ID: 976505136

View in Genome Browser
Species Human (GRCh38)
Location 4:85837624-85837646
Sequence CCCCATGAGAACTGCAACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976505136_976505142 29 Left 976505136 4:85837624-85837646 CCGAGGTTGCAGTTCTCATGGGG 0: 1
1: 0
2: 1
3: 5
4: 127
Right 976505142 4:85837676-85837698 CACAGAAGTAAAATATGCTCAGG 0: 1
1: 0
2: 0
3: 21
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976505136 Original CRISPR CCCCATGAGAACTGCAACCT CGG (reversed) Intronic
900696987 1:4018634-4018656 CTCCCTGAGATCTGAAACCTTGG - Intergenic
902114214 1:14107574-14107596 CCACCTGAGAACTGCAACACTGG - Intergenic
904353247 1:29922493-29922515 CCCAGAGAGAACTGCAGCCTTGG + Intergenic
905528919 1:38661099-38661121 CACCATGGGAGCTGCCACCTTGG - Intergenic
909034755 1:70584215-70584237 CTCCATGAGAGCAGCGACCTTGG - Intergenic
909580112 1:77223799-77223821 CCTACTGAGTACTGCAACCTGGG - Intergenic
910488591 1:87743296-87743318 CCCCATGAGAGCTACTGCCTGGG - Intergenic
911669479 1:100592082-100592104 ACCCATGACAACTGCAGCATGGG - Intergenic
915555399 1:156658127-156658149 CTCTATGAGAACTGGAACCCTGG + Exonic
918385521 1:184003542-184003564 TTCCATGATATCTGCAACCTTGG - Intronic
918448745 1:184639381-184639403 GCCCCTGAGAATTGCAATCTAGG - Intergenic
922824718 1:228509920-228509942 CCTCATGAAAACTGCACTCTGGG + Intergenic
1067695749 10:48534397-48534419 CCCCAGGAGAAATGCAGCATGGG + Intronic
1070528695 10:77317268-77317290 CCACCTGGGAAGTGCAACCTGGG + Intronic
1071708030 10:88020630-88020652 CCTCATGAGAACTGGAGCTTGGG - Intergenic
1071741977 10:88369518-88369540 CCCCATGAGAGTTGGAACCAGGG - Intronic
1073907208 10:108296148-108296170 CTCCAAGAGAAATGCAACTTTGG - Intergenic
1074147798 10:110732173-110732195 ACCAACGAGAACTGCAACATGGG - Intronic
1075618775 10:123910460-123910482 CCCCCTGGGAACTGCAACAGGGG - Intronic
1076413798 10:130270811-130270833 CCCCATCAGAAGTGCCCCCTTGG + Intergenic
1080102494 11:28475666-28475688 CAACTAGAGAACTGCAACCTTGG - Intergenic
1083537229 11:63480700-63480722 CCCCAGTATAACCGCAACCTTGG - Intronic
1087158642 11:94928065-94928087 CACCATAAGACCTGCAAGCTGGG - Intergenic
1088782743 11:113151922-113151944 CCCCAGCAGAGCTGCAAGCTTGG + Intronic
1097031704 12:56094534-56094556 TGCCATGAGAACTGCACCCAGGG + Exonic
1100429296 12:94516215-94516237 GACCATGAGAATTGCAACGTGGG - Intergenic
1101728689 12:107408899-107408921 GCCCATGAGAACAGGATCCTGGG - Intronic
1104789392 12:131472387-131472409 CCCCATGGGGACTGCAGCATGGG + Intergenic
1106404127 13:29458956-29458978 ATCCATGAGGACAGCAACCTAGG - Intronic
1110756176 13:79177042-79177064 CCCAATGAGAACTGGAACCATGG + Intergenic
1112766200 13:102747035-102747057 CTGCATGATAGCTGCAACCTTGG - Exonic
1114259750 14:21027838-21027860 CCAAATGAGAAGTGCAACCATGG + Intronic
1115069927 14:29309103-29309125 CCTCATGTGATCTGCCACCTTGG - Intergenic
1118305079 14:64648915-64648937 ACCCATAAGAACTGCAATCCTGG - Intergenic
1118657523 14:67968171-67968193 CCCCATGCTAAGTGCAGCCTAGG - Intronic
1120426159 14:84350939-84350961 GCCCATGAGGAGTGCTACCTGGG - Intergenic
1121881343 14:97503100-97503122 ACACATGAGAACTGCAGCATGGG + Intergenic
1123133918 14:106010405-106010427 CCCCATGAGCACAGCACACTAGG - Intergenic
1123583945 15:21740840-21740862 CCCCATGAGCACAGCACACTAGG - Intergenic
1123620595 15:22183443-22183465 CCCCATGAGCACAGCACACTAGG - Intergenic
