ID: 976515229

View in Genome Browser
Species Human (GRCh38)
Location 4:85956792-85956814
Sequence CAGCAAAAAGCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 733
Summary {0: 1, 1: 33, 2: 92, 3: 149, 4: 458}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976515225_976515229 0 Left 976515225 4:85956769-85956791 CCAGGGTGGAAGTCAGCGGCAGG 0: 1
1: 0
2: 0
3: 38
4: 795
Right 976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG 0: 1
1: 33
2: 92
3: 149
4: 458
976515223_976515229 4 Left 976515223 4:85956765-85956787 CCAGCCAGGGTGGAAGTCAGCGG 0: 1
1: 0
2: 0
3: 14
4: 195
Right 976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG 0: 1
1: 33
2: 92
3: 149
4: 458
976515221_976515229 11 Left 976515221 4:85956758-85956780 CCGACACCCAGCCAGGGTGGAAG 0: 1
1: 0
2: 2
3: 32
4: 261
Right 976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG 0: 1
1: 33
2: 92
3: 149
4: 458
976515222_976515229 5 Left 976515222 4:85956764-85956786 CCCAGCCAGGGTGGAAGTCAGCG 0: 1
1: 0
2: 0
3: 12
4: 170
Right 976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG 0: 1
1: 33
2: 92
3: 149
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976515229 Original CRISPR CAGCAAAAAGCAGTGGTGGA TGG Intronic
901092439 1:6650967-6650989 CAGATAAAAGAATTGGTGGAGGG - Intronic
901988173 1:13092171-13092193 CAGCAACAGGCACTAGTGGAAGG - Intergenic
901993639 1:13134596-13134618 CAGCAACAGGCACTAGTGGAAGG + Intergenic
902872342 1:19322145-19322167 CAGCAAGCATCAGTGGTGGGGGG + Intronic
903376869 1:22872051-22872073 AAGCTAAAAGCAGTGTTGGCAGG + Intronic
904703498 1:32373361-32373383 CAGAAAAAATCAGTAGTGGTTGG - Intronic
904842909 1:33385150-33385172 CTGCAAAAAGCAGATGTAGAAGG + Intronic
905937002 1:41832653-41832675 CAGCACAAAGCAGTGGTGCCTGG + Intronic
907195680 1:52684791-52684813 CAGTAAAAAGCAGTGGGTGGGGG - Exonic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907572958 1:55500709-55500731 CAACAAAAATCAGTGGGGAATGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907602967 1:55788546-55788568 CAGCAAAAAGCCATGGTGGACGG + Intergenic
907829167 1:58048074-58048096 CAGCCAAACACAGTGGTGGCAGG - Intronic
908684407 1:66699321-66699343 CAGCAATAAGGAGTGGAAGAGGG - Intronic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
909551787 1:76906173-76906195 CAGCAGAAAGAAGTGTTGGCAGG - Intronic
909715383 1:78701639-78701661 CAGCACAATGCAGTGGAGCAGGG + Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910515107 1:88052428-88052450 CAGCAAAAGGGAGTGGTCAATGG - Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
911872928 1:103121901-103121923 ATGGAAAAAGCAGTGTTGGAGGG + Intergenic
912103654 1:106243427-106243449 TGGCAAAAAGCAGTGTTGGCAGG + Intergenic
913599278 1:120407335-120407357 AAGAAAAAAGCAGTGGGAGAAGG - Intergenic
913703513 1:121396767-121396789 CGGCAAAAAGCCGTGGCGGCGGG - Intergenic
913703523 1:121396811-121396833 CAGCAAAAAGCCGCGGCGGCGGG - Intergenic
914044041 1:144076996-144077018 CGGCAAAAAGCCGTGGTGGCGGG - Intergenic
914044087 1:144077121-144077143 GAGCAAAAAGCCGCGGTGGCGGG - Intergenic
914088101 1:144472285-144472307 AAGAAAAAAGCAGTGGGAGAAGG + Intergenic
914133941 1:144883212-144883234 CCGCAAAAAGCAGCGGCGGCGGG + Intergenic
914134016 1:144883472-144883494 CGGCAAAAAGCCGTGGTGGCGGG + Intergenic
914310513 1:146461924-146461946 AAGAAAAAAGCAGTGGGAGAAGG - Intergenic
914314666 1:146498828-146498850 AAGAAAAAAGCAGTGGGAGAAGG + Intergenic
914499685 1:148234560-148234582 AAGAAAAAAGCAGTGGGAGAAGG - Intergenic
914591597 1:149111217-149111239 AAGAAAAAAGCAGTGGGAGAAGG + Intergenic
915051746 1:153082699-153082721 CAGCAAAAAGCAGTGCTAACAGG + Intergenic
915053339 1:153101673-153101695 CAGCAAAAAGCAGTGCTAACAGG + Intronic
915687586 1:157650178-157650200 CAGTCAAAAGCACTGATGGATGG - Intergenic
