ID: 976501856

View in Genome Browser
Species Human (GRCh38)
Location 4:85799760-85799782
Sequence GTGATCAAAGTTAATACTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 6, 3: 26, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976501854_976501856 -1 Left 976501854 4:85799738-85799760 CCTGGCAGCATCACTTAGCCAAG 0: 1
1: 1
2: 0
3: 8
4: 130
Right 976501856 4:85799760-85799782 GTGATCAAAGTTAATACTACTGG 0: 1
1: 0
2: 6
3: 26
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976501856 Original CRISPR GTGATCAAAGTTAATACTAC TGG Intronic
902930885 1:19730711-19730733 GTGAAGACAGTTAATTCTACAGG + Intronic
910523442 1:88150102-88150124 GTTATCAAAATGAATACTTCAGG - Intergenic
912036397 1:105322467-105322489 CTCATCAAAAATAATACTACAGG - Intergenic
915424383 1:155812174-155812196 GTGATGAAAGTTAACATTACAGG + Intronic
918687314 1:187433882-187433904 CTGAACAAAGATAATATTACAGG + Intergenic
920457699 1:206113583-206113605 ATGATGATAGTTGATACTACAGG + Intronic
923931433 1:238703287-238703309 GTGATCAAAATTAACACTACAGG - Intergenic
924792478 1:247265764-247265786 GTGAGCCAAGCTCATACTACTGG - Intergenic
1063634981 10:7773587-7773609 TTGATCAAAGTTAAGACATCTGG + Intronic
1064493233 10:15882567-15882589 GTGATCAAAGTAAACACCATTGG - Intergenic
1065389382 10:25167218-25167240 GTGAACAAAATCAACACTACTGG + Intergenic
1067244094 10:44521928-44521950 GTGATCAAGGTTAACATCACTGG - Intergenic
1069169514 10:65208273-65208295 GTGATCTTAGGTAATAATACTGG - Intergenic
1069217106 10:65834901-65834923 ATAATCAAAGTAAATTCTACAGG + Intergenic
1071239705 10:83692021-83692043 ATGATCAAAGTAAATACCAGTGG - Intergenic
1074174194 10:110979536-110979558 GAGACCAAAGTTAAAACTAGAGG - Intronic
1074322850 10:112419669-112419691 ATGACAAAAGTTAATATTACAGG - Intronic
1074364691 10:112848536-112848558 GTGATCATATTTAATATCACAGG + Intergenic
1076977314 11:184059-184081 GTGATAAAAGTTAACATTAATGG + Intronic
1077388447 11:2287214-2287236 GTGTTCCAAGTTAACACTGCCGG + Intergenic
1078158556 11:8819529-8819551 GTGATCAACGTTAACACCACAGG + Intronic
1080322927 11:31035612-31035634 GTGATCAAAGGTAACATCACTGG - Intronic
1083089475 11:60185282-60185304 GTGAACAAAATTAATACTAGTGG - Intergenic
1086009891 11:82088789-82088811 ATGATCAAAGTTAATATTACAGG + Intergenic
1090599206 11:128352937-128352959 ATAATGAAAGTTATTACTACCGG - Intergenic
1092673701 12:10891837-10891859 GTGATCAAAGTTTTTAAGACTGG - Intronic
1095207745 12:39457643-39457665 GAGATCAAAGTTAATATCATTGG - Intergenic
1096527286 12:52218159-52218181 GCGATCAAAGTTAACATCACCGG - Intergenic
1099589626 12:84570708-84570730 GTGATCAAAGGTAAGAATAAGGG + Intergenic
1104245038 12:127031315-127031337 AAGATCAATGTTAATTCTACAGG + Intergenic
1105235044 13:18543052-18543074 CTGATCAAAGTTCATACCACAGG + Intergenic
1105908429 13:24836414-24836436 GTTATCAAAGTTAAGACGAAAGG + Intronic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1107576437 13:41728215-41728237 GGGATCACAGTTAAAACTATTGG - Intronic
1108251652 13:48573713-48573735 GAAATAAAAGTTAATATTACTGG - Intergenic
1109192630 13:59344011-59344033 GTGATCAAAGTTATGATGACTGG - Intergenic
1111219246 13:85182018-85182040 GTGATCAAAGTTAACATCACTGG + Intergenic
1113351316 13:109532017-109532039 GTAACCTAAGTTAATACTCCTGG - Intergenic
1117224153 14:53637768-53637790 GTGACCACAGTTAATAATAATGG + Intergenic
1118844276 14:69534918-69534940 GTGAACATATTTAACACTACTGG - Intergenic
1121418561 14:93796213-93796235 TTGATCAAAGTTCATCCCACAGG - Intergenic
1125430286 15:39587021-39587043 GTGACCATAGTTAATAATACTGG + Intronic
