ID: 976508654

View in Genome Browser
Species Human (GRCh38)
Location 4:85881431-85881453
Sequence GAGGAAGAATAGATTGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 426}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976508650_976508654 16 Left 976508650 4:85881392-85881414 CCAAGATGTATATTCATTATTTT 0: 1
1: 0
2: 1
3: 67
4: 712
Right 976508654 4:85881431-85881453 GAGGAAGAATAGATTGTACAGGG 0: 1
1: 0
2: 2
3: 23
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976508654 Original CRISPR GAGGAAGAATAGATTGTACA GGG Intronic
901091960 1:6647719-6647741 GAGGCAGAATAGCTTGAACCTGG + Intronic
901704980 1:11066845-11066867 GAGGAAGAATGGTTTGCTCAGGG + Intronic
902380769 1:16051264-16051286 GAGGAAGAAAGGAATGTACCTGG + Intronic
904479323 1:30784137-30784159 CAGGAAGAATAGCTTGAACCTGG - Intergenic
904547289 1:31285335-31285357 GAGGAAGAATTGCTTGAACCCGG - Intronic
904742529 1:32689333-32689355 GAGGCAGAATAGCTTGAACCTGG - Intronic
906051194 1:42874680-42874702 GCAGAAGAATAGCTTGAACATGG - Intergenic
909000847 1:70215874-70215896 GAGGAAGAATTGCTTGAACCTGG - Intronic
909145478 1:71924687-71924709 GAGGAAAAATATACTTTACATGG - Intronic
909444919 1:75738315-75738337 GAGGAAGAATTGCTTGAACCTGG - Intronic
909518119 1:76534849-76534871 ATGGAATAATAGATTATACAGGG + Intronic
910074064 1:83256651-83256673 GAGGATGAATGGATTGTATTTGG + Intergenic
910098392 1:83550126-83550148 GATTAAGAATAGCTAGTACACGG + Intergenic
911367683 1:96958899-96958921 GAGGAAGAATAGTTTGTCCAAGG + Intergenic
912406364 1:109441624-109441646 GAGGTAGAATAGATAGGACTTGG - Intergenic
912855346 1:113164150-113164172 GATGAGGAACAGATTGTCCAAGG - Intergenic
913288064 1:117245581-117245603 GAGGTAGAATTGGTTGTACTGGG + Intergenic
913391446 1:118317665-118317687 GTGGAAGAACAATTTGTACAAGG - Intergenic
913442881 1:118917737-118917759 GATAGAGAAGAGATTGTACAGGG - Intronic
913677445 1:121154644-121154666 GAGGCTGAATAACTTGTACAAGG + Intergenic
914160170 1:145125677-145125699 GAGGCTGAATAACTTGTACAAGG - Intergenic
914394591 1:147252890-147252912 GAGGCAGAGAAGACTGTACAGGG - Intronic
914857009 1:151359962-151359984 GCAGAAGAATAGCTTGAACATGG - Intergenic
915386099 1:155493778-155493800 GCGGAAGAATAGCTTGAACCAGG + Intronic
915536046 1:156536100-156536122 GAGTAAGAAAAGATTGTTCTAGG - Intronic
916561582 1:165938268-165938290 GAGGCAGAATTGCTTGAACATGG - Intergenic
917308078 1:173648034-173648056 GAGGCAGAATAGCTTGAACCCGG - Intronic
917695904 1:177523761-177523783 GAGTAAGGATGGATTATACATGG + Intergenic
918120922 1:181539534-181539556 GAGGAAGAATATATTATTCCCGG + Intronic
918414838 1:184295886-184295908 GAGGCAGAATAGCTTGAACCTGG + Intergenic
918481375 1:184980904-184980926 GAGGAAGAATATTTTTTCCATGG + Intergenic
919252610 1:195077160-195077182 GAGAAAGTATATATTTTACATGG - Intergenic
919480908 1:198087830-198087852 TAGGAATAGTAGATAGTACATGG + Intergenic
920136491 1:203773358-203773380 GCGGGAGAATCGATTGAACACGG + Intronic
920404667 1:205700316-205700338 GAGGCAGAATTGCTTGAACATGG + Intergenic
920464748 1:206173158-206173180 GAGGCTGAATAACTTGTACAAGG + Intergenic
920859686 1:209695340-209695362 GAGGTAGAATCGACTGTACTTGG + Intronic
920893013 1:210011782-210011804 GAAGAAAAGTAGATTATACAGGG + Intronic
921047284 1:211486403-211486425 GTGGAAGAATCGATTGAACCTGG + Intronic
921164052 1:212493571-212493593 GAGGAAGAAGAGATGGAAGAAGG + Intergenic
922782223 1:228262254-228262276 GAGGAGGAAAAGAAAGTACAAGG + Intronic
923591299 1:235322120-235322142 GCAGAAGAATAGCTTGAACACGG - Intronic
923693596 1:236223106-236223128 GAAGAAGAATAGCTTGAACCCGG + Intronic
923997568 1:239512593-239512615 GAGGAAGAAGAAAGGGTACAAGG - Intronic
1063984646 10:11489645-11489667 GAGGAGGCATAGACTGTGCATGG - Intronic
1063990441 10:11555319-11555341 GCAGAAGAATAGACTGAACACGG + Intronic
1064575490 10:16741745-16741767 GGTGAAGAATGGATTGTAAAGGG + Intronic
1064753033 10:18551473-18551495 GAAGAAGAATAGATACTACCAGG - Intronic
1066224941 10:33373050-33373072 GAGGCAGAATTGCTTGAACACGG - Intergenic
1069445880 10:68472636-68472658 GAGGTAGAATAAATTGAACACGG + Intergenic
