ID: 976501088

View in Genome Browser
Species Human (GRCh38)
Location 4:85789886-85789908
Sequence CTTACTTAGATCTTAAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976501088_976501089 9 Left 976501088 4:85789886-85789908 CCTTGCTTTAAGATCTAAGTAAG 0: 1
1: 1
2: 0
3: 15
4: 180
Right 976501089 4:85789918-85789940 TTAGTCATTGCTTACGTTTCTGG 0: 1
1: 0
2: 0
3: 3
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976501088 Original CRISPR CTTACTTAGATCTTAAAGCA AGG (reversed) Intronic
902175498 1:14647083-14647105 TTTACTTACATCTTAAACCCTGG + Intronic
906692960 1:47804854-47804876 CTTACTTAGAACTCAAAATATGG + Intronic
909035344 1:70589749-70589771 ATTATTTAGATCTTGTAGCATGG - Intergenic
909602478 1:77474701-77474723 CTTACTTCCTTCTTAAAGAAAGG + Intronic
909940805 1:81609445-81609467 CTTTCTTCCATCTCAAAGCATGG - Intronic
911510743 1:98805547-98805569 ATTATTTAGATCTTATAGGATGG + Intergenic
912170753 1:107096579-107096601 CTTAATTAAATTTTAAAACATGG + Intergenic
912306169 1:108569820-108569842 CTGATTTAGATCTTAAAGAATGG - Intronic
916445980 1:164872167-164872189 CTTACTATGCCCTTAAAGCAGGG - Intronic
921833110 1:219750298-219750320 TTAACTTGGATCTTAGAGCATGG + Intronic
922407328 1:225328763-225328785 GTTACTTACATATTAACGCATGG - Intronic
923127891 1:231048004-231048026 CTTATTTACATCTTTAAGCCTGG - Intergenic
923770860 1:236936505-236936527 ATTATTTAGATCTTATAGGATGG + Intergenic
1064046182 10:12018036-12018058 ATTACTTAGATGTCAAAGAAAGG - Intronic
1065034866 10:21627611-21627633 CTTTCTTAGGTCTTAAAAAAGGG + Intronic
1066341744 10:34540998-34541020 TTTACTTATATCTTAAATTAAGG - Intronic
1067392182 10:45873999-45874021 CATACTGAGATGTTAATGCAGGG + Intergenic
1067871102 10:49962053-49962075 CATACTGAGATGTTAATGCAGGG - Intronic
1068058471 10:52038034-52038056 ATTACTTAGATCTTGCAGGATGG + Intronic
1069260977 10:66396281-66396303 CTTATTTAGATATTAAAAGAGGG + Intronic
1069499269 10:68936047-68936069 TTTAGTTAAATCTAAAAGCATGG + Exonic
1071786063 10:88901365-88901387 CTTACTTAGAACTCTATGCAAGG - Intronic
1074956672 10:118397436-118397458 CTTTGTGACATCTTAAAGCACGG + Intergenic
1077766510 11:5164587-5164609 ATTATTTAGATCTTGAAGAATGG + Intronic
1078306326 11:10190972-10190994 TTTACTGAGATCTAACAGCAAGG - Intronic
1079762588 11:24349476-24349498 CTTACTTAGATGTAAATGTAGGG - Intergenic
1079897923 11:26146162-26146184 CATACTGAGATCTCTAAGCATGG - Intergenic
1080969318 11:37251632-37251654 CTTGTTTAGCTGTTAAAGCAAGG + Intergenic
1083362228 11:62118413-62118435 CTAGTTTAGATCTTAAACCAGGG - Intergenic
1087592690 11:100211719-100211741 CTGACTTAGAGCTGAAAGCTAGG - Intronic
1087947501 11:104181372-104181394 CTTGCTAAGATTTGAAAGCAAGG - Intergenic
1088362901 11:109009753-109009775 CTTACTTAGATCTTGAAGCAAGG + Intergenic
1090733391 11:129590794-129590816 GTTCCTTAGTTCTTACAGCATGG - Intergenic
1090825835 11:130385129-130385151 CTTACATAGAAGTTAAAGTAAGG - Intergenic