915733481 1:158070176-158070198 CAGGAAGAAGGAGTGGTAGATGG + Intronic
915847281 1:159279629-159279651 GAGCAGAAAGCAGTTGTTGATGG + Intergenic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917255086 1:173106727-173106749 TAGCACAAAGAAGAGGTGGAGGG - Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917525175 1:175782040-175782062 GAGAAAAAGGCAGTGGGGGAGGG - Intergenic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918533883 1:185552862-185552884 AAGCAAAAAGAAGGGGTGGTAGG - Intergenic
918943618 1:191032080-191032102 CAGAAACAAGCATTGGTGAAAGG + Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919541013 1:198845488-198845510 CAGGAGAAAGCAGTGCTGGCTGG + Intergenic
919754561 1:201058704-201058726 GAGCAGAAAGTAGTGGTGGGGGG + Intronic
920160755 1:203996212-203996234 CAGCCAAAAGCGCTGCTGGATGG + Intergenic
920227729 1:204450444-204450466 CAGCAGCAAGAAGTGGGGGAGGG - Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921562774 1:216678466-216678488 TGGCAAAAAGAAGTGGGGGAAGG - Intronic
922196108 1:223362445-223362467 CAGCAATGAGCAGTGGAGGCAGG + Intronic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1063019199 10:2109400-2109422 GAGGAAAAAGTTGTGGTGGAAGG - Intergenic
1064158970 10:12927247-12927269 TAGCAAAAAGTAGTTGGGGAAGG - Intronic
1064423403 10:15209715-15209737 CAGCTAGAAACAGTGGTGCACGG - Intergenic
1065156949 10:22880399-22880421 CAGCATAAAGCAGTGCTGTGAGG - Intergenic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1065961509 10:30737804-30737826 CAGCAAAAAAGACTGGTGAAGGG - Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1066780757 10:38942735-38942757 TGGCAAAAAGCGGTGGTGGCAGG - Intergenic
1066950375 10:42111512-42111534 CAGCGAAAAGCTGTAGTGGCGGG + Intergenic
1066950468 10:42111917-42111939 GGGCAAAAAGCCGTGGTGGTGGG + Intergenic
1066950568 10:42112407-42112429 CTGCAAAAAGCAGCGGCGGTGGG + Intergenic
1066950638 10:42112695-42112717 CTGCAAAAAGCAGCGGCGGCGGG + Intergenic
1066954502 10:42150944-42150966 GAGCAAAAAGCCGTGGCGGCGGG + Intergenic
1066956307 10:42177154-42177176 CAGCAAAAAGCCACGGTGGCGGG - Intergenic
1066963854 10:42243272-42243294 CGGCAAAAAGCCGCGGTGGCAGG - Intergenic
1067790990 10:49287701-49287723 CAGCCACAAGCAGTGTTGGGAGG + Intergenic
1068409595 10:56637667-56637689 CAAAAACAAGCAGTGGTGAAAGG - Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1069285859 10:66714587-66714609 CTCAAAAAAGCAGAGGTGGATGG - Intronic
1070082934 10:73206634-73206656 CAGCAAAAAGCAGTGTCCCAAGG - Intronic
1070486652 10:76938306-76938328 CAGGAGAAAGCAGTGTTGGGAGG - Intronic
1070711891 10:78689061-78689083 CAGCACCAGGCAGAGGTGGAGGG - Intergenic
1070789501 10:79180960-79180982 CAGAAAAAAGCAGTGGGAGGAGG - Intronic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071454141 10:85830190-85830212 CAGAAACAAGCAATGGGGGAGGG + Intronic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072478478 10:95786338-95786360 GAGCAATAAGCAATGGAGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1072682872 10:97519228-97519250 CAGCAAAAAGAACTTTTGGATGG + Intronic
1073816319 10:107211792-107211814 CAGCAAAAAGCAGTGTTAAGGGG - Intergenic
1073902846 10:108244017-108244039 CAGCAAAAAGAAGGGATGCAGGG - Intergenic
1074155589 10:110796044-110796066 CAGCAAAAACCTGTGGTTTAGGG - Intronic
1074164610 10:110864046-110864068 CTGCAAAGTGCAGTGGTGGCCGG + Intergenic
1074176611 10:111011734-111011756 CAGCAACAATCTGAGGTGGAAGG - Exonic
1074379253 10:112965336-112965358 CAGCAGAATGCAGTAGAGGAGGG + Intronic
1074766313 10:116702471-116702493 CAGCAAATATCAGTGGAGGCCGG - Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077368284 11:2170079-2170101 CAGTCAGAAGCAGTGGTGGTGGG + Intronic
1077471911 11:2767756-2767778 GAGCAAAAAGCAGTTGCTGAAGG - Intronic
1078153566 11:8779143-8779165 CAGGACAATGGAGTGGTGGAGGG + Intronic
