTCCTTGTTTTTATTTCTTTGG - Intergenic
972893722 4:43592726-43592748 TTTCCTAGGTTAGTTTGCTTAGG - Intergenic
973228787 4:47818417-47818439 CTTCCTCTGTTTGATTTCTTTGG - Intronic
974691044 4:65298355-65298377 TTTCCCAGGATTCTTTTCTTAGG - Intergenic
974773176 4:66442661-66442683 CTTCCTAATTTTGTCATCTTGGG + Intergenic
975080122 4:70267662-70267684 CTTCCTACTTTTATTTTCTTAGG - Intergenic
975303884 4:72825011-72825033 TTGCCTAGGTTTTTTTTCTAGGG + Intergenic
976499429 4:85770430-85770452 CTTCCTAGGTTTGTTTTCTTGGG + Intronic
976934466 4:90612459-90612481 CTGCCTAAGTTTCTTTTCATTGG - Intronic
977049867 4:92116222-92116244 CTTCCTGTGTTAGTTTGCTTAGG + Intergenic
977241418 4:94574794-94574816 CTTACTAGTTGTTTTTTCTTTGG + Intronic
977453692 4:97230088-97230110 TTTTCTAGCTGTGTTTTCTTAGG + Intronic
977948518 4:102942115-102942137 ATTCCTAAGTTCGTTTGCTTGGG - Intronic
979266011 4:118703987-118704009 CTTCCCAGGATTGTTTTTATTGG - Exonic
979718780 4:123873552-123873574 CTTCATAGGTATTTATTCTTAGG + Intergenic
979734854 4:124070672-124070694 TTTCTTAGGGTTGGTTTCTTAGG - Intergenic
980047009 4:128000219-128000241 TTTCCTAGGTTTTTCTTCTGGGG + Intronic
980132469 4:128829684-128829706 CTTCTTGGGTTTTTTCTCTTCGG - Intronic
980390098 4:132133771-132133793 TTGCCTAGGTTTTTTTTCTAGGG - Intergenic
981216194 4:142171336-142171358 GTACCTAGTGTTGTTTTCTTAGG - Intronic
981823248 4:148910419-148910441 CTTACTAGCTTTGTAATCTTGGG + Intergenic
982378223 4:154718427-154718449 CTTCCTAGGTTCTTTTGCTGGGG - Intronic
982379504 4:154734309-154734331 CTTCCTAGCTTTGTGACCTTTGG - Intronic
982546369 4:156738072-156738094 CTTTCTAGGGTTGTTTTCTTTGG + Intergenic
982967637 4:161933790-161933812 TTTGCTAGGTTTCTTTTATTGGG - Intronic
983009747 4:162532550-162532572 TTTCCTAGGATTCTTTCCTTAGG - Intergenic
983321784 4:166204005-166204027 CTTTCTAGTTTTTTTTTTTTAGG + Intergenic
983395581 4:167190708-167190730 GTTCATATGTTTGTTTTCTAGGG + Intronic
983396812 4:167208526-167208548 CTTACTAGCTATGTTATCTTGGG + Intronic
983450788 4:167908582-167908604 TTTCCTAGCCTTGTTTTCTAAGG - Intergenic
983518871 4:168686186-168686208 CTTCCTGGGTTTTTTTGTTTTGG + Intronic
983781033 4:171670188-171670210 TTTCCTAGGTTTGTTCTGTTTGG + Intergenic
984859852 4:184228270-184228292 CTTCCTAGATTTGTTTCCTGTGG + Intergenic
985173610 4:187177715-187177737 ATTCCTCTGTTTGTTTTCATGGG - Intergenic
985233767 4:187850224-187850246 CTGCTCAGGTTTGCTTTCTTGGG + Intergenic
986123506 5:4865406-4865428 GTTCCTGGGTTAGTTTGCTTTGG - Intergenic
986722386 5:10568888-10568910 CTCCATTGGTTTGTTTTGTTAGG + Intronic