1126296813 15:47148194-47148216 GTGAACAAAGTTAATAAAATGGG + Intergenic
1128786464 15:70401045-70401067 GAAATCAAAGTTAATCCTGCAGG - Intergenic
1130373147 15:83304716-83304738 GTGAATACAGTTAACACTACTGG + Intergenic
1130637654 15:85640409-85640431 GTTTTTAAATTTAATACTACTGG - Intronic
1130930648 15:88424629-88424651 GTGATAAAAGTTAATAGAAGGGG + Intergenic
1131959088 15:97769392-97769414 GTGATCAAAGTTAACATCATTGG + Intergenic
1142442940 16:90112623-90112645 GTGATAAAAGTTAACATTAATGG - Intergenic
1142464765 17:128769-128791 GTGATAAAAGTTAACATTAATGG + Intergenic
1144450325 17:15371993-15372015 GTGATCATACTGAATACTGCAGG + Intergenic
1148171286 17:45522571-45522593 GTGATCAAACTTAGTATTACAGG + Intergenic
1148278391 17:46327230-46327252 GTGATCAAACTTAGTATTACAGG - Intronic
1148300600 17:46545085-46545107 GTGATCAAACTTAGTATTACAGG - Intronic
1148364734 17:47045980-47046002 GTGATCAAACTTAGTATTACAGG - Intronic
1150401906 17:64864171-64864193 GTGATCAAACTTAGTATTACAGG + Intronic
1152513453 17:80805889-80805911 GTAAGCAGAGTTAATATTACAGG - Intronic
1154514502 18:15146954-15146976 CTGATCAAAGTTCATACCACAGG - Intergenic
1156222995 18:35072788-35072810 GTGATCAAAATTGCTTCTACAGG - Intronic
1156616468 18:38791591-38791613 GTTATCAATTTTAATACTATCGG + Intergenic
1160655388 19:264608-264630 GTGATCACAGTTAATACCAATGG + Intergenic
1165605303 19:37098073-37098095 GTGATCCTAGTTGAGACTACAGG + Intronic
1166600134 19:44086434-44086456 CTGACCAAAGCTATTACTACAGG - Exonic
924997200 2:373040-373062 ATGAACAAAGTTAATACGGCAGG - Intergenic
929216443 2:39418593-39418615 GTGATCAAAGTTAACATTGCCGG + Intronic
929216445 2:39418615-39418637 GTGATCAAAGTTAACACTGCCGG + Intronic
931260908 2:60618271-60618293 GTGATCATACTGAATACTGCAGG - Intergenic
934905450 2:98197313-98197335 ATGATCAAAGTAAACACTGCTGG - Intronic
935366208 2:102293552-102293574 TTCATCAAAGTTATTGCTACTGG - Intergenic
938514747 2:131991580-131991602 CTGATCAAAGTTCATACCACAGG - Intergenic
940055725 2:149510864-149510886 GTGATCAAAGTTAAAACCACTGG - Intergenic
1169267627 20:4176276-4176298 GTGATCAAAGTTTCTACAAGAGG - Intronic
1172383328 20:34515099-34515121 CAGATCAAAGTTAGTATTACTGG - Intergenic
1173459111 20:43228311-43228333 GTGATCAAGTTTAATATCACAGG - Intergenic
1174371375 20:50090732-50090754 GTGACTACAGTTAATAATACTGG + Intronic
1175733306 20:61368870-61368892 GTAATCAAAATTAATATCACTGG + Intronic
1176779035 21:13171331-13171353 CTGATCAAAGTTCATACCACAGG + Intergenic
1177976676 21:27860356-27860378 CTGATCAAAGTTCATACCACAGG + Intergenic
952073178 3:29664186-29664208 TTGATAAAAGTTAATCTTACTGG + Intronic
957149756 3:76470854-76470876 GGGGTCAAAGGTAAGACTACAGG - Intronic
957388044 3:79522503-79522525 GTGATCAAAGTGATGAATACAGG - Intronic
958818235 3:98941976-98941998 GAGTTCAAAGTTCATAGTACAGG - Intergenic
962468054 3:135678820-135678842 GTGCTCAGAGTTTATTCTACGGG + Intergenic
963635532 3:147790636-147790658 GTGGTGAAAGTAAATTCTACTGG - Intergenic
963654963 3:148036015-148036037 CTGATCAAATTTAATTTTACTGG + Intergenic
967303424 3:188038624-188038646 ATAATAAAAGTTAAAACTACAGG - Intergenic
968363212 3:198163583-198163605 GTGATAAAAGTTAACATTAATGG - Intergenic
973658786 4:53080435-53080457 GTCTTCAATGTTTATACTACAGG - Intronic
974058339 4:57007103-57007125 TTGGTCAAAGGTAAAACTACTGG + Intronic
974351989 4:60760347-60760369 GTGATCAAAATTAACACCAACGG + Intergenic
974831450 4:67194517-67194539 GAGAACAAAGTTAATACTGAGGG + Intergenic
976501856 4:85799760-85799782 GTGATCAAAGTTAATACTACTGG + Intronic