1091183541 11:133628225-133628247 ATTACTTAGATCTTGTAGGATGG - Intergenic
1092469700 12:8766839-8766861 CTAACTCAAATCTTAAAGTATGG - Intronic
1093390677 12:18616191-18616213 CTGACTTAGCTCTTAAAACTTGG + Intronic
1094783879 12:33823166-33823188 GTTAATTATATCTTAAAGCTGGG + Intergenic
1095712195 12:45302200-45302222 CCTACATAGATCTTATTGCAGGG + Intronic
1096641982 12:53002106-53002128 TTTACTTAGATGGTAAAGCCTGG - Intergenic
1097841116 12:64322483-64322505 CATACTTACTTCTTAGAGCATGG + Intronic
1108789730 13:53953721-53953743 CTTATGTAGATAGTAAAGCAAGG - Intergenic
1109648821 13:65297110-65297132 CTTCTTTATATTTTAAAGCAGGG - Intergenic
1109678524 13:65714171-65714193 CTTTCTTAAATTTTAAAGCAAGG - Intergenic
1111966320 13:94865665-94865687 CTCACTTAGATTTTAAAGTCAGG + Intergenic
1114740778 14:25095009-25095031 TTAACTTAGATATTAAAGGAGGG + Intergenic
1116857135 14:49962675-49962697 CTTCCTTCCATCTTAAAGCAGGG + Intergenic
1117831528 14:59756320-59756342 TTTACTTAGATCTTAAGAAAAGG + Intronic
1119361725 14:74055764-74055786 CTTACTTAGAACTAAAGGGACGG + Intronic
1119668559 14:76501373-76501395 CTTACTTGGTTCTTAAAGTGTGG - Exonic
1120082658 14:80233387-80233409 ATTATTTAGATCTGAAAGCAGGG - Intronic
1120525486 14:85572164-85572186 TTTACTTAGATCATAAACCTAGG + Intronic
1124814672 15:32977715-32977737 CTTCATAAGAGCTTAAAGCATGG + Intronic
1127160511 15:56179498-56179520 CTAAATTTAATCTTAAAGCATGG + Intronic
1130789767 15:87141557-87141579 CTTACTAAAAATTTAAAGCAGGG + Intergenic
1137431983 16:48426029-48426051 CTTACATGGATCTCAAGGCAGGG - Intronic
1138872454 16:60907867-60907889 TTTACTTAAATCTTAAAGGAAGG + Intergenic
1140079017 16:71726758-71726780 CTGAATTGGATCTTAAATCATGG - Intergenic
1145097976 17:20048070-20048092 CTTAGTGAGAGGTTAAAGCAAGG - Intronic
1150240373 17:63627042-63627064 ATTACTTGTATCTCAAAGCAGGG - Intronic
1150696347 17:67408908-67408930 TTTTCTTAGATGTTAAACCAAGG - Intronic
1155094084 18:22539176-22539198 CTTGTTTACTTCTTAAAGCAGGG + Intergenic
1159941130 18:74409799-74409821 CTTTCTTAAATTTTAAAACATGG + Intergenic
1160275796 18:77433802-77433824 AACACTTAGATCTTTAAGCATGG - Intergenic
1164090333 19:21946033-21946055 CTTACTTAGATAATGGAGCAAGG + Intronic
1164173391 19:22747059-22747081 CTAACTCAAATCTTAAAGTATGG + Intergenic
1166499059 19:43327743-43327765 ATTATTTAGATCTTATAGGATGG + Intergenic
1167378087 19:49122645-49122667 CTTCCTTAGAACCTAAAACAGGG - Intronic
926972354 2:18479654-18479676 CTTAATTAGATCTTACAGGAAGG + Intergenic
927597599 2:24410316-24410338 TTTACTTAGAACCTAAAGCTGGG + Intergenic
928532139 2:32203362-32203384 TTTAGTTAAATCTAAAAGCACGG + Intronic
931110162 2:59101700-59101722 CCTTCTTAGATCTCAAAGGAAGG - Intergenic
932086946 2:68771025-68771047 CTTACTGAGTACTTAAAACATGG + Intronic
934162973 2:89269923-89269945 CTTACTTACGTCTTAAGGCTAGG + Intergenic