1069556186 10:69400104-69400126 GAGGAAGATGAGATTTTGCAGGG - Intronic
1069964173 10:72100320-72100342 GAGGGAGAATAGCTTGAACCCGG - Intronic
1070072792 10:73105677-73105699 GAGGAAGAATTGCTTGAACTGGG - Intergenic
1070972771 10:80581193-80581215 GAAGAAGAACTGATTGAACATGG + Intronic
1071921045 10:90350963-90350985 GGCCAAGAATAGATGGTACATGG - Intergenic
1076882903 10:133248191-133248213 GAGCAAGAATCGCTTGTCCAGGG + Intergenic
1077998909 11:7477057-7477079 GAGGAAGAAGAGATTGGAGGAGG + Intergenic
1078282046 11:9912216-9912238 GAGGCAGAATAGCTTGAACCTGG + Intronic
1078282082 11:9912486-9912508 GAGGCAGAATAGCTTGAACCTGG + Intronic
1078985643 11:16593797-16593819 GAGGATAAATAAATTGTAAATGG + Intronic
1079956539 11:26873250-26873272 GAGGGAGAATAGCTTGAACCCGG + Intergenic
1080500719 11:32868320-32868342 GTGGAAGAATAGCTTGAACCTGG + Intergenic
1080627280 11:34041954-34041976 GCGGAAGAATAGCTTGAACCTGG + Intergenic
1080745773 11:35107298-35107320 GAGCAAAGATAGATTGTTCAAGG - Intergenic
1080883332 11:36342758-36342780 GAAGAAGACTGGATTGTAAAGGG - Intronic
1081444639 11:43118596-43118618 GAGGAAGAATAGATGCGAAAGGG + Intergenic
1082265469 11:50113030-50113052 GAGGCAGAATCGATTGAACCCGG + Intergenic
1083243789 11:61409874-61409896 GAGGCAGAATAGCTTGAACCCGG + Intronic
1083459768 11:62803220-62803242 GAGGCAGAATAGCTTGAACCCGG + Intronic
1084469693 11:69351334-69351356 GAGGAAAAAAAGATTGAAGAAGG - Intronic
1084620742 11:70268914-70268936 GTGGAAGAATAGCTTGAACCTGG - Intergenic
1085323972 11:75592639-75592661 GAGCAAGAATACATGGAACAGGG - Intronic
1085616288 11:78001686-78001708 GAGGCAGAATAGCTTGAACCCGG - Intergenic
1085810314 11:79674121-79674143 GAGGAAAGATTGATTCTACATGG - Intergenic
1086859627 11:91909607-91909629 CAGGAAGAATTGATAGTACAGGG - Intergenic
1087059382 11:93963045-93963067 GAAGAAAAGTAGATTGTCCACGG + Intergenic
1088436651 11:109820659-109820681 GAGGAAGAATAGATTATCTGGGG + Intergenic
1088886796 11:114014022-114014044 GAGGGAGAATGGATTGTGCCTGG + Intergenic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1089887812 11:121845441-121845463 AAGGAAGAAGAGAGAGTACAAGG + Intergenic
1090052415 11:123391346-123391368 AAGGAACAATAGATTATACAAGG - Intergenic
1090978260 11:131694278-131694300 GAGGAAGAGTAGATGCTGCAAGG - Intronic
1091092768 11:132788241-132788263 GAGAAAGAGTAGATTTTTCAGGG - Intronic
1091948016 12:4566307-4566329 GAGGTAGATTAGGTTGTAAAGGG - Intronic
1091971219 12:4788533-4788555 GAGGAGGAATAGGTTGAAGAAGG + Intronic
1092006258 12:5072968-5072990 CAGTAGGAATAGATTATACATGG + Intergenic
1092124267 12:6064706-6064728 GAGGACGAAGAGAATGCACAGGG - Intronic
1093198823 12:16162297-16162319 GAGAAAGAACTGAATGTACAAGG + Intergenic
1095479539 12:42620970-42620992 GAGGCAGAATAGCTTGAACCTGG + Intergenic
1096176331 12:49522458-49522480 GAGGAAGAATTTATAGTAGAGGG - Intronic
1097787768 12:63780001-63780023 GAGGGAGAATAGGCAGTACAGGG - Exonic
1098244321 12:68500667-68500689 GAGGATGACTAAATTTTACAAGG + Intergenic
1098423033 12:70324579-70324601 GAGGAAGTGTAGAGTGTACTTGG + Intronic
1099483926 12:83203829-83203851 GAGGAGGAATAGCTTGAACTGGG + Intergenic
1099927638 12:89037706-89037728 GAGGAAGAGTAGGTTGGAGAAGG - Intergenic
1100307265 12:93362170-93362192 GTGGAAGAATAGTTTGAACCCGG + Intergenic
1100959049 12:99942801-99942823 AAGGAAGAATACAGTGGACAGGG + Intronic
1101461623 12:104902587-104902609 GAGGAAGAACATGTTGAACAAGG + Intronic
1102117149 12:110411305-110411327 GAGGCAGAATAGCTTGAACCTGG - Intergenic
1102678966 12:114677318-114677340 CAGGGATAATAGATTATACAGGG - Intronic
1103031486 12:117617691-117617713 GAGGATGAAGTGATTGCACAGGG + Intronic
1104028276 12:125045429-125045451 GAGGCAGAATAGCTTGAACCAGG - Intergenic
1105774579 13:23645769-23645791 GAGGCAGAAGAGATTGTAGCTGG - Intronic
1107529628 13:41270832-41270854 GAGGCAGAATAGCTTGAACCAGG - Intergenic
1108591491 13:51916739-51916761 GAGGTAAAATAAATTTTACATGG - Intergenic
1109113644 13:58353839-58353861 GAGGAAGAATTGCTTGAACCCGG - Intergenic
1109187480 13:59287893-59287915 GTGGAAGAATTGCTTGAACAGGG + Intergenic