1079601746 11:22317941-22317963 CAGCCAGCAGCAGTGGTGCAGGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079933258 11:26590806-26590828 CTGCAAATGGCAGTGGTGGACGG + Intronic
1080122926 11:28698088-28698110 CAGCAAATAGCAGTTGAGGCTGG - Intergenic
1080464146 11:32481278-32481300 CAGCCACAACCAGTGGGGGATGG - Intergenic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081061939 11:38490000-38490022 CAGCAACAAGCAATGGGGAAAGG - Intergenic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1082767690 11:57181991-57182013 CAGGCAACAGCAGTGCTGGAGGG - Exonic
1084137866 11:67200619-67200641 CAGCTAAAGGCTGAGGTGGAAGG - Intronic
1084286711 11:68136272-68136294 CAGCAGGAAGCAGTTGTAGAGGG + Intergenic
1084462518 11:69303814-69303836 CAGCGAAGACCAGTGGTGGTCGG + Intronic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085652275 11:78278980-78279002 CAGTAAAAAAAAGTGGTAGAGGG - Intronic
1087694127 11:101356163-101356185 CAGCTAAAATCAGTGGAGCAGGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088533418 11:110835176-110835198 CAGTAAGAAATAGTGGTGGAGGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089160248 11:116431895-116431917 CAGCAAAATGGAGTTGTGAAGGG - Intergenic
1089697904 11:120227053-120227075 CAGCACAGAGCAGTGGAGGAGGG + Intronic
1089933140 11:122334632-122334654 CAGCTAGAAGCAGTGGTAGGAGG - Intergenic
1090150027 11:124374326-124374348 CACCAGAATGCAGTGGTGGGGGG - Intergenic
1090855452 11:130606667-130606689 AAGCAAAGAGCAGAGGTGAAGGG - Intergenic
1091325111 11:134680321-134680343 CAGCAAACAGCAGTGGCTGCTGG - Intergenic
1091822595 12:3487402-3487424 CAGCAAAAGGAAGTGTTGGTTGG + Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095315556 12:40756553-40756575 CAACAAGAAGCAGTACTGGATGG + Intronic
1095552470 12:43459166-43459188 CAGCAAACAGCAGTGGTAGGCGG - Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096754668 12:53789066-53789088 CAGCCAAGATCAGGGGTGGAAGG - Intergenic
1096816738 12:54206430-54206452 CAGCAAGAAGCAGAGGAGGTGGG + Intergenic
1096928435 12:55175381-55175403 CAGCATCAAGGAGTGGAGGAAGG - Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098176352 12:67795601-67795623 CAGAAAAAAACAGTGCTGTAGGG + Intergenic
1098611883 12:72468756-72468778 CAGCAACAGGCAGTGGCGGCTGG - Intronic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099529212 12:83755538-83755560 CAGCATAAAGCCAAGGTGGAAGG + Intergenic
1100816913 12:98395662-98395684 CACCAAAGAAGAGTGGTGGAGGG + Intergenic
1101075272 12:101122643-101122665 CAAAAACAAGCAGTGGGGGAAGG - Intronic
1101555299 12:105803059-105803081 CGGCAAGTAACAGTGGTGGATGG + Intergenic
1101655561 12:106717078-106717100 CAGGAAAAAGCAGAAGAGGAAGG - Intronic
1102519832 12:113471445-113471467 CAGCAGAAAGCGGTCGAGGATGG + Exonic
1102833045 12:116025066-116025088 CAGAACAAAGCAGTGGTGGGGGG - Intronic
1103108847 12:118256297-118256319 CAGCTACCAGCAGTGTTGGAGGG - Intronic
1103111244 12:118280454-118280476 CAGAAACAAGCAATGGGGGATGG - Intronic
1103168221 12:118789290-118789312 CAGGAAACAGCAGTGGGTGATGG - Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104404484 12:128506207-128506229 CAGGAGAAAGCAGTGGGGAATGG + Intronic
1104709394 12:130974834-130974856 CTGGAAGAAGCAGGGGTGGAGGG - Intronic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1106594210 13:31122960-31122982 CAGAAAGAAGCTGGGGTGGAGGG + Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1108557253 13:51606010-51606032 TGGCAAAAGGCAGTGTTGGATGG + Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108907336 13:55494414-55494436 CAGTAAAAACAAGTGGTGCATGG - Intergenic
1108922949 13:55698896-55698918 CAGCAAAAAACAGTTATTGATGG - Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109380903 13:61558304-61558326 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110310057 13:74038460-74038482 CGACAAAAAGCAGTGCAGGAGGG + Intronic
