ID: 976502336

View in Genome Browser
Species Human (GRCh38)
Location 4:85806049-85806071
Sequence ATGAAGCAGCTGAATGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976502336_976502341 4 Left 976502336 4:85806049-85806071 CCTACCCCATTCAGCTGCTTCAT 0: 1
1: 0
2: 1
3: 16
4: 245
Right 976502341 4:85806076-85806098 CCAGATTTTCAAAGCTTTTCAGG 0: 1
1: 0
2: 2
3: 29
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976502336 Original CRISPR ATGAAGCAGCTGAATGGGGT AGG (reversed) Intronic
900626397 1:3610683-3610705 ATGGGGGAGCTGAATGGAGTTGG - Intronic
902601928 1:17545821-17545843 GTGTAGCAGGGGAATGGGGTAGG + Intronic
902808717 1:18876301-18876323 ATGAAGGAGGTGACTGGGGTGGG - Exonic
903528525 1:24011810-24011832 ATGACACGGCTGAATGGGGCAGG - Intergenic
903737349 1:25538517-25538539 AAGAAGCAGCTGCATGGGAAGGG + Intergenic
904904109 1:33881607-33881629 ATGAAGGAGCTGAGTTGGGATGG + Intronic
905847698 1:41246505-41246527 AAGGAGCAGCTGAAAGGAGTTGG + Intergenic
906557082 1:46722368-46722390 ATGAAGCAGAAGACTGGGCTAGG - Intergenic
907201047 1:52726845-52726867 CCGAAGCAGGTGAATGGGGAAGG - Intronic
909696832 1:78476888-78476910 ATGAAGCAGCTGGATAGATTAGG + Intronic
910028668 1:82689244-82689266 AGGAAGCAGCGGTATGGGGCTGG - Intergenic
910300271 1:85698365-85698387 TTGTAGCAGCTGACTGGGATAGG - Intronic
910424689 1:87109004-87109026 ATGAATCAACTGAATGGAGTGGG - Exonic
911270028 1:95790070-95790092 ATGAAGTAGGTGAAGGGGATGGG + Intergenic
911546305 1:99221859-99221881 ATGAAGCAGGTTAAGTGGGTAGG + Intergenic
912453651 1:109783561-109783583 GTGAAGGTGATGAATGGGGTTGG + Intergenic
915089963 1:153417373-153417395 CTTAAGCTGCTGGATGGGGTGGG - Intronic
915092912 1:153439032-153439054 CTTAAGCTGCTGGATGGGGTGGG + Intronic
915205938 1:154270416-154270438 ATGAAGCTGAGGCATGGGGTGGG - Exonic
916808545 1:168284129-168284151 ATGAAGTAGTAGAATGGGGGAGG - Intronic
917545507 1:175962581-175962603 ATGAATCAGCTGCCAGGGGTGGG - Intronic
918800334 1:188962191-188962213 AAGAAGAAGCTGAATGGATTTGG - Intergenic
919146107 1:193637472-193637494 ATGAAGAAGATGAATGGTTTGGG - Intergenic
920590833 1:207217026-207217048 ATGAAGCAGCCAAATAGGGAGGG + Intergenic
921933462 1:220774575-220774597 ATTAAGCAGATGAAGGGGCTGGG + Intronic
921945796 1:220885134-220885156 ATGCAGCAGCTGAAGGTGGTGGG + Intergenic
922248564 1:223825055-223825077 ATAAAGCAGAAGAATGGGCTAGG - Intronic
922681705 1:227603631-227603653 ATGAAGCAGCAGAAGGGGGCTGG - Intronic
923865242 1:237932554-237932576 AGGAAGTATCTGAATGGGGAGGG - Intergenic
1062918132 10:1257544-1257566 ATGAAGCTGCTGCAGGGGCTGGG + Intronic
1065655954 10:27950045-27950067 ATGGAGAAGCTGTGTGGGGTAGG - Intronic
1065786919 10:29224483-29224505 AGGAAGTAGCTAAATGGGGAGGG + Intergenic