1110059081 13:71018317-71018339 GAGGCAGAATAGCTTGAACCTGG - Intergenic
1110100187 13:71590970-71590992 GAGGGAGAATAGCTTGAACCTGG - Intronic
1110225404 13:73114349-73114371 GAGAAAGAATAGAATCTACAAGG - Intergenic
1110335069 13:74319200-74319222 GAAGAAGAAAGCATTGTACATGG - Intergenic
1110729897 13:78867748-78867770 GAGGAAATATAGATTCCACACGG + Intergenic
1112150834 13:96761581-96761603 GAGGAAGATTAGATTGGGAAGGG - Intronic
1112378234 13:98863698-98863720 GAGAAAGAATCAATTCTACAAGG + Intronic
1112670379 13:101629157-101629179 GAAGAAGAATAAAATGTAAAGGG - Intronic
1114784179 14:25575674-25575696 ATGCAAGAATAGATAGTACAGGG - Intergenic
1115001536 14:28426815-28426837 AAGGAAGAATATATGCTACAAGG - Intergenic
1115166426 14:30453106-30453128 GAGGAAGATGAGATTATAAAAGG + Intergenic
1119149181 14:72342634-72342656 GTGGGAGAATTGCTTGTACATGG + Intronic
1119384816 14:74251354-74251376 GCGGAAGAATAGCTTGAACCCGG + Intronic
1119409721 14:74423016-74423038 GAGGAAGAATAAATGCAACATGG - Intronic
1119761044 14:77152081-77152103 AAGGATGAATAGATTCTACAGGG + Intronic
1120180689 14:81339598-81339620 AAGGAAGATTAGATTGAACAGGG - Intronic
1120481857 14:85059586-85059608 GAGGAAGAAGAGATATTACATGG + Intergenic
1121379779 14:93453939-93453961 GAGGAGGAATAGATTGTTTGAGG + Intronic
1121676100 14:95754272-95754294 TAGGAAGAATGGATTGTGGAAGG - Intergenic
1121733989 14:96205383-96205405 GAGGTTGAATAGCTTGTCCAGGG - Intronic
1123632132 15:22268806-22268828 GAGGAAGAAAGGAAAGTACAGGG - Intergenic
1125615908 15:41012467-41012489 GAGGAAGAATTGCTTGAACCCGG + Intronic
1126181579 15:45790727-45790749 AAGGAAGACCAGATTGTGCAGGG - Intergenic
1127084534 15:55412796-55412818 GATGAAGAGTAGATTGAATATGG + Intronic
1127476738 15:59340923-59340945 GAGGTAGAAAAGCTTGAACAGGG + Intronic
1127706684 15:61554323-61554345 GAAGAAGAATAGATTGGTGATGG + Intergenic
1128220099 15:65963008-65963030 GAGGAAGGATGAATTATACAGGG + Intronic
1128464313 15:67896773-67896795 GAGGCAGAATAGCTTGAACCTGG + Intergenic
1128650467 15:69408760-69408782 GAGGCAGAATCGCTTGAACATGG - Intergenic
1128798947 15:70484889-70484911 GAGGAAGAATAAATTGGAGAAGG + Intergenic
1128844331 15:70876690-70876712 AAGGAAGAATTGACTGGACATGG - Intronic
1130418478 15:83716418-83716440 GAGGTAGAATTGCTTGAACATGG + Intronic
1130736684 15:86557723-86557745 AAGAAAGAAGAGATTGTAAAAGG - Intronic
1130809280 15:87359486-87359508 GCAGAAGAATTGATTGAACATGG - Intergenic
1131884423 15:96896292-96896314 GAGGAAGGATAGATACAACATGG - Intergenic
1132123496 15:99198389-99198411 GAGGCAGAATTGATAGGACATGG - Intronic
1133643497 16:7740770-7740792 GAGGCTGACTAGATTGTCCAAGG - Intergenic
1133648887 16:7790834-7790856 GTGAAAGAGTAGATTGCACAAGG - Intergenic
1133872963 16:9706697-9706719 GAGGAAGGAAAGATGGGACAGGG - Intergenic
1134065731 16:11226843-11226865 GAAGGAGAATAGATTGAACCCGG - Intergenic
1136459208 16:30399219-30399241 GAGGAAGAATAGATAGAAATAGG + Exonic
1138102998 16:54269395-54269417 GCAGGAGAATAGATTGAACACGG - Intronic
1139184987 16:64795279-64795301 GAACAAGAACAGATTGAACACGG - Intergenic
1139445138 16:66993107-66993129 GAGGAAGAAAAGAGTATCCACGG + Intronic
1139772043 16:69285884-69285906 GTGGGAGAATAGCTTGTACCTGG - Intronic
1139903502 16:70346515-70346537 GAGGTAGAATAGCTTGAACACGG + Intronic
1140446251 16:75030932-75030954 GAGGAAGAATTGCTTGAACCCGG - Intronic
1140998664 16:80286940-80286962 CAGGAAGATTTGATTGTCCAGGG - Intergenic
1141301685 16:82821880-82821902 TAGGAAGCATAGATGGTCCAAGG - Intronic
1141585208 16:85028695-85028717 GAGGAAAAAAAGACTTTACAGGG + Intronic
1141970863 16:87481581-87481603 GAGGAAGAAAGGAAAGTACAGGG + Intronic
1142017614 16:87759076-87759098 GAGGAAGAATTGCTTGAACCTGG + Intronic
1142781965 17:2188284-2188306 GAGGAAGAATGGAGACTACAGGG + Intronic
1143051388 17:4128863-4128885 GAGGAAGAATAGCTTGAACTCGG - Intronic
1143198549 17:5096289-5096311 AAGGAAGAAAATTTTGTACATGG - Exonic
1143335046 17:6165782-6165804 GAGGCAGAATTGCTTGAACATGG + Intergenic
1143337934 17:6187474-6187496 GATGAAGAACACACTGTACAAGG + Intergenic