934204300 2:89912601-89912623 CTTACTTACGTCTTAAGGCTAGG - Intergenic
934850842 2:97700141-97700163 CTTAGCTAGATCTCAAAGGAAGG - Intergenic
936529745 2:113267960-113267982 CCTCCTTAGATCTTATAGCCTGG - Intronic
939543588 2:143524114-143524136 CTTTCTTAAATCTTTAAGCAAGG - Intronic
940294782 2:152111138-152111160 CTTACTTAGATTTCACTGCAAGG - Intergenic
941562414 2:167064092-167064114 GTTAATTATATCTTAAAGCTGGG - Intronic
941796832 2:169608544-169608566 CTTACTTAGATAATAAAGTTAGG - Intronic
942134625 2:172912444-172912466 CTTTCTGAAGTCTTAAAGCAGGG + Intronic
943244581 2:185430324-185430346 CTTAATTTGCTCTTAAAGTAGGG - Intergenic
943539132 2:189189808-189189830 CTTAATTATATATTAAAGTATGG + Intergenic
943614101 2:190071970-190071992 CTTTCATAAATCTTAAAGCATGG + Intronic
943965799 2:194330157-194330179 CTTAGCTATATCTAAAAGCATGG - Intergenic
944152316 2:196573092-196573114 CTTTTTTAGATCTTGAAACATGG - Intronic
945744160 2:213700541-213700563 GTTACTTACATCTTAATGAAGGG + Intronic
946521753 2:220472831-220472853 CTTACATTGCTCTAAAAGCAAGG - Intergenic
1177031307 21:15984095-15984117 ATTATTTAGATCTTATAGGATGG + Intergenic
1179963523 21:44785817-44785839 CTCACTAGGATCTTCAAGCAGGG + Intronic
1182658616 22:31909217-31909239 CTTATTTAGAACTTAAAACGTGG + Intergenic
952636859 3:35543212-35543234 CTTTCTTCAATCTTACAGCAAGG - Intergenic
955522428 3:59787996-59788018 CCTACTTTGTTCTTAAAGGAGGG - Intronic
960100509 3:113737651-113737673 CTTACCTAGATTTTACAGCAGGG + Intronic
961880930 3:130060714-130060736 ATTATTTAGATCTTACAGGATGG - Intergenic
962082259 3:132152540-132152562 CTTAGTTGGATCTTACATCAGGG + Intronic
963293501 3:143518729-143518751 CTTATTTATATCATATAGCAAGG - Intronic
964159374 3:153628215-153628237 CTTTCTAAGACCTTAAGGCAGGG - Intergenic
964221568 3:154352754-154352776 TTTAGTTAAATCTAAAAGCATGG - Intronic
964762656 3:160148927-160148949 CTTGCTTAGATCTCACTGCATGG - Intergenic
964941088 3:162158445-162158467 ATTACTTAGATCTTGTAGGATGG + Intergenic
966048390 3:175582348-175582370 CTTATTTAGATTTCTAAGCAAGG - Intronic
966397531 3:179518271-179518293 ATTATTTAGATCTTGTAGCATGG - Intergenic
967151962 3:186659065-186659087 ATTATTTAGATCTTATAGGATGG - Intergenic
967740357 3:192997094-192997116 ATTACTTAGATCTTGCAGGATGG - Intergenic
973161772 4:47027435-47027457 CTTATTTATATATTATAGCATGG - Intronic
973941179 4:55911951-55911973 GTTACTGAGCTCTTGAAGCAAGG - Intergenic
974466913 4:62269650-62269672 ATTAATTGGCTCTTAAAGCATGG + Intergenic
974726109 4:65800226-65800248 ATTACTTAGGTCTTCTAGCAAGG + Intergenic
975023402 4:69519181-69519203 TTTACTCAGATTTTAAAGGACGG + Intronic
975401002 4:73939552-73939574 CTGACTTAGATGTAACAGCAGGG + Intergenic
976396655 4:84563098-84563120 TTTACTTACTTCTTAAAGCTTGG - Intergenic
976501088 4:85789886-85789908 CTTACTTAGATCTTAAAGCAAGG - Intronic
978274028 4:106926964-106926986 CTTACTCAGATTTTGAGGCAGGG + Intronic