1066482435 10:35809955-35809977 AGAAAGCAGCAGAATGGTGTAGG - Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1071195976 10:83160274-83160296 TTGAAGCATCTGACAGGGGTGGG + Intergenic
1073645129 10:105293838-105293860 ATGAAGAAGCTGGATATGGTAGG - Intergenic
1075627597 10:123973737-123973759 CTGAAGGAGCTGGATGGGGCTGG - Intergenic
1075809232 10:125212590-125212612 ATGAAGCTTCTCCATGGGGTAGG + Intergenic
1076399769 10:130174328-130174350 AAGAAGCAGCAGCCTGGGGTGGG + Intronic
1077164624 11:1129508-1129530 CTGCAGCAGCTGGACGGGGTCGG - Intergenic
1077470975 11:2760333-2760355 ATGAACCAGCGGATGGGGGTGGG + Intronic
1077694125 11:4378199-4378221 CCCAAGAAGCTGAATGGGGTTGG - Intergenic
1079394523 11:20050309-20050331 AAGAGGCAGCTGCATGGGGAGGG - Intronic
1080381938 11:31780957-31780979 ATGAAAAAGCTTTATGGGGTAGG - Intronic
1082635180 11:55585598-55585620 AGGAGGCATCTGAAAGGGGTTGG - Intergenic
1082767067 11:57178788-57178810 ATGAAGCAGCTCCATGAGGGAGG + Intergenic
1083648398 11:64186262-64186284 ATGGAGCAGGTGAAGGGGGAGGG + Intronic
1083837188 11:65278585-65278607 TTGAATCAGTTTAATGGGGTTGG - Intronic
1084554433 11:69867530-69867552 ATGGAGCATCAGAATGGGGAAGG - Intergenic
1084941491 11:72615601-72615623 ATGAAGCAGCTGAAGGTGGGAGG - Intronic
1085011805 11:73146536-73146558 AGGAAGGAGATGAATGGGGATGG - Intergenic
1086458502 11:86982910-86982932 ATGAAGCAGCTAAAGGGATTAGG + Intergenic
1087007787 11:93486296-93486318 TGGAAGCAGCTGCTTGGGGTGGG - Intronic
1087025358 11:93644158-93644180 ATGAAGTTGCTGTATGTGGTAGG - Intergenic
1088405488 11:109471362-109471384 ATGATGGGGCTGAATGGGGTAGG + Intergenic
1089084447 11:115805264-115805286 ATGTAGCTGCAGAATGGAGTAGG - Intergenic
1091412975 12:256375-256397 ATGAAGCAGGTGCCTGGGGGTGG + Intronic
1091918943 12:4289196-4289218 AGCAAGCAGATGAAGGGGGTGGG + Intronic
1092835832 12:12487162-12487184 CTGATGCAGCAGAATGGGATTGG - Exonic
1093788362 12:23217867-23217889 ATGAGGCAGCTATATGGGGGAGG - Intergenic
1094106537 12:26817835-26817857 TTCAAACAGTTGAATGGGGTAGG + Intronic
1094604731 12:31940462-31940484 ATGAAGCTGCTGCTTGGTGTTGG + Intergenic
1096537525 12:52284886-52284908 ATGAAGGAGCTGAATGGCCCTGG + Intronic
1096866227 12:54565214-54565236 ATGAAGCAGAAGGCTGGGGTGGG + Intronic
1098271312 12:68772928-68772950 AAGAAGCAGGTCAAGGGGGTGGG + Exonic
1099215402 12:79846970-79846992 ATGAAGGAGCTAAATTGGTTAGG - Intronic
1101762923 12:107673885-107673907 ATGACACAGCCGAATGGGATTGG - Intergenic
1104347077 12:128009875-128009897 AAGAAGCAGCTAAATTGTGTGGG + Intergenic
1106202294 13:27549544-27549566 ATGAAATAGCTGAAAGTGGTTGG - Intronic
1108717875 13:53099770-53099792 ATGAAGCAGTTGAGAGGGGAAGG - Intergenic