1144316981 17:14070902-14070924 GAGGTAGAATAGATTGGCTAGGG + Intronic
1147594403 17:41707341-41707363 GTGGAAGAATTGCTTGAACATGG - Intergenic
1148001813 17:44392638-44392660 GAGGAAGAATTGCTTGAACCTGG + Intergenic
1148532657 17:48409573-48409595 GTGGAAGAATTGCTTGAACAGGG + Intronic
1148593825 17:48836854-48836876 GAGGCAGAATAGCTTGAACCTGG - Intronic
1149668800 17:58386729-58386751 GAAGAAGAAGAGATTCTTCATGG - Intronic
1150161632 17:62902894-62902916 GAGGCAGAAGAAATTGTATATGG - Intergenic
1150570655 17:66383854-66383876 GAGGCAGAATAGCTTGAACCTGG + Intronic
1151273509 17:73015154-73015176 GAGGAAGAAAAAACAGTACAGGG - Intronic
1151594085 17:75066274-75066296 GAGGGAGAATTGCTTGAACATGG - Intergenic
1151604412 17:75127394-75127416 GAGGCAGAATAGCTTGAACCCGG - Intronic
1151619074 17:75234143-75234165 GAGGAAGAATGGCTTGAACCCGG - Intronic
1155668975 18:28346473-28346495 GATGAAAAATAGTTTGTACGTGG + Intergenic
1155796795 18:30048867-30048889 GAGGCAGAATAGCTTGAACCTGG - Intergenic
1155944593 18:31834201-31834223 GAGGCAGAATAGCTTGAACCTGG - Intronic
1156337684 18:36185628-36185650 GAGGCAGAATAACTTGCACACGG - Intergenic
1156440436 18:37181670-37181692 TAGAAAGAATATATTGTACTTGG + Intronic
1157162579 18:45327557-45327579 GAGGTAGAATAGAGGGTACCAGG - Intronic
1158141414 18:54260125-54260147 GCTGAAGAATAGAGTGTAGAAGG - Intergenic
1158750226 18:60250464-60250486 GGGGAAAAATAAATTTTACATGG + Intergenic
1159144211 18:64432802-64432824 GCAGAAGAATAGCTTGAACATGG + Intergenic
1160459122 18:79024319-79024341 GTGGGACAATAGATTGAACAGGG + Intergenic
1161318269 19:3628830-3628852 GAGGAAGAATTGCTTGAACCTGG + Intergenic
1162071574 19:8155368-8155390 GAGAAATAATATATTGTATATGG - Intronic
1162535453 19:11261149-11261171 CAGTAAGAGTAGAATGTACAGGG - Intronic
1163396439 19:17065728-17065750 GAGGCAGAATAGCTTGAACCCGG + Intronic
1163433229 19:17280887-17280909 GAGGCAGAATAGCTTGAACCTGG + Intronic
1163763640 19:19150428-19150450 GAGGAAGAATCGTTTGAACCCGG + Intronic
1164918620 19:32071938-32071960 GAGGAAGAAGAGAGAGAACAGGG + Intergenic
1165118462 19:33543946-33543968 GCAGAAGAATAGATTGAACCCGG - Intergenic
1165310901 19:35029136-35029158 GAGGAAGAATCGCTTGAACCCGG - Intergenic
1165960487 19:39530123-39530145 GAGGCAGAATAGCTTGAACCCGG + Intergenic
1166207971 19:41285318-41285340 GAGGTAGAATAGCTTGAACCGGG - Intronic
1166261992 19:41646505-41646527 GAGGGAGAATCGCTTGAACATGG + Intronic
1167219916 19:48192354-48192376 GAGGAAGAATCGCTTGAACCCGG + Intronic
925823744 2:7825764-7825786 GAGAAAGAAGACTTTGTACAGGG + Intergenic
926563256 2:14440955-14440977 GGGGAAGAGTCAATTGTACAGGG - Intergenic
927388323 2:22562421-22562443 GGGGAAGAAGAGATTGGAGAAGG - Intergenic
928791055 2:34954111-34954133 GAGCAAGGGTAGATTGTAAATGG + Intergenic
928803227 2:35119601-35119623 GAGGCAGAATAGCTTGAACCTGG + Intergenic
928931495 2:36629545-36629567 CAGAGAGAATAGATTGTAAATGG - Intronic
929298843 2:40278373-40278395 GAGGAAGAATTGCTTGAACCTGG + Intronic
930660522 2:54048330-54048352 GTGGAAGAATTGCTTGAACAAGG + Intronic
932254624 2:70273964-70273986 AAGGAAGAATAGATGTTCCATGG + Intronic
933069612 2:77840715-77840737 GAGGCAGAATTGCTTGTACCCGG - Intergenic
933442664 2:82333792-82333814 GTGGGAGAATAGAGTGAACAAGG + Intergenic
934778392 2:96953447-96953469 GTGGGAGAATTGATTGTACAAGG + Intronic
935169366 2:100598943-100598965 TAGAAAAAATAGATTATACAAGG - Intergenic
936061168 2:109296638-109296660 GAGCAAGAACAGATGGTGCAGGG - Intronic
936432153 2:112473949-112473971 GAGGAAGAATTGCTTGAACCTGG + Intergenic
936862777 2:117037500-117037522 GAGGAAGAATTGCTTGAACCTGG + Intergenic
937311652 2:120906550-120906572 AAGGAGGACGAGATTGTACACGG - Intronic
937522975 2:122734274-122734296 GAGTAAGGAGAGATTGCACAGGG - Intergenic
937773488 2:125748778-125748800 GAGGAAGAATATATAGTAAAAGG + Intergenic
937816297 2:126254292-126254314 GAAGAAGAGTAGATTTTACATGG - Intergenic
938095194 2:128456963-128456985 GAGGAAGAATGGATTTGAGAAGG - Intergenic
938988768 2:136606333-136606355 GATAAAGAATAGATTTTCCATGG - Intergenic
939021117 2:136959692-136959714 GAGATAGAATAGATTGCAAAGGG + Intronic