986973753 5:13370891-13370913 GTTCCTGTGTTAGTTTTCTTAGG - Intergenic
987730870 5:21770939-21770961 GTTCTTAGGTTAGTTTGCTTAGG - Intronic
987782242 5:22454410-22454432 CTTGGTATGTTTGTTTTCTCAGG + Intronic
988219243 5:28320048-28320070 CTTCTTAGGTTCGTTTTTGTAGG + Intergenic
988265084 5:28938822-28938844 ATTCCTAATTTTGTTTTATTGGG + Intergenic
988413804 5:30919930-30919952 CTGCCTGGGTCTGTTCTCTTTGG - Intergenic
989403753 5:41037823-41037845 CTTCCTAGAGTTGTTTTCTAGGG - Intronic
989495599 5:42108222-42108244 ATTCCTAGGTATTTTTTCTTGGG + Intergenic
990375579 5:55167177-55167199 TTTGCTTTGTTTGTTTTCTTTGG + Intronic
990932046 5:61103210-61103232 CTTTCTAGCTTTGTCTCCTTAGG + Intronic
991322717 5:65393134-65393156 CTTCCTACCTTTGTGTTCTATGG - Intronic
991515620 5:67431918-67431940 CTTGCTCAGATTGTTTTCTTTGG + Intergenic
991570233 5:68046132-68046154 CTTCCTAGCTTGCTTTTCTTTGG + Intergenic
992101110 5:73408951-73408973 CTCCCTATGTTTGTTTCCTAGGG + Intergenic
992419409 5:76587137-76587159 CTTTCTAGCTCTGTTCTCTTAGG - Intronic
992520858 5:77549530-77549552 GTACCTAGGTTTGTTTTTTTGGG - Intronic
992911487 5:81399906-81399928 CTTCCTAGTTATGTGGTCTTGGG - Intergenic
993012474 5:82498960-82498982 ATTCCCAAGTTTGTTTTCTTTGG - Intergenic
993237131 5:85326095-85326117 CTTCCTAGGTTAGATTAGTTTGG + Intergenic
993362280 5:86992385-86992407 CTTGCTGGGTTAGTTTGCTTGGG + Intergenic
993725601 5:91363021-91363043 CTCCCTAGGTTAGTTTCCTGTGG - Intergenic
994522848 5:100863195-100863217 TTTCCTATGTCTGTTTTCTTTGG - Intronic
994590511 5:101766664-101766686 GTTCCTATGTTTGCTTACTTAGG + Intergenic
995959096 5:117817605-117817627 GTTCCTGGGTTAGTTTTCTGAGG + Intergenic
996337920 5:122404865-122404887 CTTTCTAGGTTTGTTTATCTTGG + Intronic
997093927 5:130889448-130889470 TTGCTTTGGTTTGTTTTCTTGGG + Intergenic
997713573 5:136026512-136026534 CTTCCTAGCTGTGTGGTCTTGGG - Intergenic
998892198 5:146757974-146757996 CTTCCTTGGTTGTTTTCCTTTGG - Intronic
999054078 5:148554912-148554934 GTTCCTCTGTTAGTTTTCTTAGG + Intronic
999271506 5:150298875-150298897 CTTCCTAGCTGTGTGATCTTGGG - Intronic
999693359 5:154167700-154167722 CATCCCAGATGTGTTTTCTTGGG - Intronic
1000737905 5:164928486-164928508 ATGCCTAGGTTTTTTTTCTAGGG + Intergenic
1001178889 5:169499743-169499765 GTTCCTATGTTAGTTTGCTTAGG + Intergenic
1001337180 5:170808848-170808870 GTTCCAAGAGTTGTTTTCTTGGG + Intronic
1003898345 6:10629322-10629344 GTTCCATGTTTTGTTTTCTTGGG + Exonic
1003908911 6:10726001-10726023 TTTCCTAGGTATGTCTGCTTTGG + Exonic
1004566881 6:16806536-16806558 CTTCCTAGCTGTGTGTCCTTGGG - Intergenic
