ID: 976501088

View in Genome Browser
Species Human (GRCh38)
Location 4:85789886-85789908
Sequence CTTACTTAGATCTTAAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976501088_976501089 9 Left 976501088 4:85789886-85789908 CCTTGCTTTAAGATCTAAGTAAG 0: 1
1: 1
2: 0
3: 15
4: 180
Right 976501089 4:85789918-85789940 TTAGTCATTGCTTACGTTTCTGG 0: 1
1: 0
2: 0
3: 3
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976501088 Original CRISPR CTTACTTAGATCTTAAAGCA AGG (reversed) Intronic