939968303 2:148632670-148632692 GAGGAAGAATTGCTTGAACCTGG - Intergenic
940214264 2:151288720-151288742 TAGGAAGATTCGATTCTACACGG - Intronic
941324540 2:164097274-164097296 GAAGGAGAATAGCTTGTACCCGG - Intergenic
941538866 2:166757596-166757618 GAGGAAGAATGGCTTGAGCATGG + Intergenic
941725385 2:168854580-168854602 GGGGAAGAAAAAATTGTTCAGGG - Intronic
941727773 2:168882506-168882528 GAGGCAGAATAGCTTGAACCAGG + Intronic
942843958 2:180400488-180400510 GAGGAAGAGTATATTTGACAAGG + Intergenic
945529966 2:210940504-210940526 GAGGAAGAAGAGAGTGAAAAGGG - Intergenic
945700458 2:213163074-213163096 GAGTAAAAATAGCTTTTACATGG - Intergenic
946784095 2:223224184-223224206 CATAAAGAATAGATTGTAGAGGG + Intergenic
947498094 2:230653547-230653569 GAGGCAGAATAGCTTGAACCTGG - Intergenic
1169572386 20:6920616-6920638 GAGGAAGATAAGATTATAAATGG - Intergenic
1169919639 20:10721073-10721095 CAGCAAGAACAGATTTTACAAGG - Intergenic
1170761445 20:19254750-19254772 GAGGAAGATGAGATTTCACAGGG + Intronic
1171035930 20:21713028-21713050 GAGGAAGGATGGCTTGGACAGGG + Intronic
1171269144 20:23799819-23799841 GAGGAGGAAGAGAGTGAACAGGG - Intergenic
1172260873 20:33564354-33564376 GAGGCAGAATAGCTTGAACCCGG - Intronic
1172734536 20:37116202-37116224 GAGGCAGAATAGCTTGAACCAGG + Intronic
1173066341 20:39716273-39716295 GAGGAAGAATTGCTTGAACCTGG + Intergenic
1173518265 20:43680589-43680611 GAGGAAGAATTGCTTGAACCTGG - Intronic
1174294871 20:49538776-49538798 GAGGCAGAATAGCTTGAACCTGG - Intronic
1175014317 20:55772464-55772486 GAAAAAGAAAAGATTGTTCAGGG + Intergenic
1177232083 21:18334941-18334963 AAGGAAGAAGAGAGTGTACATGG + Intronic
1177527160 21:22309157-22309179 GAAGAAGAATAGCTTGAACATGG + Intergenic
1178074650 21:29003504-29003526 GAGGAAGAATTGCTTGAACCTGG + Intergenic
1178085330 21:29106278-29106300 GAGGCAGAATAGCTTGAACCCGG - Intronic
1179412441 21:41172489-41172511 GAGGCAGAGTAGTTTGTCCAGGG + Intronic
1182445764 22:30388307-30388329 GAGGCAGTGTTGATTGTACATGG - Intronic
1182501685 22:30752633-30752655 CAGAGAGAATAGATTGTAAATGG + Intronic
1182794140 22:32978119-32978141 GATGAAGAATACATTGGAGATGG + Intronic
1183450282 22:37890417-37890439 GAGGTAGAATAGCTTGAACCTGG - Intergenic
1183557149 22:38538048-38538070 GAGGAAGAATTGCTTGAACCTGG + Intronic
1183852342 22:40600879-40600901 GAGGCAGAATAGCTTGAACCCGG + Intronic
1184811125 22:46832886-46832908 GAGGAAGAAGGGATAGAACAGGG + Intronic
1184953430 22:47862552-47862574 GAGGAAGAATGGATGGAGCAGGG + Intergenic
949204006 3:1416305-1416327 GAGCAAGAATACATTGTTGAGGG - Intergenic
951363853 3:21756594-21756616 TAGGAAGTATAGATTGAAAAAGG + Intronic
952132434 3:30381575-30381597 CAGGAAGAATAGCTAGTAAATGG - Intergenic
952395032 3:32913793-32913815 GAGGGAGAACCTATTGTACAGGG + Intergenic
953582505 3:44169609-44169631 GAGAAAGAATAGATTAGCCAGGG + Intergenic
954693054 3:52406057-52406079 GAGGGAGAATAGCTTCTAAAAGG - Intronic
954974137 3:54676810-54676832 GAGGAAAGATAGATTGGCCAGGG + Intronic
955106710 3:55905748-55905770 AAGAAAGAACAGATTCTACAAGG - Intronic
955273606 3:57526620-57526642 GAGGCAGAATAGCTTGAACCAGG - Intronic
956923507 3:73956482-73956504 GAGGAAGAATGTCTTCTACAGGG - Intergenic
957136754 3:76298235-76298257 GAGTTATAATGGATTGTACAAGG + Intronic
957302368 3:78408909-78408931 GAGAAAAAATATATTGCACACGG - Intergenic
959760406 3:109956351-109956373 GAGTAAGAATAGATTGTTGCTGG - Intergenic
959979402 3:112498337-112498359 GAAGAAGAATCGATTGAACCCGG + Intronic
960105967 3:113797344-113797366 GAGGAAGAATTGCTTGAACCCGG - Intronic
960622008 3:119646184-119646206 GAGGAAGAATAGATACAGCAAGG + Intronic
961245527 3:125449323-125449345 GAGGTAGAATTGCTTGAACACGG + Intronic
961690267 3:128664432-128664454 GAGGAAGAATCGCTTGAACCTGG + Intronic
961758966 3:129151026-129151048 GAGGCAGAATAGCTTGAACCTGG + Intronic
962054373 3:131854356-131854378 GAGGAAGAAGAGCTTGTAAGGGG + Intronic
963172678 3:142266783-142266805 GTGGAAGAATTGATTGAACTTGG + Intergenic
963990853 3:151652020-151652042 GAAGAACAATAGATATTACAGGG - Intergenic