1109730895 13:66412311-66412333 ATTAATCAGCTGGATGTGGTGGG - Intronic
1110131264 13:72014357-72014379 ATGAAGCAGCTGAAATCTGTAGG + Intergenic
1110669969 13:78166289-78166311 ATAAATTAGCTGAATGTGGTGGG - Intergenic
1115557395 14:34554306-34554328 TTGAAGCAGGTGAAGGGAGTTGG + Intergenic
1115841624 14:37477724-37477746 ATATTGCAGCTGAATGGGCTGGG - Intronic
1115852021 14:37596192-37596214 CTGAAGCGGCTGAAGGGGGGCGG - Intronic
1115962524 14:38851767-38851789 ATGAAGCAGGGGGGTGGGGTGGG - Intergenic
1119489064 14:75014364-75014386 ATGAAGCTGGAGAATGGGGAGGG - Exonic
1120388408 14:83874945-83874967 ATGAAGCAGCTGAAAAGTGAGGG - Intergenic
1121554406 14:94825367-94825389 ATGGGGAAGATGAATGGGGTGGG + Intergenic
1122439707 14:101722320-101722342 ATGAGTCAGCTTGATGGGGTGGG - Intergenic
1122577126 14:102749611-102749633 GAGAAGCAGCTGAAGGGGCTGGG - Intergenic
1124911805 15:33928570-33928592 AAGACGCAACTGAATGGGGGAGG + Intronic
1125444187 15:39736256-39736278 ATGAAGTAGGGGAAAGGGGTGGG - Intronic
1128092660 15:64929552-64929574 GAGAAGCAGCTGCATGGGGCAGG - Intronic
1129651164 15:77491082-77491104 ATAAAGCAGCTGAATGTTCTAGG + Intergenic
1129740059 15:77985797-77985819 ATGAGGCAGGTGAAGGGCGTGGG - Intronic
1132184724 15:99792985-99793007 ATGAAGTAAATGAATTGGGTAGG - Intergenic
1132794017 16:1709653-1709675 AAACAGCAGCTGAACGGGGTGGG + Intronic
1132861037 16:2071926-2071948 TTGAAGCAGGTGAGTGGGGCCGG + Exonic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1137290704 16:47050259-47050281 GAGAAGGAGCTGACTGGGGTGGG - Intergenic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1140267671 16:73434435-73434457 ATGAAGCAGATAACTGGGGCAGG - Intergenic
1141140081 16:81491612-81491634 ATACACCAGCTGAATGGGTTTGG + Intronic
1142482916 17:229643-229665 AAAAAACAGCTGAATGGGGAGGG + Intronic
1146931874 17:36783350-36783372 ATGAAGCAGCTGACTAGGTCCGG - Intergenic
1147710426 17:42459338-42459360 ATGAAGCAGGTGAATACCGTGGG + Intronic
1148329307 17:46803880-46803902 ATGGCGCAGCTGAAGAGGGTGGG + Intronic
1149192975 17:54086046-54086068 ATGCTGCAGCTGGATGGGGGAGG + Intergenic
1151201443 17:72470658-72470680 ATGGTGCAGCTGAAGGGGGCCGG - Intergenic
1152139616 17:78528815-78528837 ATTAGGCAGCTGAAGGGGGCGGG - Intronic
1153440311 18:5110459-5110481 AAGAAGCAGGAGGATGGGGTGGG + Intergenic
1153464748 18:5376903-5376925 ATGAAACAGCAGACTTGGGTTGG + Intergenic
1155098673 18:22586477-22586499 AAGAAGCATCTGAAGTGGGTAGG + Intergenic
1158971753 18:62674631-62674653 ATGAAGGAGCTGAAGGAGATGGG - Intergenic
1159374161 18:67570400-67570422 ATGAAGAAGATTAATGAGGTTGG + Intergenic
1160815913 19:1035625-1035647 ATGAAGCAGCCCCATGGGCTGGG + Intronic
1162145740 19:8611266-8611288 AGGAAGGGGCTGAGTGGGGTGGG + Intergenic