1005244891 6:23872527-23872549 GTTCCTGGGTTAGTTTGCTTAGG - Intergenic
1005957573 6:30675074-30675096 CTTCCTAACTCTGTTTTCCTGGG + Intergenic
1006807439 6:36797820-36797842 CTTCCTAGCTGTGTGTCCTTGGG + Intronic
1007127253 6:39436460-39436482 TTTCCTAGGTTTTTTTTTTCTGG + Intronic
1007962999 6:45978047-45978069 CTTACTAGGGTTGTAATCTTGGG + Intronic
1008141947 6:47842115-47842137 TTTCCTAGGTTTGTGATCTTGGG + Intergenic
1008777219 6:55054883-55054905 CTCACTCGGTTTGTTTCCTTAGG - Intergenic
1009189283 6:60610215-60610237 CTTCCTAGGTTAGTTTGCTAAGG + Intergenic
1009418986 6:63444268-63444290 CTTGCCAGTTTTGTTATCTTGGG - Intergenic
1009528076 6:64773244-64773266 GTTCCTAAGTTGGTTTGCTTAGG + Intronic
1010313927 6:74422694-74422716 TTGCCTAGGTTTTTTTTCTAGGG - Intergenic
1010467999 6:76191431-76191453 CTTACTAGCTTCTTTTTCTTTGG - Intergenic
1011012842 6:82721575-82721597 CTTCCTACTTTGGTTTTCCTGGG - Intergenic
1012008141 6:93742994-93743016 GTTCCTATGTTTGTTTGCTAGGG - Intergenic
1012219866 6:96636341-96636363 CTTCATAAGTCTGTTTTGTTTGG - Intergenic
1012958251 6:105593868-105593890 CTGCCTAGATTTGTTTTCTTTGG - Intergenic
1013805146 6:113988530-113988552 CTTACTAGCTGTGTTTTATTGGG - Intronic
1013893902 6:115061764-115061786 CTTCCTAGATTCATTTACTTTGG - Intergenic
1014163908 6:118202096-118202118 TTTCATTGGTATGTTTTCTTGGG + Intronic
1014194062 6:118532235-118532257 GTTCCTATGTTAGTTCTCTTAGG - Intronic
1014226181 6:118849880-118849902 CTTCCTATGTTTCTTTTTTTTGG - Intronic
1014354184 6:120383528-120383550 ATTCCTAGGTTTATATTTTTGGG + Intergenic
1014725430 6:124966000-124966022 CTTCCTAGCCTTGGTTTCTGGGG - Intronic
1014975938 6:127884210-127884232 CTTCCCATGTTGGTGTTCTTTGG + Intronic
1015038300 6:128685102-128685124 CTTCTTAGTTTTGGTTTCTCTGG + Intergenic
1015105768 6:129534345-129534367 CTTTATAGGTTTTCTTTCTTTGG + Intergenic
1015794349 6:136996209-136996231 CTTCCTAGGTTTGTCACCTCAGG - Intergenic
1016347063 6:143124996-143125018 TTTCCAAGTTTTGTTTTTTTGGG + Intronic
1016705317 6:147100207-147100229 GTTTTTATGTTTGTTTTCTTTGG - Intergenic
1016869413 6:148801815-148801837 ATTTCTAGGTATTTTTTCTTGGG + Intronic
1017598031 6:156050452-156050474 TTTCATTGCTTTGTTTTCTTCGG + Intergenic
1018470113 6:164087357-164087379 CTTCTTTGGTTTGGTTTCCTTGG - Intergenic
1018625237 6:165771485-165771507 CTTCCCAGGTGTCTTCTCTTTGG - Intronic
1019199675 6:170304412-170304434 CTTCCTAGGTTTGTTGTGCTGGG + Intronic
1020463751 7:8452946-8452968 CTTCCTAGTTTGCTTTTCTGGGG + Intronic
1021541094 7:21759489-21759511 CTTCCCAGGTTTGACTGCTTCGG - Intronic
1021930184 7:25572956-25572978 CTAGCTAGATTTGTTTTCTCTGG + Intergenic