1110502491 13:76244708-76244730 CAGCATAACTCAGTGGAGGATGG + Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1111947493 13:94681218-94681240 GGGAAAAAAGCAGTGGAGGATGG + Intergenic
1111997022 13:95175466-95175488 ATACAAAAATCAGTGGTGGATGG - Intronic
1113197395 13:107824333-107824355 CTGCAAAAAGTATTTGTGGAAGG + Intronic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114390319 14:22301150-22301172 AGGCAAAAAGCAATGTTGGATGG + Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1115485701 14:33909325-33909347 CAACAAAAAACAGTGTTGGCTGG - Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1116740324 14:48746699-48746721 CAACAAACAACAGTGGTGGATGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117901708 14:60540640-60540662 CAAAAAAAAGCAGTGGAGAAAGG - Intergenic
1118437009 14:65780642-65780664 CAGGGCAAAGCAGTGGTGGAAGG + Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119142733 14:72282513-72282535 TAGCATTAAGCAGGGGTGGACGG - Intronic
1119387272 14:74265573-74265595 CAGCACAAAGGAAAGGTGGAGGG + Intergenic
1119387668 14:74267907-74267929 CAGCAGCAAGGAGTGGGGGAGGG - Intergenic
1120097376 14:80403859-80403881 CAGTGATCAGCAGTGGTGGACGG - Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120124537 14:80725477-80725499 CAGGAAAAAGCACTGGGGGCTGG - Intronic
1120317318 14:82912174-82912196 TAGCAAACAGCAGTAGTGCAGGG + Intergenic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1122330239 14:100907023-100907045 CTGCAAAATGGAGAGGTGGAAGG + Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1202939978 14_KI270725v1_random:137015-137037 CCGCAAAAAGTAGTGGCGGCGGG + Intergenic
1123396840 15:19944694-19944716 CCGCAAAAAGCCGCGGTGGTGGG - Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124286729 15:28406719-28406741 CAGCAAAAAGCAGTAGTAAGAGG - Intergenic
1124295974 15:28504917-28504939 CAGCAAAAAGCAGTAGTAAGAGG + Intergenic
1125714289 15:41810418-41810440 CAGGAGAAAGCAGTGGAGGCTGG + Intronic
1125874981 15:43136033-43136055 CAGAAAAAAGGACTGGGGGATGG - Intronic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126482444 15:49140964-49140986 AAGAAAACAGCAGAGGTGGATGG + Intronic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1126846516 15:52765565-52765587 CAGTAAAACGCAGTGGGGGTAGG + Intronic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1127001018 15:54505283-54505305 CAGAGAAAAGCTGTGATGGACGG - Intronic
1127027006 15:54817839-54817861 CAGCAGAAAGCAGAGGTCGAAGG - Intergenic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1127218429 15:56849883-56849905 CAGCAAAAAGCAGGGGTCAGAGG + Intronic
1127309169 15:57737352-57737374 CACAAAAAAGAAGGGGTGGAGGG - Intronic
1127659650 15:61088457-61088479 AAGCAAAAAGCGGTGGGGGATGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129378105 15:75146931-75146953 CTACAAAAAGCACTGGTGGGAGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130196131 15:81781943-81781965 CAGAAAGAAGCAGAGATGGATGG + Intergenic
1130252593 15:82309826-82309848 TAGCAAAAAGCAATGGAGGGTGG - Intergenic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132406756 15:101546381-101546403 AAGCAACAAGCAGTGATGGAGGG + Intergenic
1133254603 16:4508972-4508994 CAGCAAGCAGCACTGGTGGGCGG - Intronic
1135017211 16:18933849-18933871 CAGCAAACATCAGGGATGGAAGG + Intergenic
1136388874 16:29949173-29949195 CATTAAAAAGCAGTGGGGGCTGG - Intronic
1136670745 16:31854882-31854904 CAGATGACAGCAGTGGTGGATGG - Intergenic
1136696500 16:32085422-32085444 CAGCAAAAAGCCGCGGCGGCGGG + Intergenic
1136699192 16:32116436-32116458 CAGCAAAAAGCCGCGGCGGCGGG - Intergenic
1136796998 16:33028696-33028718 CAGCAAAAAGCCGCGGCGGCGGG + Intergenic
1136799683 16:33059607-33059629 CAGCAAAAAGCCGCGGCGGCGGG - Intergenic
1136938754 16:34500463-34500485 CTGCAAAAAGCAGCGGTGGTGGG + Intergenic