1126677337 15:51171768-51171790 CCCCGTGAGTACTGCATGCTTGG - Intergenic
1129332056 15:74832736-74832758 CCCCATCAGCCCTGCAATCTGGG + Intergenic
1131498179 15:92933394-92933416 CCAGATGAGAACTGCAAACAAGG - Intronic
1134849496 16:17469403-17469425 CCCCTGGAGAACTGAGACCTTGG + Intronic
1136391831 16:29970256-29970278 CCCCATGAGGAGCACAACCTGGG + Intronic
1139969133 16:70762914-70762936 CCACTTGAGAACTGCAATCCTGG + Exonic
1140427568 16:74873924-74873946 CTCCATGAAAACTTCCACCTTGG + Exonic
1140760192 16:78102749-78102771 CCCCATGACATCTGCAACCTGGG - Intronic
1141656589 16:85419965-85419987 ACCCATGATAACTGCCAGCTGGG - Intergenic
1144065319 17:11619386-11619408 CCACATGTGGACTGCGACCTGGG - Intronic
1144242526 17:13327429-13327451 CACCATGAGTACTTGAACCTGGG - Intergenic
1144633259 17:16886854-16886876 CCTCATGAGAAGTGGAAGCTGGG - Intergenic
1147239453 17:39080951-39080973 AGCCATGAGAACTGCAAAATGGG - Intronic
1149540020 17:57461764-57461786 CCTCAAGAGATCTGCTACCTCGG + Intronic
1157173023 18:45425457-45425479 CCACCTGAGAACTGTATCCTTGG + Intronic
1157556751 18:48617851-48617873 CCCCCTGAGCTCAGCAACCTTGG - Intronic
1158904729 18:62001044-62001066 ACCCATGAGAACAGCCACATGGG - Intergenic
1162361550 19:10223598-10223620 CCCCTTTAGAACTGGATCCTGGG - Intronic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
1164968682 19:32510786-32510808 CCCCTTGAAATGTGCAACCTTGG - Intergenic
1166912408 19:46168745-46168767 AAGCTTGAGAACTGCAACCTGGG - Intergenic
926469057 2:13230307-13230329 CCACATTAGAACTGTAACCATGG + Intergenic
927208981 2:20627202-20627224 CTCCCTGAGAGCTGCCACCTGGG - Intronic
928711550 2:34012418-34012440 CTCCCTGATAACTGCAACTTTGG - Intergenic
928922386 2:36539234-36539256 CCCCATGAGAACTGCAATTCTGG - Intronic
937560511 2:123218690-123218712 GACCATGAGATCTGCAGCCTGGG - Intergenic
938974104 2:136459028-136459050 ACCCATGAGAACTGCTACATGGG - Intergenic
941162754 2:162053983-162054005 ACCCATGAGAGCTGCACCATGGG + Intronic
948592921 2:239062949-239062971 CCCCTTGGGACCTGCAGCCTGGG - Intronic
1174683878 20:52434765-52434787 CCCCATGGGATATGCATCCTGGG + Intergenic
1175479837 20:59302856-59302878 CCCCATGAAAGCTGCTACCAAGG - Intronic
1176935399 21:14860982-14861004 GCCCATGAGGTGTGCAACCTGGG - Intergenic
1178401874 21:32293436-32293458 ACCCCTGAGATTTGCAACCTGGG - Intronic
1178794966 21:35735430-35735452 GACCATGAGAAATGCTACCTAGG + Intronic
1179829156 21:43985154-43985176 CCCCATGACACCTGGCACCTGGG - Exonic
1180098209 21:45571232-45571254 CCCCATCAGGACAGCAACTTGGG - Intergenic
1181945257 22:26512099-26512121 CCCTATGAGCAGTGGAACCTAGG - Exonic
1183403533 22:37618665-37618687 CCCCATTAGAACTCAGACCTAGG + Intronic
1184164327 22:42718953-42718975 CCCCAGCTGAACTGCATCCTTGG + Intronic
952557580 3:34550647-34550669 CACCAAGAGGACTGAAACCTGGG + Intergenic
955190713 3:56758835-56758857 TGCCATCAGAACTGCAAACTGGG - Intronic
955630859 3:60973267-60973289 CCCCTGAAGAACTACAACCTAGG - Intronic
962682648 3:137815777-137815799 CCCAATGAATACAGCAACCTAGG + Intergenic
963146581 3:142000955-142000977 ACCCAGGAGAACTGCAGCATGGG - Intronic
963244913 3:143048826-143048848 ACCCAGGTGCACTGCAACCTTGG - Intronic
964492628 3:157253198-157253220 CGCCATGAGAACCCCAGCCTTGG - Intergenic
968526347 4:1059573-1059595 TCCCATGAGAACCACAACCAAGG + Intronic