1023039315 7:36158442-36158464 TTTAGTAGGTGTGTTTTCTTAGG + Intronic
1023429876 7:40079638-40079660 TTTACTAGATTTGTATTCTTGGG - Intronic
1023456733 7:40347928-40347950 CTGCCTAGCATTCTTTTCTTGGG + Intronic
1024226753 7:47331225-47331247 CCTCTTAGTTTTGTTTTATTGGG - Intronic
1025037389 7:55604791-55604813 CTTCCTAGGTTATTTGTGTTTGG - Intergenic
1025591628 7:62867320-62867342 CTTTCTTGTTTTTTTTTCTTGGG - Intergenic
1027994846 7:85412792-85412814 TTTCCTATGTTTGTTTATTTTGG - Intergenic
1028299409 7:89179644-89179666 CTTACTTGGTTTGTTTTGTGAGG + Intronic
1028727907 7:94110077-94110099 CTTATTAGGGGTGTTTTCTTTGG + Intergenic
1029290385 7:99497981-99498003 CTTCCTGGTTTTGCTTTCTGCGG - Intronic
1029303584 7:99602614-99602636 CTTCCTAGCTGTGTGATCTTGGG - Intronic
1030100691 7:105942493-105942515 CTTCCTAGATTTGTAAACTTAGG + Intronic
1030191375 7:106813651-106813673 CTTCACAGCTTTGTTTTATTAGG - Intergenic
1030265240 7:107614355-107614377 CATGCTAGGTTTTTTATCTTAGG + Intronic
1030272243 7:107682634-107682656 CTTTCTAGCTTTCTTTTTTTTGG - Intronic
1030744722 7:113151368-113151390 CTTCCTTGGGATGTTTTCCTGGG - Intergenic
1031294873 7:119989011-119989033 GTTCCTCTGTTGGTTTTCTTAGG - Intergenic
1031888594 7:127267145-127267167 CTTCCTGTGTTAGTTTGCTTAGG + Intergenic
1032650179 7:133869355-133869377 CTTACTAGTTGTGTTCTCTTGGG + Intronic
1032880560 7:136085611-136085633 CTTCTTTTGTTTTTTTTCTTGGG + Intergenic
1032915497 7:136484488-136484510 CTTCCTTTCTTTGTTTTCTAGGG + Intergenic
1033513419 7:142083104-142083126 ATTCCTGGGTTTGCTTCCTTTGG - Intronic
1033694922 7:143778400-143778422 ATTCCTAGGTATTTTTTTTTTGG - Intergenic
1034295399 7:149967861-149967883 CTTCCCAGGCTTTTCTTCTTGGG + Intergenic
1034565076 7:151907337-151907359 CTTCCTGTGTTAGTTTGCTTAGG - Intergenic
1034810659 7:154129069-154129091 CTTCCCAGGCTTTTCTTCTTGGG - Intronic
1035142175 7:156773746-156773768 TTTCCTAGGTTTTTTTTCCAGGG - Intronic
1035892214 8:3357300-3357322 CTTCCTAGCTCTGTGTCCTTGGG + Intronic
1036585189 8:10117208-10117230 GTTCCTAGGTTTGATTTTTGAGG + Intronic
1036591016 8:10168069-10168091 CTTACTAGCTTTGTGTCCTTGGG + Intronic
1037026046 8:14039613-14039635 CTTCCTATGTTAATTTTCTTAGG + Intergenic
1037155084 8:15689721-15689743 CTTCCTGTGTTAGTTTGCTTAGG + Intronic
1038724893 8:30072504-30072526 ATTCATAGGTTTGTTGACTTAGG + Intronic
1039335673 8:36586616-36586638 CTTACTAGATTTGTAATCTTGGG + Intergenic
1039411987 8:37362620-37362642 GTTCCTAGGTTAGTTTGCTGAGG - Intergenic
1039737285 8:40346392-40346414 GTTCCTAGGTTAGTTTGCTAAGG - Intergenic