1136961065 16:34848093-34848115 CTGCAAAAAGCAGCGGTGGTGGG - Intergenic
1137084296 16:36101635-36101657 CGGCAAAAAGCCGCGGTGGCGGG + Intergenic
1137218925 16:46427910-46427932 CCGCAATAAGCAGTGGCGGCAGG + Intergenic
1137218957 16:46428067-46428089 CTGCAAAAAGCCACGGTGGAGGG + Intergenic
1137219030 16:46428391-46428413 GAGCAAAAAGCCATGGCGGAGGG + Intergenic
1138154793 16:54693204-54693226 TTGCAAATTGCAGTGGTGGAGGG - Intergenic
1138943869 16:61823589-61823611 CAGAAAAAAACATTGGAGGAAGG + Intronic
1139102508 16:63785620-63785642 CAGCAAGAAGCAGTTATAGAAGG - Intergenic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141649238 16:85384366-85384388 CAGTAAACAGCAGAGGTGGGAGG - Intergenic
1141705410 16:85661851-85661873 AGGCAAAAAGCAGGAGTGGACGG - Intronic
1142228696 16:88889381-88889403 CAGGAAAAAGCAGAGGAGGCAGG + Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1142735935 17:1899597-1899619 CAGGAAACAGAAGTGGGGGAGGG - Intronic
1143970253 17:10790142-10790164 CAGAAAAAAGCTTTGATGGAGGG + Intergenic
1144068512 17:11645823-11645845 CACCTAATAGCAGAGGTGGAAGG - Intronic
1145327516 17:21843632-21843654 CCGCAAAAAGCAGCGGCGGCGGG - Intergenic
1145327554 17:21843776-21843798 CAGCAAAAAGCCTTGGCGGCGGG - Intergenic
1145327574 17:21843857-21843879 CCACAAAAAGCAGTGGCGGCGGG - Intergenic
1145690102 17:26731351-26731373 CCGCAAAAAGCCGCGGTGGCGGG - Intergenic
1145693139 17:26765937-26765959 GAGCAAAAAGCCGCGGTGGCGGG - Intergenic
1145694003 17:26773686-26773708 CGGCAAAAAGCCGTGGCGGCGGG - Intergenic
1145694153 17:26774315-26774337 CCGCAAAAAGCAGCGGCGGCGGG - Intergenic
1145694161 17:26774347-26774369 CAGCAAAAAGCCGCGGTGGTGGG - Intergenic
1145694374 17:26775165-26775187 CCGCAAAAAGCAGCGGCGGCGGG - Intergenic
1145694404 17:26775283-26775305 GAGCAAAAAGCCGCGGTGGCGGG - Intergenic
1148229740 17:45924439-45924461 CAGCAAAGAGGAGTGGAGGCCGG - Intronic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149776886 17:59365325-59365347 CCCCAGAAAGCTGTGGTGGAAGG - Intronic
1150970843 17:70025863-70025885 CAGAAACAAGCAATGGGGGAAGG + Intergenic
1151017843 17:70577585-70577607 CGGCGAACAGCAGTGGTGAACGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151412808 17:73942423-73942445 AAGCAAAGAGCAGTGGTTGTTGG + Intergenic
1152123976 17:78435351-78435373 CAGGAAGAAGCGGTGGTGGGTGG - Intronic
1152218475 17:79048118-79048140 CAGCACAGCGCAGGGGTGGAAGG - Exonic
1152791873 17:82284479-82284501 AGGCAGAAAGCAGTGGGGGAGGG + Intergenic
1203192169 17_KI270729v1_random:199868-199890 CCGCAAAAAGCAGCGGCGGCGGG - Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153434663 18:5056687-5056709 CAGAGAAAAACAGTGGTAGAGGG + Intergenic
1154169015 18:12037425-12037447 CAGCAAAATGGAGTGGTGGGAGG - Intergenic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1157054582 18:44211508-44211530 CAGAAACAAGCAGTGGGGAAAGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158574274 18:58623087-58623109 CAGAAAAAAGCAGTGGTGTGAGG + Intronic
1159096924 18:63913427-63913449 CAGCGAAAAGCAGTGTTAGGAGG - Intronic
1160057977 18:75503900-75503922 CATCAAAAAGCAAAGGTGGCAGG - Intergenic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1163894815 19:20049452-20049474 CAGGAAAAACTAGTGGAGGATGG + Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164856395 19:31527868-31527890 CAGCAAAATGCAGTTGTAGAGGG - Intergenic
1165093342 19:33397678-33397700 CAGCAAAGCCCAGTGGTGGGTGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1202680270 1_KI270712v1_random:2949-2971 CAGCAAAAAGCCGCGGTGGCGGG + Intergenic
1202683272 1_KI270712v1_random:29309-29331 CGGCAAAAAGCCGTGGTGGCGGG - Intergenic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG + Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925038374 2:709636-709658 CTGCCAGAAGCAGTGGTGCACGG + Intergenic