972328037 4:38036613-38036635 CCCCATGAAAACTGCACACTTGG - Intronic
976505136 4:85837624-85837646 CCCCATGAGAACTGCAACCTCGG - Intronic
979391935 4:120138325-120138347 CCCCATGATGTGTGCAACCTAGG - Intergenic
979562728 4:122118659-122118681 CCCCATCAGCACTCTAACCTTGG - Intergenic
979580643 4:122355000-122355022 CCCCATGAGAACAGTTACCATGG + Intronic
980836866 4:138205089-138205111 CCCCATGAGAACTATAATATAGG + Intronic
981437021 4:144736366-144736388 CCTCATGTGATCTGCCACCTTGG + Intronic
983447386 4:167870834-167870856 CCCCATAAAAACTCCATCCTAGG + Intergenic
983928265 4:173426002-173426024 CCCCAGGAGAACTGTTAGCTTGG - Intergenic
984250783 4:177332128-177332150 CCCTAAGAAAACTGCGACCTTGG - Intronic
984312989 4:178087618-178087640 CCCCATGAGAGCAGCAACTCAGG + Intergenic
986019766 5:3790340-3790362 CCTGATGAGAACTGCAGCCGTGG - Intergenic
994046780 5:95319170-95319192 CCCAAAGAGAATTGCATCCTTGG + Intergenic
997895006 5:137708590-137708612 CCCCATGAGGACAGGGACCTTGG - Intronic
999447976 5:151656337-151656359 CCACATGAGAACTGGAACAGTGG - Intergenic
1001044317 5:168360177-168360199 CTCCATCAGGACTGCAGCCTAGG + Intronic
1001136316 5:169105511-169105533 CCCAAAGACAACTCCAACCTTGG - Intronic
1006337787 6:33429488-33429510 CCCCTTGAGAGCTGCCAGCTGGG + Intronic
1010930820 6:81800860-81800882 CACCATGTGATCTGCAACCACGG - Intergenic
1011111036 6:83836857-83836879 TCCCAAGAGAACTTCACCCTAGG + Intergenic
1011868505 6:91862137-91862159 CCCCAGGAGACCAGCAACATGGG + Intergenic
1015342411 6:132116642-132116664 CCAAATGAGCACTGGAACCTGGG + Intergenic
1021194802 7:17663206-17663228 CTCCATGGGAACAGGAACCTGGG - Intergenic
1021402199 7:20222282-20222304 CCCCATTAGAATTTCCACCTCGG + Intergenic
1021499199 7:21311093-21311115 CCCAATTAGGATTGCAACCTCGG - Intergenic
1023521761 7:41056619-41056641 CCCCTCGATAACTGCAACTTAGG - Intergenic
1024600359 7:50975194-50975216 CCACATGAGAAGTTCAACCATGG - Intergenic
1025078403 7:55962871-55962893 AACCATGAAAACTGCAACCAAGG - Intronic
1026889940 7:73975973-73975995 CCTCCTGAGAACTGCAGCCCAGG + Intergenic
1030640599 7:112001807-112001829 CCCCAGGATACCTGCAACCTTGG - Intronic
1032024481 7:128430679-128430701 ACCCATGAGGTCAGCAACCTGGG - Intergenic
1033397053 7:140985372-140985394 CCTCAAGAGATCTGCCACCTCGG - Intergenic
1034551223 7:151822073-151822095 CCCCATGACAACTGCCACTGGGG + Intronic
1035574892 8:697983-698005 CCCCGTGAGCTCTCCAACCTGGG - Intronic
1037871467 8:22501438-22501460 CCAGATGAGAACTGAAACCCTGG - Intronic
1041361198 8:57055996-57056018 CCCCCTGAGAACTGCTCCATGGG - Intergenic
1044834505 8:96282581-96282603 CACCATCCGAACTGCCACCTAGG + Intronic
1047012257 8:120685085-120685107 ACCCATAAGAACTGCCACATTGG - Intronic
1047413429 8:124643206-124643228 CCACATGAGGACTCCATCCTAGG + Intronic
1056394697 9:86170996-86171018 GCCCAAGAGAACTGAAACATAGG - Intergenic
1191210050 X:57875435-57875457 CCCCATGAGCACTGGAGACTGGG - Intergenic
1191870548 X:65741558-65741580 CCCCTTGAGGACTGAACCCTGGG - Exonic
1192743840 X:73919189-73919211 CCAGATCAGAACTGCAACCCTGG + Intergenic
1194065224 X:89252950-89252972 CGCCATGAGTTCTGCAGCCTAGG - Intergenic
1194348237 X:92793234-92793256 ACCCATGAGCTATGCAACCTGGG - Intergenic
1195518479 X:105804278-105804300 AACCATCAGAACTGCCACCTAGG - Intergenic
1200656567 Y:5909863-5909885 ACCCATGAGCTATGCAACCTGGG - Intergenic