1162454315 19:10773761-10773783 AAAAAGTAGCTGAATGGGCTGGG - Intronic
1162567545 19:11452763-11452785 ATGGGGCCGCTGAGTGGGGTGGG + Exonic
1164710978 19:30357135-30357157 ATGAAGCAGGAGAATGGGTGGGG + Intronic
1165834214 19:38744375-38744397 AGGTAGCAGCTTAATGGGCTTGG + Exonic
1166837902 19:45678310-45678332 GTGCAGCCACTGAATGGGGTGGG + Intronic
1167213062 19:48145653-48145675 ATGAGGCAGCAGAGTGTGGTGGG + Intronic
1168566430 19:57428161-57428183 ATGTTGCAGCTGTATGAGGTGGG + Intronic
924995621 2:357991-358013 AGGAAGCAGCTCAGTGGGGATGG - Intergenic
925354664 2:3230384-3230406 ACGCTGCAGCTGAAGGGGGTGGG + Intronic
927056882 2:19373556-19373578 ATGCAGCAGCTCACAGGGGTTGG + Intergenic
928639976 2:33288229-33288251 ATGTAGCAGCTGCTTGGGGTTGG - Intronic
929547083 2:42862815-42862837 AGGCAGCAGCTCAGTGGGGTTGG + Intergenic
933595186 2:84276282-84276304 ATGAACCATTTGAATGTGGTAGG + Intergenic
933785227 2:85834802-85834824 ATGAAGCATTTGAATGGAATTGG - Intergenic
934153522 2:89172957-89172979 ATGAGGGAGGAGAATGGGGTGGG - Intergenic
934153949 2:89177042-89177064 ATGAGGGAGGAGAATGGGGTGGG - Intergenic
934155567 2:89196742-89196764 ATGAGGGAGGAGAATGGGGTGGG - Intergenic
934166279 2:89297206-89297228 AGGAAGCAGATGTATGGGGCTGG - Intergenic
934200997 2:89885250-89885272 AGGAAGCAGATGTATGGGGCTGG + Intergenic
934211757 2:89986017-89986039 ATGAGGGAGGAGAATGGGGTGGG + Intergenic
934213285 2:90004893-90004915 ATGAGGGAGGAGAATGGGGTGGG + Intergenic
934213714 2:90008975-90008997 ATGAGGGAGGAGAATGGGGTGGG + Intergenic
934789439 2:97046217-97046239 ATGAGGGAGGAGAATGGGGTGGG + Intergenic
934817033 2:97336323-97336345 ATGAGGGAGGAGAATGGGGTGGG - Intergenic
934820663 2:97372161-97372183 ATGAGGGAGGAGAATGGGGTGGG + Intergenic
934939445 2:98489871-98489893 ATCTTGCAGCTGCATGGGGTGGG - Intronic
936679275 2:114752056-114752078 ATGAGGCAGTTGTCTGGGGTGGG + Intronic
937278699 2:120702841-120702863 AGGAAGGAGCAGAATGAGGTCGG - Intergenic
937449621 2:121991475-121991497 ATGAAGCAGCTCAGTGAGATGGG + Intergenic
939200842 2:139031760-139031782 GTGCAGCAGCTGACTGGGGGAGG + Intergenic
942579026 2:177396459-177396481 ATGAAGCAGCTGAAGGGGCTTGG + Intronic
942941599 2:181625114-181625136 AAAAAGCAGCCCAATGGGGTAGG + Intronic
943621711 2:190155522-190155544 TAGAGGAAGCTGAATGGGGTGGG + Intronic
944651953 2:201839244-201839266 ATGAAGAAGATGAATAGGCTGGG - Intronic
945159702 2:206876917-206876939 AGAAAGCAGCTGAATTGGGCTGG + Intergenic
946106606 2:217375857-217375879 ATGCAGCAGATGACTGGGTTGGG - Intronic
947682772 2:232050888-232050910 ATGAAGGAGGTGTATGGAGTGGG + Intronic
1168877371 20:1180918-1180940 ATGAGACAGCTCAATGGGGATGG - Exonic
1169756709 20:9050643-9050665 ATGATGAAGCTGAGTGAGGTAGG - Intergenic