926599797 2:14830188-14830210 CAGCAATGAGCAGAGGTAGAGGG + Intergenic
926966714 2:18423093-18423115 AAGCATAAAACAGTGGTGGGAGG + Intergenic
927466703 2:23342108-23342130 CAGGAAAATGCAGTGATGGGAGG - Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928026404 2:27742963-27742985 CATCAAAAATAAATGGTGGAGGG - Intergenic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928674557 2:33637542-33637564 CAGCCAAATGCAGTGGTGGCAGG + Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929213932 2:39390585-39390607 CAGCAAGAGGCACTGGAGGAAGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930190999 2:48459835-48459857 CAGCACCAAGCTGTGGTTGACGG + Exonic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931190722 2:59997610-59997632 CAGCAAGGAGAAGTGGTGGGAGG + Intergenic
931471321 2:62540440-62540462 CAGCTCTAAGCAGAGGTGGAAGG - Intergenic
932399913 2:71473200-71473222 AAACAAAAAGCAGAGGTAGATGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
933039389 2:77443364-77443386 CAGCAAAAAGCAGTGGCACCAGG + Intronic
933200573 2:79443389-79443411 CAGAAAAAAAAAGTGGAGGAAGG - Intronic
933938207 2:87224107-87224129 CATCCAAATGCAGTGGTGAAGGG - Intergenic
934304312 2:91809391-91809413 CGGCAAAAAGCTGCGGTGGTGGG - Intergenic
934328943 2:92043359-92043381 CGGCAAAAAGCTGCGGTGGTGGG + Intergenic
934331604 2:92074173-92074195 CCGCAAAAAGCAGCGGCGGTAGG - Intergenic
934331661 2:92074448-92074470 CCGCAAAAAGCAGCGGTGGTGGG - Intergenic
935535209 2:104285639-104285661 AAGGGAAAAGAAGTGGTGGAGGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
935958000 2:108397862-108397884 CAGCAAAAGGTGGTGGTGGTGGG - Intergenic
936354929 2:111741668-111741690 CATCCAAATGCAGTGGTGAAGGG + Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937187525 2:120058562-120058584 GATCAAAAAGGATTGGTGGAGGG + Intronic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
937733472 2:125261592-125261614 CAGAAAAAAGAAGTGATGCAGGG - Intergenic
937862646 2:126723000-126723022 CAGCAGACAGCAGTGGCAGAGGG + Intergenic
938518288 2:132038255-132038277 CAGCAAAAAGCCGCGGCGGCGGG + Intergenic
938645480 2:133325930-133325952 CATCAAAAAGAAGTTGTTGATGG + Intronic
939067121 2:137496944-137496966 CAGCAAATTGCAGAAGTGGAAGG + Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939494109 2:142907501-142907523 TGGCAAATAGCAGTTGTGGATGG + Intronic
940242808 2:151581182-151581204 AAGGAAAAAGCAATGATGGATGG + Intronic
940243766 2:151591733-151591755 AAGGAAAAAGCAATGATGGATGG + Intronic
940244722 2:151602286-151602308 AAGGAAAAAGCAATGATGGATGG + Intronic
940284699 2:152022315-152022337 CATCAAGGAGAAGTGGTGGAGGG + Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940881811 2:158954196-158954218 CAGCAAAATGGATTGGGGGAGGG + Intergenic
942179486 2:173366495-173366517 CAGAAAAAGGCATTGGTGAAGGG + Intronic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
943955869 2:194188397-194188419 CAGCCAAACACAGTGGTGGCAGG + Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
946094227 2:217258674-217258696 CAGCAAAAAGACATGGTTGAGGG + Intergenic
947758946 2:232589139-232589161 CAGCGAGAGGCAGTGCTGGATGG - Intergenic
948725854 2:239933453-239933475 CAGCCTACAGCAGTGGTGGCAGG - Intronic
948922632 2:241072906-241072928 CTCCAAGAAGCAGGGGTGGAAGG + Intronic
948981143 2:241495480-241495502 CAGCACACTGCAGGGGTGGAAGG + Exonic
1168840772 20:908673-908695 CCTCAATAAACAGTGGTGGAAGG + Intronic
1168938351 20:1687200-1687222 AATCTAAATGCAGTGGTGGATGG - Intergenic
1170791114 20:19510377-19510399 CAGCACACAGCAGTGGGGCATGG - Intronic
1171187892 20:23136614-23136636 CAGCAAGCCGCAGAGGTGGACGG + Intergenic
1171448362 20:25220205-25220227 CAGCAAACAGCAGTCGCGGCTGG + Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172240234 20:33408261-33408283 CTGCAAAAGGCACTGGTGGAGGG + Exonic