1040893859 8:52345086-52345108 TTTCCTAGTTTTGGTTTGTTTGG - Intronic
1040996886 8:53411320-53411342 CTTCTTTGATTTCTTTTCTTTGG - Intergenic
1041209689 8:55536323-55536345 CTGACTAAGTTTCTTTTCTTTGG + Exonic
1042062750 8:64838957-64838979 CTTCCCAGGTGTTTTATCTTGGG + Intergenic
1042137706 8:65647644-65647666 TTCCATGGGTTTGTTTTCTTGGG + Intronic
1042711214 8:71719554-71719576 CTTCCTATGTTAGTTTCCTAGGG + Intergenic
1042735220 8:71980041-71980063 CTTCCTGGCTTGGTTTCCTTGGG - Intronic
1042822440 8:72945340-72945362 CTTACTTGATTTGTTTTGTTTGG + Intergenic
1043159027 8:76822389-76822411 ATTCCAAGGTTTTTTTCCTTTGG + Intronic
1043636899 8:82396126-82396148 CTTTCCAGGTTTGCTCTCTTAGG - Intergenic
1043996427 8:86823396-86823418 GTTTGTAGGTTTGTGTTCTTGGG + Intergenic
1044166706 8:88993504-88993526 ATTATTAGGTTTTTTTTCTTAGG + Intergenic
1044351248 8:91169132-91169154 GTTCCTGGGTTAGTTTGCTTAGG - Intronic
1044461106 8:92445029-92445051 CTTTCTAGTTTTTGTTTCTTCGG - Intergenic
1044528034 8:93274602-93274624 CTTACTAGCTTTGTGGTCTTAGG - Intergenic
1044561419 8:93616282-93616304 CTTCCTAGCTATGTGTCCTTGGG + Intergenic
1045207769 8:100060543-100060565 ATTCCTAGGTATGTTTTTTGTGG - Intronic
1045711575 8:104990643-104990665 CTTCAGAGGTGTGTCTTCTTTGG + Intronic
1046081734 8:109377807-109377829 ATTCATAGGTTTTATTTCTTGGG + Intronic
1047130299 8:122012128-122012150 ATTCCTGTGTTTGTTTGCTTAGG + Intergenic
1048136010 8:131747019-131747041 CTTCCTGTGTTAGTTTCCTTAGG - Intergenic
1048271627 8:133032950-133032972 CTTCCTTGCTGTGTGTTCTTTGG - Intronic
1048274496 8:133056022-133056044 CTTCCTAGGTGTGTGCTCTTGGG - Intronic
1048687627 8:136921775-136921797 CTTGCTAGTTTTGATTTATTTGG + Intergenic
1048901827 8:139045402-139045424 TTTCCTATGTTTATTTTTTTTGG - Intergenic
1049155042 8:141061163-141061185 ATTCCAAGCATTGTTTTCTTGGG + Intergenic
1050278817 9:4029194-4029216 TTTCCAAAGTTTGTTTTCTAAGG - Intronic
1050569023 9:6918284-6918306 GTTCTTAGGTTAATTTTCTTAGG + Intronic
1051207902 9:14708848-14708870 CTTCCTGTGTTAGTTTTCTGAGG - Intergenic
1051866536 9:21689578-21689600 CTTCCTAGGTTGGATTTCGTGGG + Intergenic
1052003906 9:23323388-23323410 CTTCTTTTGTTTGTTTTTTTTGG + Intergenic
1052414776 9:28164496-28164518 CTTTCTAGCTGTGTATTCTTGGG - Intronic
1052762655 9:32608641-32608663 CTACCTGGGTTAGATTTCTTTGG - Intergenic
1052873887 9:33537296-33537318 CTTACTCTTTTTGTTTTCTTTGG - Intronic
1053785920 9:41652877-41652899 TTTAATTGGTTTGTTTTCTTGGG - Intergenic
1054449493 9:65395870-65395892 TTTAATTGGTTTGTTTTCTTGGG - Intergenic
1055727578 9:79248083-79248105 CTTCATAGTTTTGTCTTTTTCGG - Intergenic