982572687 4:157070025-157070047 TTTACCTAGGTCTTAAAGGAAGG + Intergenic
982636176 4:157899649-157899671 CTGCCCTAGATCTTAAAGCAAGG + Intergenic
983011892 4:162557573-162557595 CTTTCCTGGACCTTAAAGCATGG - Intergenic
983290908 4:165803392-165803414 CTAACTTAGTTCTTAAATCAGGG - Intergenic
984339409 4:178436222-178436244 CTTTCTTAGACCTTAAACCATGG - Intergenic
985922418 5:2988088-2988110 CATACATAGAACTTAAAGCCTGG - Intergenic
991467097 5:66924948-66924970 AATTCTTAGATCATAAAGCATGG + Intronic
992736632 5:79728352-79728374 TTTGCTGAGATTTTAAAGCAGGG + Intronic
992920076 5:81506029-81506051 CTTACTTAGTTATTCAAGCTGGG + Intronic
995899496 5:117050635-117050657 ATTACTTAGATCTTGCAGGATGG + Intergenic
997391630 5:133521808-133521830 CTTACTTAGAAATTAAAGATGGG - Intronic
999445000 5:151632262-151632284 CTCACTTAATTCTTAAACCAAGG + Intergenic
999926823 5:156388060-156388082 CTTACACAGCTCTTAAAGCAAGG - Intronic
1000141881 5:158412806-158412828 CTTGCTTACATCTTAAAACTGGG - Intergenic
1000682771 5:164206694-164206716 CTTAAATAGATCTTTAAACAAGG + Intergenic
1000935767 5:167302171-167302193 ATTACTTAGATCTTGTAGGATGG + Intronic
1002357583 5:178643094-178643116 CTTCTTTACATCTTCAAGCATGG + Intergenic
1002460405 5:179370448-179370470 TTTAATGACATCTTAAAGCAGGG - Intergenic
1008696908 6:54048846-54048868 CTTACTTAGAAATTTCAGCAAGG - Intronic
1008818303 6:55597149-55597171 CTTCCTTAGAACTTAACGTATGG + Intergenic
1009498770 6:64384433-64384455 CTTACTTACATCTGAAAAAAAGG + Intronic
1010595344 6:77756069-77756091 CTGAGTTAGACCTCAAAGCATGG - Intronic
1010763823 6:79755718-79755740 CTTGCTTAGTTATTAAACCAGGG - Intergenic
1012155242 6:95811869-95811891 ATTACTTAGATATCAAACCAGGG - Intergenic
1012357627 6:98335518-98335540 GCTACTTAGATATTTAAGCAGGG - Intergenic
1013194862 6:107836142-107836164 CTAAAATACATCTTAAAGCATGG - Intergenic
1013241145 6:108246938-108246960 CTTAGCTATATCATAAAGCATGG + Intronic
1014614795 6:123586550-123586572 ATTATTTAGATCTTGAAGGATGG + Intronic
1014647138 6:123988011-123988033 GTTACTGGGATTTTAAAGCAAGG + Intronic
1014912639 6:127112694-127112716 CTGACATTGATCTTAAAGCATGG - Intergenic
1015089689 6:129340529-129340551 CTTTCTTATCTCTTAAAGTAGGG + Intronic
1015323710 6:131903123-131903145 ATTATTTAGATCTTGCAGCAAGG - Intergenic
1017315199 6:153023183-153023205 CTTTTATAGATCTCAAAGCAAGG + Intronic
1017348928 6:153417067-153417089 ATTACTTAGATTTAAAAGAATGG + Intergenic
1017581523 6:155869935-155869957 CTTTCTTTTTTCTTAAAGCAAGG + Intergenic
1022060618 7:26790172-26790194 ATTACTTAGGTCTGGAAGCAAGG + Intronic
1022195045 7:28056813-28056835 CTTACTTAGTTCTTAAGTCATGG - Intronic
1023171805 7:37397162-37397184 TTTACTTATATATCAAAGCAAGG + Intronic
1025953936 7:66168159-66168181 CATACTCAGATCAGAAAGCAGGG - Intergenic
1026398854 7:69988440-69988462 CTTACATATATCTGCAAGCATGG + Intronic
1026445591 7:70482005-70482027 CTTAATAAGATCTTATAGCTGGG + Intronic