1172781662 20:37440101-37440123 AAGCAAACAGCAGAGGTGGCAGG - Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173899969 20:46580580-46580602 CAGTAAAAGCCAGAGGTGGAAGG + Intronic
1174264582 20:49322141-49322163 CAGCTAGAAGCACTGGGGGATGG + Intergenic
1174772801 20:53317083-53317105 TAGCAAAAGGCAGTGGTCCAAGG + Intronic
1176583212 21:8550064-8550086 CCGCAAAAAGTAGTGGCGGCGGG - Intergenic
1176743356 21:10627593-10627615 CCGCAAAAAGCCGCGGTGGTGGG - Intergenic
1177073630 21:16544053-16544075 CACCAAAATGGAGTGGTGAATGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179444728 21:41423260-41423282 CAGCAAATGGCAGTGGTGGATGG + Intronic
1180266011 22:10526956-10526978 CCGCAAAAAGTAGTGGCGGCGGG - Intergenic
1180269574 22:10572190-10572212 CGGCAAAAAGCCGCGGTGGTGGG - Intergenic
1180281488 22:10699886-10699908 GAGAAAAAAGCCGTGGTGGCAGG - Intergenic
1181626924 22:24128663-24128685 GAGGAAACAGGAGTGGTGGAGGG - Intronic
1182204965 22:28614675-28614697 CAGCAACAAGCAATGGGGGAAGG + Intronic
1183053897 22:35289160-35289182 AAGAAAAACGCAGTGGTGGCTGG + Intronic
1183237255 22:36628770-36628792 AAGAAAAAAGCAGTGGGGGTTGG - Intronic
1184178124 22:42801399-42801421 CAGCAAACATCAGTTGTGGGTGG - Intronic
1203238738 22_KI270732v1_random:32042-32064 GAGAAAAAAGCCGTGGTGGCAGG - Intergenic
1203325057 22_KI270738v1_random:5181-5203 CAGCAAAAAGCCGCGGCGGCGGG + Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950186336 3:10947938-10947960 GAGCAAAGGGCACTGGTGGAAGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
951591925 3:24275670-24275692 CGGCAAAAACCAGAGTTGGATGG - Intronic
952556502 3:34537560-34537582 CAGAAAGAGGCAGTGGTGCAGGG + Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
952941907 3:38452158-38452180 AAGCAAGAAGCAGTGTTGTATGG - Intergenic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
953766505 3:45747262-45747284 CACCAACAAGCACTGGTGGAGGG + Intergenic
954130958 3:48560771-48560793 CAGCAAAGAGCAGAGCAGGAGGG + Intronic
954753332 3:52825941-52825963 CAGCAAGAAACAGTCCTGGACGG - Exonic
955083561 3:55680010-55680032 CAAATAAAAGCAGTGCTGGATGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955873054 3:63460256-63460278 CTGCATAAAGCAGTGATGTAAGG - Intronic
956068713 3:65424562-65424584 CAGCAAAAGCCAGTGGGAGATGG + Intronic
956155286 3:66289582-66289604 CTGAAAAAAGCAATGGGGGAAGG - Intronic
956612327 3:71136669-71136691 CAGCAAAAAACAGTTGTTGATGG - Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957211012 3:77258671-77258693 CAGCAAAAGGAAGTGTTGAAAGG - Intronic
957296912 3:78344277-78344299 CGGCAAACCCCAGTGGTGGATGG + Intergenic
957557721 3:81782297-81782319 CAGCAAACAACAATGGTGGATGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
959117388 3:102194387-102194409 CATCAAAATGCAGAGGTGGTGGG + Intronic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
959506881 3:107166060-107166082 CAAAAAAAAGCAGGGGTGGCTGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961325423 3:126106538-126106560 CATCAACAGGCCGTGGTGGAAGG + Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963315967 3:143759182-143759204 CAGGAAATAGCAGTGTTAGATGG - Intronic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
963822005 3:149907683-149907705 CAGCATATAGCATTGCTGGAAGG + Intronic
963915312 3:150854370-150854392 CAGCAAACAGCAGTAGCAGACGG - Intergenic
965113041 3:164451556-164451578 CAACAAATAGCAGGGGTGGGTGG + Intergenic
965253540 3:166373811-166373833 CAGCAGAAAGGAGAAGTGGAAGG - Intergenic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
967013802 3:185463755-185463777 CAATAAAAAGCAGAGGTGAAAGG - Intronic
967563088 3:190940034-190940056 CAACAAAAAACAGTGCTGAAAGG - Intergenic
968074650 3:195809830-195809852 GTGTAAAAAGCAGTGGTGAACGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
970049255 4:11895163-11895185 CATCGCAGAGCAGTGGTGGAAGG - Intergenic