1056617941 9:88184438-88184460 CTTACTAGTTTTGTTTTCTTTGG - Intergenic
1056626352 9:88256894-88256916 CCTCCTGTGTTTGTTTTCTCAGG - Intergenic
1056679970 9:88708629-88708651 CTTCCTGGGTTAGTTTGCTGAGG - Intergenic
1056760462 9:89411043-89411065 CTTCCCAGGTCTTCTTTCTTAGG + Intronic
1057681525 9:97191357-97191379 CTTACTTTTTTTGTTTTCTTTGG + Intergenic
1057870745 9:98715133-98715155 AACCCTAGGTTTGTTTTCTATGG + Intergenic
1057947259 9:99340485-99340507 CTTCCTGCATCTGTTTTCTTGGG - Intergenic
1057967468 9:99518085-99518107 CTTCCTCTATTTGTTTTCTAGGG - Intergenic
1058178036 9:101761080-101761102 GTTCCTATGTTAGTTTGCTTAGG + Intergenic
1058326376 9:103703586-103703608 CTTCCTAAGGTTTTTTTCCTAGG - Intergenic
1058369106 9:104244178-104244200 CATCCTATATTTGTTTTCTGTGG - Intergenic
1058616591 9:106835174-106835196 GTTCCTATGTTAGTTTGCTTAGG - Intergenic
1058739882 9:107932377-107932399 GTTCCTAGGTTTGTGAGCTTGGG - Intergenic
1059325162 9:113499877-113499899 CTTGTCAGGTTTGTTTTCTGTGG + Intronic
1060068776 9:120528480-120528502 CTTCCTAGCTATGTGCTCTTAGG + Intronic
1060358230 9:122931108-122931130 CTCCCGAGGCTCGTTTTCTTAGG + Intronic
1060425980 9:123506122-123506144 CTTCCTAGCTGTGTTACCTTGGG + Intronic
1061970084 9:134040207-134040229 CTTCTTTGGTTTGTTTACTGGGG + Exonic
1187671534 X:21670965-21670987 GTTCCTACGTTAGTTTGCTTAGG + Intergenic
1188083954 X:25880848-25880870 CTTACTAGGTTTGTGTCTTTGGG + Intergenic
1188227998 X:27625737-27625759 GTTCCTGGGTTGGTTTACTTAGG - Intronic
1188633248 X:32395084-32395106 CTTCCTAGTTATGTTACCTTGGG - Intronic
1188636664 X:32441079-32441101 CTCTCTTGGGTTGTTTTCTTTGG + Intronic
1188787062 X:34360082-34360104 GTTCCTATGTTAGTTTGCTTAGG + Intergenic
1188826278 X:34839319-34839341 CTTCCTGTGTTAGTTTGCTTAGG + Intergenic
1188900559 X:35727901-35727923 CTTCCTGTGTTAGTTTGCTTAGG + Intergenic
1188966381 X:36558314-36558336 CTTCAAAGTTATGTTTTCTTAGG - Intergenic
1189653530 X:43216124-43216146 TTTCCTAGGTTTTTTTCCTAGGG - Intergenic
1189923413 X:45926636-45926658 TTTTCCAGGTTTGTTTTCTGTGG + Intergenic
1190605030 X:52132435-52132457 TTTCCTAGGTTTTTTTTCCAGGG - Intergenic
1191169874 X:57432789-57432811 CCTCCTAGTTTTGTTATCTTGGG + Intronic
1191734268 X:64372971-64372993 CTTCCTAGATTGGTGTTATTGGG - Intronic
1191790589 X:64968284-64968306 CTTCCTGAATTTGTCTTCTTGGG - Intronic
1192232678 X:69276885-69276907 GTCCCTAGGTTAGATTTCTTTGG + Intergenic
1192692603 X:73380562-73380584 GTTCCTATGTTAGTTTTCTGAGG - Intergenic
1192734255 X:73833444-73833466 CTTCCTAGGTTTTTTTCATTGGG - Intergenic