964354731 3:155839849-155839871 GAGGCAGAATTGTTTGAACAAGG + Intronic
964362206 3:155910150-155910172 GCAGAAGAATAGTTTGGACATGG + Intronic
965028569 3:163333997-163334019 GAGGCAGAATTGATTGAACCTGG + Intergenic
966817654 3:183902288-183902310 GAGGCAGAATAGCTTGAACCTGG + Intergenic
968260684 3:197321376-197321398 CAGGAAGAATAGATTACAAAGGG + Intergenic
970280135 4:14445882-14445904 GAGAATGAATAAAATGTACAAGG + Intergenic
971582550 4:28361206-28361228 AAGGAAGAATAGATTCTATTTGG + Intergenic
971747015 4:30595101-30595123 GAGGAATAATAGATAGTAAAAGG - Intergenic
972505570 4:39717325-39717347 GAGGCAGAATTGCTTGAACACGG - Intronic
972532618 4:39975180-39975202 GAGGCAGAATAGCTTGAACCTGG + Intronic
972689044 4:41378789-41378811 GAGGAACAAAAGATTGTAGTAGG + Intronic
973313388 4:48733179-48733201 GAAGAAGAATTGCTTGTACTCGG + Intronic
973725881 4:53775149-53775171 GAGGAAGAGTAACTTGTTCAAGG - Intronic
973814160 4:54603516-54603538 AAGGAAAATTAGATAGTACATGG + Intergenic
974099347 4:57399554-57399576 GAGGATGAATGGATGGTATAAGG + Intergenic
974875341 4:67697557-67697579 CAGGAAGAATAGATTAAGCAGGG - Intronic
975208482 4:71671205-71671227 GAGGCAGAATAGGTTATAAATGG + Intergenic
975562157 4:75718040-75718062 GAGGCAGAATAGCTTGAACCTGG + Intronic
976508654 4:85881431-85881453 GAGGAAGAATAGATTGTACAGGG + Intronic
976573757 4:86644226-86644248 GAGGCAGAATAGCTTGAACCTGG - Intronic
977405498 4:96592586-96592608 AAGGAAGAATAAATTGTTTAAGG - Intergenic
977471058 4:97443514-97443536 GAAGAAGAAAAGATTGGAGAAGG + Intronic
977788790 4:101073368-101073390 GAGGAAGAATCGCTTGAACCCGG - Intronic
978795117 4:112701153-112701175 GAGGGAAAATAGATGATACAGGG + Intergenic
979171413 4:117603829-117603851 GAGGAAGAATTGCTTGAACCTGG + Intergenic
979982175 4:127270720-127270742 AAGGAAGAAGAGATTACACAAGG + Intergenic
981070703 4:140534389-140534411 AAGGAAGAATTGATTGAAAAGGG + Intronic
981754067 4:148122100-148122122 GAGGTTGAATGGATAGTACATGG + Intronic
982595806 4:157381650-157381672 GCGAAAGAATAGCTTGAACATGG + Intergenic
982634425 4:157874952-157874974 GAGGTAGAATTGATTGGACTAGG - Intergenic
983112863 4:163774589-163774611 GAGGCAGAATAGCTTGAACCCGG - Intronic
983411145 4:167399654-167399676 GATGAAGAATTGATCATACATGG - Intergenic
984866762 4:184287582-184287604 GAGGTAGAAAAGATTATTCAGGG - Intergenic
985144248 4:186878172-186878194 GAGAAAGAATACATTCTACTTGG + Intergenic
985246652 4:187985655-187985677 GAGGCAGAATAGCTTGAACCTGG + Intergenic
986094476 5:4541070-4541092 GAGGAAGAACAGCATGTAGAAGG - Intergenic
986428659 5:7659940-7659962 AAGTAAGAATATATTGTACTTGG - Intronic
987352907 5:17036951-17036973 GAGGCAGAATAGCTTGAACCTGG + Intergenic
988213092 5:28233757-28233779 GGTGAAGAATAGATTGAAAAGGG - Intergenic
989415533 5:41171195-41171217 GAGGTAGAATGAATTGTGCATGG + Intronic
990628894 5:57645487-57645509 GAGGCAGAATAGTTTGAACCTGG + Intergenic
991248618 5:64534407-64534429 GTGTAAGAAAAGACTGTACAGGG + Intronic
992316002 5:75555642-75555664 GAGGGAGAATAGCTTGAACCCGG - Intronic
992705886 5:79391647-79391669 GAGGCAGAATAGCTTGAACCTGG + Intronic
992801121 5:80296964-80296986 GAGGCAGAATAGCTTGAACCTGG + Intergenic
992984685 5:82215839-82215861 GAGGCAGAATAGCTTGAACCTGG + Intronic
993512135 5:88783534-88783556 GAGGAAGAATTGCTTGAACCCGG + Intronic
993999032 5:94755961-94755983 GAGTAAGAATAGATTTTAGAGGG - Intronic
994706524 5:103213479-103213501 GAGGAAGAGTAGAGTTTAGAAGG - Intergenic
995902191 5:117083023-117083045 GCTGAAGAATACATTGCACAAGG + Intergenic
996143093 5:119939011-119939033 GAGGTAGAATACACTGCACATGG - Intergenic
996488642 5:124066428-124066450 GAGAAAGAATATATTGTAGCAGG + Intergenic
996762644 5:127001734-127001756 TGTGGAGAATAGATTGTACAGGG - Intronic
997556649 5:134805262-134805284 GAGGCAGAATAGCTTGAACCCGG - Intronic
997621592 5:135302063-135302085 GAGTAAGAATATATTTCACATGG + Intronic
997837152 5:137204560-137204582 GAGGTAGAATCTATGGTACAGGG - Intronic
998172254 5:139879553-139879575 GAGTAAGAATGGAATGGACAAGG + Intronic
998763583 5:145459478-145459500 GTGGAAGAATAGATTCTATGGGG - Intergenic