984143201 4:176028788-176028810 GTGATCAAAGTTAATATCACTGG + Intergenic
986987993 5:13520885-13520907 GTGATCAAGGTTAACATCACCGG - Intergenic
987290885 5:16506832-16506854 GTTATCAAAATTAAAACTACAGG + Intronic
987667569 5:20964655-20964677 ATGTTCAAATTTAATACTAATGG - Intergenic
988333641 5:29876236-29876258 GTAATCATGGGTAATACTACAGG + Intergenic
991332568 5:65508066-65508088 GTGGTCAAGGTTAATATCACAGG - Intergenic
991374355 5:65950525-65950547 GTGATCAAAGTTCAAATCACTGG - Intronic
992745662 5:79817842-79817864 GTTATCAAAGTCAATTCTATTGG - Intergenic
995363138 5:111321983-111322005 GTGATAAAAATTAAGACTATGGG + Intronic
996423908 5:123292152-123292174 GTGACTATAGTTAATAATACCGG - Intergenic
996672208 5:126131614-126131636 GTGAGAAAAGGTAATATTACAGG + Intergenic
1002347944 5:178561116-178561138 CAGATCAAAGTTAATGCTCCAGG + Intronic
1005345594 6:24886721-24886743 CTGATCAAAGTTAACATCACCGG - Intronic
1005725583 6:28644484-28644506 GTGACCAAAATTAATACCACTGG + Intergenic
1007940961 6:45781101-45781123 GTGATCAAAGTGAATTCAACTGG - Intergenic
1008116848 6:47561048-47561070 GTTATCAAAATAAATAATACTGG - Intronic
1009578707 6:65502904-65502926 GTGATCAAGGTTAACATTAATGG - Intronic
1011003847 6:82622080-82622102 GTGATCAAAGTTAATATCAATGG + Intergenic
1012777827 6:103521034-103521056 CTGATCAAAGATAGTACTACTGG + Intergenic
1013879960 6:114885564-114885586 GTGATCAAAGTTAACATCCCAGG + Intergenic
1017576825 6:155814686-155814708 GAGAACAAAGATAATACTACAGG + Intergenic
1019252468 7:25128-25150 GTGATAAAAGTTAACATTAATGG + Intergenic
1021995223 7:26173140-26173162 ATGATCAAAATTCACACTACAGG - Intronic
1028436078 7:90806163-90806185 GAGATAAAAGTTAAAACTTCTGG + Intronic
1028687555 7:93608839-93608861 GTTATCAAAGTTAACAGTAAGGG + Intronic
1030401853 7:109061486-109061508 GTAATCAAAGATAATAATAAAGG + Intergenic
1033274393 7:139960160-139960182 GTGCTCAAGGTTAAGACTATGGG - Intronic
1036156337 8:6345916-6345938 GTTATAAAAGTTAATACAAAAGG + Intergenic
1040909750 8:52505839-52505861 GTGATGAAGGTTAACATTACTGG + Intergenic
1041168620 8:55117085-55117107 ATGATAAAAGTTAATTTTACTGG + Intronic
1042327537 8:67544195-67544217 CTGATTAAAGTTAATTCTCCTGG - Intronic
1042969418 8:74391686-74391708 ATGGTCAAAGTTAATATTACTGG + Intronic
1044647747 8:94462208-94462230 GTGATCAAAGTTAATACCTCTGG - Intronic
1045378217 8:101597219-101597241 GTGATAAAAATTCATACTCCTGG - Intronic
1045825786 8:106396322-106396344 GTGATCAAAGTTAACGTTGCTGG + Intronic
1046259840 8:111753230-111753252 ATGATCAAATTTAATATTATAGG + Intergenic
1047467355 8:125130292-125130314 GTGATCAAGGTTGACATTACTGG - Intronic
1052181590 9:25535092-25535114 GTGATCAAAGTTAAAAAACCTGG - Intergenic
1057735824 9:97658928-97658950 GTGATAAAATTAATTACTACTGG + Intronic
1060900446 9:127252963-127252985 GTGAACAAAGAAAATACTATGGG - Intronic
1062747899 9:138227243-138227265 GTGATAAAAGTTAACATTAATGG - Intergenic
1185891257 X:3824233-3824255 ATGATCAGAGTTAATACCTCAGG - Intronic
1185896364 X:3862649-3862671 ATGATCAGAGTTAATACCTCAGG - Intergenic
1185901482 X:3901075-3901097 ATGATCAGAGTTAATACCTCAGG - Intergenic
1187604339 X:20867450-20867472 GTAATTAAATTTAATACTACTGG - Intergenic
1188438313 X:30188326-30188348 ATGATCCAAGTTGATACTAGAGG - Intergenic
1189271264 X:39753696-39753718 GTGATCAATGTTAACATTACCGG + Intergenic
1196222424 X:113126768-113126790 GTGAACAAAGGTAATACTTGGGG - Intergenic
1196971345 X:121112167-121112189 GTGAATATAATTAATACTACTGG - Intergenic
1200392869 X:155961984-155962006 GTGATCAAAATTAACATTAATGG - Intergenic