1171193147 20:23175454-23175476 ATGAAGCAGCTGCATTGTCTGGG + Intergenic
1173186207 20:40842524-40842546 ATGAAACAGCAGGAAGGGGTGGG - Intergenic
1173222970 20:41144525-41144547 ATGTAGCCGCTGATTGGGGGTGG + Intronic
1173888222 20:46480432-46480454 ATGAGGCAGCTGCATGGAGGAGG - Intergenic
1174171110 20:48618749-48618771 CTGAAGGAGCTGAAGGGGGAAGG - Intergenic
1175458926 20:59136236-59136258 ATGAAGCAGCAGCAGAGGGTAGG - Intergenic
1178337441 21:31756029-31756051 ACGAAGCAGCTCAATGGGAGGGG - Intergenic
1178961565 21:37071387-37071409 ATGAAACAGTTCTATGGGGTAGG - Intronic
1179592271 21:42416637-42416659 AAGAAGCAGATGAATGGGCTGGG + Intronic
1182863692 22:33583593-33583615 AAGATGGAGCTGAATGGGATAGG - Intronic
1184241975 22:43215838-43215860 TTGCTGGAGCTGAATGGGGTGGG + Intronic
952957160 3:38564570-38564592 ATGAAGCATGCGGATGGGGTAGG + Intronic
955006009 3:54969558-54969580 ATGAAACAACTGAGCGGGGTGGG - Intronic
956496341 3:69830595-69830617 ATGAAGCATCGGGATGGGGAGGG - Intronic
959531818 3:107441776-107441798 ACTAAGCAGCTGAATGTGGCTGG - Intergenic
961263183 3:125618933-125618955 ATGAAGCAGGTGAAGAAGGTGGG + Intergenic
962130975 3:132675663-132675685 ATGAAGATAATGAATGGGGTAGG + Exonic
962404988 3:135092950-135092972 AGCAAGCAGCTAAATGGGGGTGG - Intronic
963672796 3:148272713-148272735 AGGAAGGAGCTGGAAGGGGTTGG + Intergenic
965612022 3:170554560-170554582 CTGAAGCAGGTGAATGCTGTGGG - Intronic
965692977 3:171377376-171377398 GTGAAGCAGCTGAGCGGGGAGGG - Intronic
970291226 4:14574754-14574776 CTGAAGCAGTTGGATAGGGTTGG + Intergenic
971375348 4:26051561-26051583 GTGCAGCAGCTGAGTGGGGCTGG + Intergenic
975145376 4:70961744-70961766 ATGAAGTAGGTGAATAGGGTTGG + Intronic
976502336 4:85806049-85806071 ATGAAGCAGCTGAATGGGGTAGG - Intronic
979308730 4:119177309-119177331 TTTAAGCAGCTGAATGTGGCTGG + Intronic
980465972 4:133182199-133182221 ATGAAAATGCTGAATGGGATTGG - Intronic
983706201 4:170662642-170662664 ATGAAGCAGCTGCATTGTCTGGG - Intergenic
983734851 4:171044075-171044097 ACGAATCAGCAGGATGGGGTGGG + Intergenic
983930580 4:173449167-173449189 GGGAAGCAGCTGAAAGAGGTGGG + Intergenic
987328967 5:16838188-16838210 ATGACGCAGCTGAGTGAGGAAGG + Intronic
988484161 5:31654617-31654639 ATGAAGCATCTGGAAGGGGCAGG - Intronic
990136756 5:52654496-52654518 TTGGATCTGCTGAATGGGGTTGG + Intergenic
990258623 5:53997660-53997682 ATGAAGGAGGTGAATGGGGAAGG + Intronic
990749176 5:58994341-58994363 AAGAAACAGCTGATGGGGGTGGG - Intronic
991178820 5:63724404-63724426 ATTAGGCAGCTGAATGGATTTGG + Intergenic
991985264 5:72278559-72278581 ATGAAGAAGCAGGATGGGGTTGG - Intronic
992638190 5:78745872-78745894 ACAAAGCAGCTGAGTGGGTTGGG - Intronic