999034749 5:148334873-148334895 GCGGATAAATAGCTTGTACAAGG + Intronic
999068641 5:148718458-148718480 GAAGAATAATAGATTAGACAGGG + Intergenic
999195044 5:149776134-149776156 GAGTTAGAATAGAATGTACAGGG - Intronic
999294567 5:150450571-150450593 GAGGCAGAATAGCTTGAACCTGG - Intergenic
999880468 5:155857664-155857686 CAGGAAGGATAGATTATAAAGGG + Intergenic
1000711145 5:164580129-164580151 TAGAAAGTATGGATTGTACATGG - Intergenic
1000883676 5:166726284-166726306 AAGGAATAATATATTTTACAGGG - Intergenic
1001391091 5:171379873-171379895 GAGGAAGAATTGCTTGAACCCGG + Intergenic
1002687566 5:181025843-181025865 GAGGAAGAAGAGATGGTGAAAGG + Intergenic
1003368002 6:5495392-5495414 GAGCCAGAAGAAATTGTACATGG + Intronic
1003494268 6:6650426-6650448 GCGGAAGAATAGCTTGAACCTGG - Intronic
1004936857 6:20516302-20516324 GAGGCAGAATAGCTTGAACCTGG - Intergenic
1004985630 6:21079047-21079069 GAGGAAGAATGGCTGTTACAGGG + Intronic
1007556021 6:42767056-42767078 GAAGAAGAATAGATTGAACCTGG + Intronic
1008615205 6:53219696-53219718 CAGGAAGAATAGATTCTTGAGGG - Intergenic
1008713241 6:54255281-54255303 GAGGTAGAATAACTTGTTCAAGG - Intronic
1009924235 6:70100593-70100615 GAGGCAGAATTGCTTGAACACGG - Intronic
1011337539 6:86277695-86277717 GAGGAAGAAGAGTTTGTTCTTGG - Intergenic
1012491094 6:99783175-99783197 GAGGAAAAAGAGATAGTGCAGGG + Intergenic
1013088590 6:106877620-106877642 AAGGATGAATAGTTTGAACATGG - Intergenic
1013742859 6:113309270-113309292 GAAGAAGTAAAGATTGAACATGG - Intergenic
1013765286 6:113566920-113566942 GTGGAAGAATTGCTTGAACACGG + Intergenic
1014117671 6:117684510-117684532 GGTGAAGAATGGATTATACAGGG - Intronic
1015577106 6:134683415-134683437 GTGGAAGAATAGCTTGAACCTGG - Intergenic
1019964055 7:4484571-4484593 GAGGAAGAAGAGAGTGGAGAGGG + Intergenic
1020933035 7:14424351-14424373 GAGGAAGAATATTTTGAACAGGG - Intronic
1020990411 7:15188368-15188390 TAAGAAGAATAGCTGGTACATGG + Intergenic
1021167123 7:17354982-17355004 AAGGAAGAAAAGATTGGAAAAGG - Intergenic
1021220309 7:17968348-17968370 GAGGAGGAAAGGATTGTACCTGG + Intergenic
1021264849 7:18507586-18507608 GAGGCAGAATAGCTTGAACCCGG - Intronic
1021778639 7:24079488-24079510 GAGGAAAAATATATTGTGGATGG + Intergenic
1021783431 7:24129413-24129435 GAGGAAGAATAGACAGTGAAAGG + Intergenic
1022087496 7:27082625-27082647 GAAAAAGAATAGAATGTAAATGG + Intergenic
1022534584 7:31088037-31088059 GAGGAGGAATAAATTGTTAAAGG - Intronic
1022768644 7:33444813-33444835 CAGGGAGAATAGATTATACTGGG - Intronic
1023194837 7:37623661-37623683 ATGGGAGAATAGATTGTAGAGGG + Intergenic
1024188880 7:46984870-46984892 GAGGCAGAATTGCTTGAACACGG + Intergenic
1024429172 7:49266034-49266056 GAGGAAGAAGAAATTATAAAAGG - Intergenic
1024543038 7:50494606-50494628 GAGGAAGAAAAGAATTTCCAGGG + Intronic
1025005145 7:55348091-55348113 GAGGCAGAATAGCTTGAACCTGG - Intergenic
1025014008 7:55424217-55424239 GAGAAAGAAGAAAATGTACAAGG + Intronic
1026343281 7:69452466-69452488 GAGGCAGAATAGCTTGAACATGG - Intergenic
1026914277 7:74110625-74110647 GAGGCAGAATCGATTGAACCTGG - Intronic
1026935623 7:74253625-74253647 GAGGCAGAATTGATTGAACCAGG + Intronic
1026986925 7:74560676-74560698 GAGGCAGAATAGCTTGAACCTGG - Intronic
1027133279 7:75606480-75606502 GAGGCAGAATTGCTTGAACACGG + Intronic
1027260177 7:76459279-76459301 GAGGAAGAATTGCTTGAACCTGG + Intergenic
1027311552 7:76957383-76957405 GAGGAAGAATTGCTTGAACCTGG + Intergenic
1027794371 7:82674169-82674191 GACGCAGAAGAGAATGTACAAGG + Intergenic
1028218806 7:88169390-88169412 GTGGAAGACTACATGGTACAGGG - Intronic
1029582242 7:101444935-101444957 GAGGCAGAATAGCTTGAACCTGG - Intronic
1030260436 7:107558508-107558530 GTGGAAGAATAGCTTGAACCCGG + Intronic
1030297332 7:107942086-107942108 GAGGCAGAATAGCTTGAACCCGG - Intronic
1030445218 7:109640740-109640762 AAGGAAGAAGAGATAGTAAAAGG + Intergenic
1030506801 7:110434717-110434739 GAGGAAGAATTCAGTGAACACGG + Intergenic
1031376701 7:121035289-121035311 GAAGAAAAATAGATTCTAGAAGG + Intronic
1031526445 7:122826697-122826719 GTGGCAGAATAGATGGGACAGGG + Intronic
1032145552 7:129376468-129376490 AAAGAAGACTAGGTTGTACAAGG - Intronic