1026734236 7:72939208-72939230 CATACTGAGATCTTAAATGATGG + Intronic
1026784569 7:73294114-73294136 CATACTGAGATCTTAAATGATGG + Intergenic
1027109501 7:75425814-75425836 CATACTGAGATCTTAAATGATGG - Intronic
1027123151 7:75536724-75536746 CTGACTTGGATCCCAAAGCAAGG - Exonic
1027486314 7:78765975-78765997 CTTTCTAAGATCTGAAAGAAAGG + Intronic
1028247594 7:88499822-88499844 TTTGGTTTGATCTTAAAGCATGG + Intergenic
1028482246 7:91320389-91320411 CTTACTCAGCTCTTTAAGAAGGG - Intergenic
1037371903 8:18189075-18189097 CTTACTGAGATCTCTAAGTAAGG - Intronic
1039774054 8:40718400-40718422 CTTACTTCTATCTTCAAGGATGG - Intronic
1040389376 8:46936482-46936504 CTTACTTAAAAATTAAAGAAAGG - Intergenic
1042417405 8:68538768-68538790 TTAACTTGGATATTAAAGCAAGG + Intronic
1045197395 8:99945308-99945330 ATTACTTAGATCTTGCAGGATGG - Intergenic
1045893596 8:107187104-107187126 GTTACTCAGATCTTCAAGGAGGG - Intergenic
1046380264 8:113440603-113440625 TTAACTTTGATCTTAAAACAGGG + Intergenic
1046386463 8:113513770-113513792 ATTATTTAGATCTTACAGGATGG + Intergenic
1046559150 8:115816042-115816064 ATTATTTAGATCTTATAGGATGG - Intergenic
1050216520 9:3331568-3331590 CTTATATATATCTTAAAGCCTGG + Intronic
1052219866 9:26007085-26007107 CTTACTTAGCTTTTACAGCTAGG - Intergenic
1052819947 9:33130558-33130580 CTAACTTATATCTTAAAATAAGG - Intronic
1054739575 9:68791230-68791252 CTTTCTTTGTCCTTAAAGCAAGG - Intronic
1055575313 9:77655275-77655297 CTTAATACTATCTTAAAGCAGGG + Intergenic
1055809927 9:80138858-80138880 ATTATTTAGATCTTACAGGATGG - Intergenic
1056221740 9:84456540-84456562 TTTCCTTTGATCTTATAGCAAGG - Intergenic
1056411635 9:86334106-86334128 CTTACTTAGATGAGAAAGGAAGG + Intronic
1056704792 9:88942795-88942817 CTAACTCAAATCTTAAAGTATGG - Intergenic
1061641874 9:131964668-131964690 CTTACTTAAACCTTGAACCAAGG + Intronic
1186867289 X:13733462-13733484 CTTAGTTGGATTTTAAAGGATGG - Intronic
1189841905 X:45088645-45088667 ATTTCTTAGATCTTAAGGAAAGG + Intronic
1190361153 X:49649694-49649716 ATTAGTTAGATCTTTAACCATGG - Intergenic
1192917400 X:75667104-75667126 CTTACGTGGTTCTTAAAACAGGG + Intergenic
1193369230 X:80673658-80673680 CACACTAAGATCTTAAAGCTGGG + Exonic
1194660559 X:96625458-96625480 ATTATTTAGATCTTATAGGATGG - Intergenic
1196341095 X:114598586-114598608 CTTACTTGTAACTTAAACCAAGG - Intronic
1196639107 X:118038362-118038384 CTTAATTTGATGTTAAAACAAGG - Intronic
1196699117 X:118646952-118646974 CTTGCCTAGACCTAAAAGCATGG + Intronic
1198391989 X:136185390-136185412 CTTTGTTAGATGTTAAAACAGGG - Intronic
1199263478 X:145803032-145803054 TTTACTTAGATGTTTAAGAAAGG - Intergenic
1200888129 Y:8292692-8292714 CTCACTCAGATAATAAAGCAAGG + Intergenic
1202247183 Y:22832070-22832092 AAAACTTAGATATTAAAGCAGGG + Intergenic
1202400172 Y:24465818-24465840 AAAACTTAGATATTAAAGCAGGG + Intergenic
1202470609 Y:25204268-25204290 AAAACTTAGATATTAAAGCAGGG - Intergenic