993968830 5:94391530-94391552 ATCATGCAGCTCAATGAGGTAGG - Intronic
994482171 5:100351092-100351114 AGGAAGCAGCCCAATAGGGTAGG - Intergenic
995271089 5:110220312-110220334 ATGAAGAAGCTGCATGGTGCAGG + Intergenic
996314542 5:122147182-122147204 TGGAGGCTGCTGAATGGGGTGGG + Intronic
997352667 5:133242177-133242199 CTGAAACAGCTGCATGGGGCTGG + Intronic
997476755 5:134146903-134146925 ATGAAGTGTCTGAATGGGGAGGG - Exonic
999001904 5:147932836-147932858 TTGAAGCAGCTTTATGTGGTAGG - Intergenic
999528054 5:152430157-152430179 CTCAAGCAGCTGAATGAGGCTGG - Intronic
999659125 5:153840466-153840488 AGGAAGGAACTGGATGGGGTTGG - Intergenic
1000870839 5:166575130-166575152 ATTAAAAAGCTGAATGGGGAGGG + Intergenic
1001400730 5:171444997-171445019 ATGGAGCAGGGGAATGGGGTAGG + Intronic
1002496121 5:179612800-179612822 ATGAAGGAGCCAAATGGAGTTGG - Intergenic
1002902948 6:1425033-1425055 ATGTTGCAGCTGAAGGGGGCTGG - Intergenic
1003946459 6:11080530-11080552 ATGAAGCTCCTGAATGGAGCTGG - Intergenic
1004179103 6:13365503-13365525 ATGAAGCAGCTGATCGAGGAGGG - Exonic
1004405330 6:15327758-15327780 AAGAAGCAGATGAATGGGCTTGG + Intronic
1006302127 6:33199318-33199340 ATGGAGCTGTTGAAGGGGGTAGG + Exonic
1009500296 6:64404667-64404689 ATCAAGATGCTTAATGGGGTTGG + Intronic
1009813923 6:68706285-68706307 ATGATGGAGCTGGCTGGGGTGGG + Intronic
1012218072 6:96613311-96613333 ATGAAGCAGTTCAATGTGATGGG - Intronic
1015330180 6:131968772-131968794 AGGAAGCAGCTGTTGGGGGTTGG + Intergenic
1017018959 6:150124908-150124930 ATGAAACAGCACAATCGGGTGGG - Intergenic
1017212335 6:151870810-151870832 AGGAAGCATCTACATGGGGTGGG - Intronic
1017831879 6:158137941-158137963 ATGAGGCACCTGAAATGGGTAGG + Intronic
1018207015 6:161445618-161445640 GTGCTGCAGCTGAATGGGATCGG + Intronic
1020361928 7:7336038-7336060 TTTAAGCAGCTGAATGTGGTTGG + Intergenic
1021262511 7:18475617-18475639 ATTATGCAGCTGCATGGGCTGGG - Intronic
1022233389 7:28436995-28437017 AAGAAGCAGCTGAATGTCTTTGG + Intronic
1026975521 7:74495457-74495479 ATGAAGAAGGTGAATGGTGAGGG - Intronic
1027648984 7:80841025-80841047 ATCAAGAAGCGGAATGGAGTGGG + Intronic
1028311331 7:89340991-89341013 AAGCAGCAGCTGAATGGGTTAGG + Intergenic
1029859913 7:103559493-103559515 ATGAAGAAGATGCATGGGTTAGG - Intronic
1031103531 7:117511592-117511614 AAGAAGCAGCTGAAATGTGTAGG + Intronic
1031620012 7:123924458-123924480 ATGAGGCAGGAGAATAGGGTTGG - Intergenic
1032154886 7:129459572-129459594 CTAAAGCAGGTGACTGGGGTGGG + Exonic
1033658869 7:143390494-143390516 AAGATGGAGCTGGATGGGGTGGG + Intronic
1034001952 7:147424113-147424135 ATGGAGCAGCGGAATGAAGTAGG - Intronic
1034005969 7:147472614-147472636 AAGAAGCTGCAAAATGGGGTGGG + Intronic
1035105855 7:156441066-156441088 ATGAAGCAGGAGAATGGGTCTGG - Intergenic