1033203194 7:139392747-139392769 GAGGCAGAATAGCTTGAACCTGG - Intronic
1035725297 8:1821045-1821067 GAGGCAGAATAGCTTGAACCAGG + Intergenic
1036815126 8:11896629-11896651 GAGGCAGAATTGCTTGAACACGG + Intergenic
1037141732 8:15527845-15527867 GAGGAAGAGGAGAATGTATACGG - Intronic
1037672496 8:21027372-21027394 GAGAAAGAATCGATAGAACATGG + Intergenic
1038586377 8:28792932-28792954 AAAGAAGAATAATTTGTACATGG + Intronic
1039812893 8:41065436-41065458 GAGGGAGAATTGCTTGAACACGG + Intergenic
1041107336 8:54455736-54455758 GAGGATGAAGAAAGTGTACAGGG + Intergenic
1041834162 8:62192976-62192998 GATGAAGAATAAAATGTGCAGGG + Intergenic
1042646594 8:70993704-70993726 CAGAAAGAATAGATTGTAGCTGG + Intergenic
1043078301 8:75730752-75730774 AAGGAAGAAAAGAATGTAAAAGG + Intergenic
1044861826 8:96531174-96531196 GAGGTAAAGTAGATTGTTCAAGG + Intronic
1044927290 8:97220415-97220437 GAGGAAAAATAAATTGTACATGG - Intergenic
1045677226 8:104620605-104620627 GATGAAGAGTAGATTGGAGAGGG + Intronic
1045943581 8:107768574-107768596 GAGAAAGATAAGATTGGACAGGG + Intergenic
1046711433 8:117515937-117515959 CAGGAAGAATAGATTGTTTCAGG - Intergenic
1047648280 8:126892061-126892083 GAGGTAGAGTAAATTGTCCATGG + Intergenic
1047925060 8:129674600-129674622 GAGGAAGAATTAATTGCAAATGG - Intergenic
1048392422 8:133980301-133980323 GAGGAGAAATAGAGTGTAGATGG - Intergenic
1048605758 8:135967150-135967172 CAGAAAGAATAGATGGTACCTGG - Intergenic
1050154815 9:2655275-2655297 GACAAAGAAAAAATTGTACAGGG + Exonic
1050845709 9:10215093-10215115 GAGAAAGAAAAGATTGTGCTTGG - Intronic
1051052146 9:12947469-12947491 GAAGAAAAAGAGATTGTATAAGG + Intergenic
1051070207 9:13156680-13156702 GAGGAAAAGTAGATTTTAGAAGG - Intronic
1051294708 9:15583316-15583338 GAGGCAGAATAGCTTGAACCTGG + Intronic
1052401912 9:28011385-28011407 TAGCAAGAATAGAGAGTACAGGG + Intronic
1054961315 9:70973154-70973176 GTGGAATAAATGATTGTACATGG - Intronic
1055741962 9:79399283-79399305 TAGGAAGAAAAGAAGGTACATGG + Intergenic
1056560745 9:87726943-87726965 GAGGAAGAATGGCTTGAACCCGG + Intronic
1056947064 9:91006654-91006676 GAGGATGCATAATTTGTACATGG - Intergenic
1057466488 9:95318516-95318538 GAGGCAGAATAGCTTGAACCAGG + Intergenic
1057974455 9:99589990-99590012 GAGGAAGAACAAATTGCACAGGG + Intergenic
1059873664 9:118607112-118607134 GAGGAAAGATATATAGTACATGG - Intergenic
1059943895 9:119386239-119386261 GAGGCAGAATAGCTTGAACCCGG - Intergenic
1186239655 X:7552818-7552840 GAGGGAGAACAGATTTCACAGGG - Intergenic
1186582891 X:10839999-10840021 CGTGAAGAATAGATTGTAGAGGG - Intergenic
1187668095 X:21638211-21638233 GAGGAGGATTAGATTATAGAGGG - Intronic
1187765311 X:22635199-22635221 GAGGAAGGATAAAATTTACAGGG - Intergenic
1188910182 X:35837833-35837855 GAGAAAGAATAGACTCTTCAAGG - Intergenic
1189729705 X:44006253-44006275 GAGGAAGCATTGATTATTCAAGG + Intergenic
1190021557 X:46882846-46882868 GAGGAAGAATTGTTTGAACCTGG - Intergenic
1190063923 X:47227413-47227435 GAGGAAGAATGGATGTTTCATGG - Exonic
1190689175 X:52899317-52899339 GAGGAATAAAATATTGTCCAAGG - Intronic
1190696808 X:52956475-52956497 GAGGAATAAAATATTGTCCAAGG + Exonic
1191661063 X:63651292-63651314 GAATAAGAATTGATTGTACCAGG + Intronic
1192478167 X:71461554-71461576 GAGGAAGAATACATATTAGATGG + Intronic
1194180260 X:90702904-90702926 GTGGAATCATAGATAGTACATGG - Intergenic
1194476301 X:94363868-94363890 GAGTAAGCATAACTTGTACAAGG - Intergenic
1195385109 X:104306713-104306735 GAGGGAGAATCGCTTGAACACGG - Intergenic
1195710561 X:107770222-107770244 GAGGAATTTTAGATGGTACATGG + Intronic
1196469182 X:116006354-116006376 GTGGGAGAATAGATTGCCCAGGG + Intergenic
1197637207 X:128928482-128928504 GAAGAAGAACAGAATGTAAAGGG - Intergenic
1197842203 X:130760690-130760712 GTGGAAGAATAGCTTGAACCTGG + Intronic
1198685986 X:139228642-139228664 GAGAAGGAATAGATTATACAGGG + Intergenic
1199105311 X:143859331-143859353 CAGGAAGATCATATTGTACAAGG - Intergenic
1199315088 X:146367466-146367488 GAGAGAGAAGAGAATGTACACGG + Intergenic
1200282470 X:154789266-154789288 GTAGAGGAATAGATTGGACAGGG - Intronic