1193229390 X:79026224-79026246 GTTCCTATGTTAGTTTGCTTAGG - Intergenic
1193432961 X:81434458-81434480 CTTCCTACATTAGTTTGCTTAGG + Intergenic
1193464328 X:81829034-81829056 ATTCAGAGGTTTGTTTTCTATGG + Intergenic
1193557920 X:82979339-82979361 GTTCCTGCGTTAGTTTTCTTAGG - Intergenic
1193637753 X:83973689-83973711 CTTCCTAGGTTAGTTTGCTGAGG - Intergenic
1194123533 X:89988161-89988183 CTTCTTATTTCTGTTTTCTTTGG - Intergenic
1194179157 X:90691913-90691935 GTTCCTATGTTAGTTTGCTTAGG - Intergenic
1194208911 X:91045176-91045198 CTTTGAAGGTGTGTTTTCTTTGG - Intergenic
1194251415 X:91579854-91579876 CTTCCTTTGTTAGTTTGCTTAGG + Intergenic
1194389908 X:93303725-93303747 CTTATTAGTTGTGTTTTCTTAGG - Intergenic
1194646993 X:96469888-96469910 CTTCCTATGATTTTCTTCTTTGG + Intergenic
1194980886 X:100439181-100439203 CTTCCTAGGTGTGTATATTTGGG - Intergenic
1195762711 X:108264060-108264082 CTTCCTGGGTTTTGTTTCTAGGG + Intronic
1196455986 X:115892020-115892042 CTTCCTTGGTTTGTGTTCCCTGG - Intergenic
1197003255 X:121465038-121465060 CTTCCTCTCTTTCTTTTCTTTGG + Intergenic
1197007478 X:121519410-121519432 CTTCCTAAATTTTATTTCTTAGG + Intergenic
1197091551 X:122544626-122544648 CTGCCCAGGTTTATTTCCTTTGG - Intergenic
1197155392 X:123264688-123264710 CTTCCTAGAGATGTTGTCTTGGG + Intronic
1197261769 X:124327531-124327553 CTTCCTAGCTGTGTGATCTTGGG + Intronic
1197294616 X:124703203-124703225 CTTATTAGGTGTGTTTCCTTGGG - Intronic
1197675450 X:129325045-129325067 CTTGCTAGGTGTGTGATCTTGGG + Intergenic
1197993597 X:132347030-132347052 ATTCCTAGGTTTTTTTTTTTTGG - Intergenic
1198009108 X:132532277-132532299 CTTCCTAGTTTGGTGTTCTCAGG + Intergenic
1198316784 X:135475906-135475928 CTTGATAGCTTTGTTGTCTTAGG + Intergenic
1198602471 X:138298608-138298630 GTTCCTAGCTTTGATTTTTTTGG - Intergenic
1198652972 X:138884001-138884023 CTTGCTAGCTTTGTGATCTTGGG + Intronic
1198692338 X:139297973-139297995 TCTCCAAAGTTTGTTTTCTTGGG - Intergenic
1198842114 X:140868483-140868505 ATTCCTAGGTATTTTTTGTTTGG - Intergenic
1198884619 X:141320917-141320939 CTTCCTAGCTTTGTGCTCTTGGG - Intergenic
1199183898 X:144892342-144892364 CTTCCTTGGTGAGCTTTCTTTGG + Intergenic
1199253221 X:145688880-145688902 CTTCCTACATTAGTTTGCTTAGG + Intergenic
1199659059 X:150029068-150029090 CTTTCAAGGTTTTTTTCCTTTGG + Intergenic
1200023802 X:153237380-153237402 CTTTCTGATTTTGTTTTCTTTGG - Intergenic
1200476418 Y:3645781-3645803 CTTCTTATTTCTGTTTTCTTTGG - Intergenic
1200525824 Y:4274080-4274102 GTTCCTATGTTAGTTTGCTTAGG - Intergenic
1200570356 Y:4821085-4821107 CTTCCTTTGTTAGTTTGCTTTGG + Intergenic