1035396037 7:158535312-158535334 TTCACGCAGCTGAATGGGGAGGG - Intronic
1036036783 8:5028701-5028723 ATGAAGCAACCAAATGAGGTGGG - Intergenic
1036577456 8:10041252-10041274 ATGATGCAGCTGTAAGTGGTAGG - Intergenic
1039805446 8:40993887-40993909 AAGGAGCACCTGAATGGCGTGGG - Intergenic
1044147299 8:88732949-88732971 GTGATGCTGCTGAAGGGGGTTGG + Intergenic
1044631401 8:94282336-94282358 ATTAAGCAGCTGGATGGTCTTGG + Intergenic
1044941767 8:97350807-97350829 CTGAAGCAGCTGAACGAAGTAGG + Intergenic
1045323268 8:101097943-101097965 AGGAAGGAGCTGAGTGGCGTGGG + Intergenic
1045406124 8:101868371-101868393 CTGAAGCAGGAGAATAGGGTCGG + Intronic
1045640174 8:104241102-104241124 TAGAAGCAGCTTAGTGGGGTGGG - Intronic
1046044647 8:108949041-108949063 ATGAGTCTGCTGATTGGGGTTGG + Intergenic
1046530373 8:115437680-115437702 ATGAAGTAGCTAAATAGGATTGG + Intronic
1046962668 8:120126483-120126505 TGGCAGCAGCTGAAGGGGGTGGG + Intronic
1048563380 8:135567090-135567112 CTATAGCAGCTGAGTGGGGTTGG + Intronic
1048982090 8:139708029-139708051 ATGCTGCAGCTGAATGAGTTTGG - Intergenic
1051120420 9:13746363-13746385 AGGAAGCAGCTGATTGGGCAAGG - Intergenic
1052369341 9:27646022-27646044 ATGAACCAGATGAATAGGGCCGG + Intergenic
1052957348 9:34263636-34263658 ATAAACTATCTGAATGGGGTAGG + Intronic
1054745186 9:68847007-68847029 ATGAAGCTTCTTATTGGGGTAGG - Intronic
1055018387 9:71643711-71643733 TTTGAGCACCTGAATGGGGTTGG - Intergenic
1055326111 9:75131806-75131828 ATGAAGCAGCAAAAAGAGGTAGG + Exonic
1056028225 9:82523745-82523767 ATCAAGCAGGCTAATGGGGTAGG + Intergenic
1057050439 9:91919713-91919735 ATGAAGGAGCAGAGTGGGCTGGG - Intronic
1058300130 9:103361241-103361263 ATGATGCAGCTGGCTGGGATTGG - Intergenic
1058906727 9:109488054-109488076 TTTAAGCAGCTGTGTGGGGTCGG + Intronic
1059349936 9:113657189-113657211 ATCAAGCAGCAGCAAGGGGTGGG - Intergenic
1059740630 9:117146140-117146162 ATAGAGCTGCTGAATGGGGTCGG - Intronic
1060316486 9:122516259-122516281 ATCAAGAGGCTGAATGTGGTGGG + Intergenic
1203361215 Un_KI270442v1:220423-220445 ATGGAGCAGCTCAGTGCGGTGGG + Intergenic
1188621240 X:32226725-32226747 CTGAAAAAGCTGAATGAGGTAGG - Intronic
1189296025 X:39918432-39918454 AGGAAGAAACTGAAAGGGGTTGG + Intergenic
1189741256 X:44119245-44119267 ATCAAGCAGGTGAATGAGATAGG - Intergenic
1190598527 X:52068216-52068238 GTGAAGCAGCTGCAGGGGGAGGG + Exonic
1190610297 X:52185857-52185879 GTGAAGCAGCTGCAGGGGGAGGG - Exonic
1192631614 X:72781929-72781951 ATGGAGCAGCAGAAGGGGCTTGG + Intronic
1192650095 X:72938872-72938894 ATGGAGCAGCAGAAGGGGCTTGG - Intronic
1197873099 X:131078658-131078680 AAGAAGCAGATGGGTGGGGTGGG - Intronic
1199440851 X:147866439-147866461 CTGCAGCAGCAGCATGGGGTGGG + Intergenic