970250779 4:14113455-14113477 CAGCAAGAAGCATGGGAGGAAGG - Intergenic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
970909172 4:21254638-21254660 CAGCATTAAGCAGTGGAGGTAGG - Intronic
971076770 4:23158374-23158396 CAGCGTACAGCAGGGGTGGATGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976189289 4:82473690-82473712 CAGCAATCAGCAGTGGTAGATGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978406028 4:108379730-108379752 CATCTAAAAGCAGTGCTGAAGGG + Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978909017 4:114044497-114044519 TAGCCAGCAGCAGTGGTGGACGG - Intergenic
979526246 4:121720283-121720305 CAGCAAAAAGATGTTGGGGAAGG - Intergenic
979546246 4:121943231-121943253 GTGGAAGAAGCAGTGGTGGAGGG + Intronic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
980861207 4:138501491-138501513 TAGGAAAAAGCAGTGATGTATGG + Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
982406593 4:155027305-155027327 CAGCAAAAGGCAGTGGGTGGCGG - Intergenic
982513066 4:156308571-156308593 CATCAAAAAGCAGTTGTGAAAGG - Intergenic
982765081 4:159337236-159337258 CATAAAAAAACAGTGGTGCATGG - Intronic
982886242 4:160786398-160786420 CTACAAAAAACAGTTGTGGATGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
983822224 4:172209788-172209810 CAGCAAAATGAATTTGTGGAAGG - Intronic
983968136 4:173839118-173839140 AACCAAAAAGCACAGGTGGAAGG + Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
984365393 4:178792990-178793012 GAGCAAAAAGCAGAGGTGGAGGG - Intergenic
984377075 4:178945530-178945552 CAGCAAAAAGTAGGTGTGGCAGG - Intergenic
985226354 4:187765516-187765538 CAGCTAACAGTAGTGGTGGATGG - Intergenic
985350731 4:189058645-189058667 CAGACAACAGCGGTGGTGGACGG - Intergenic
985916491 5:2922805-2922827 CTGCAATAAGCAGTGCTGGAGGG - Intergenic
986887348 5:12256134-12256156 TGGAAAAAAGCAGTGGAGGAAGG - Intergenic
987738468 5:21874686-21874708 CTGTGAACAGCAGTGGTGGATGG - Intronic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
987934919 5:24451359-24451381 CAGCATTCAGCAGTGATGGACGG + Intergenic
988654156 5:33189648-33189670 CACTCAAAAGCAGTGGTGAAAGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988756227 5:34253978-34254000 CAGAAAGAAGCAGTGTTTGATGG + Intergenic
988806144 5:34742622-34742644 CAGCAAACTGCAGTAGTGTATGG - Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
988983497 5:36595105-36595127 GAGTATAAAGCAGTGGAGGAAGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990607554 5:57425742-57425764 CCAAAAAAAGCAGGGGTGGAGGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
991290608 5:65030855-65030877 CCGGAAACGGCAGTGGTGGATGG - Intergenic
991744423 5:69719460-69719482 CAGTAAGAAGCAGTGTTTGATGG + Intergenic
991753281 5:69835773-69835795 CAGTAAGAAGCAGTGTTTGATGG - Intergenic
991795995 5:70299184-70299206 CAGTAAGAAGCAGTGTTTGATGG + Intergenic
991802898 5:70392500-70392522 CAGTAAGAAGCAGTGTTTGATGG - Intergenic
991823804 5:70594774-70594796 CAGTAAGAAGCAGTGTTTGATGG + Intergenic
991832602 5:70710892-70710914 CAGTAAGAAGCAGTGTTTGATGG - Intergenic
991888373 5:71298744-71298766 CAGTAAGAAGCAGTGTTTGATGG + Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992980524 5:82166333-82166355 CAACACAAAGCAGTGGTGGTGGG - Intronic
993178042 5:84513988-84514010 CAGAAACAAGCAATGGGGGAAGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993872423 5:93268142-93268164 CAGGAACATGCAGGGGTGGAGGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994105270 5:95940960-95940982 CTGCAAAAAGAAGGGGGGGAGGG + Intronic
994119550 5:96098582-96098604 CAGAAACAAGCAATGGTGAAAGG - Intergenic
994709361 5:103247872-103247894 CAATAAGAAGCAATGGTGGAAGG - Intergenic
995187265 5:109285033-109285055 CAGCAAAAAGCAGTGCTAGAAGG + Intergenic
995441465 5:112197044-112197066 GACCACAAAGCACTGGTGGAGGG - Intronic
995443184 5:112214354-112214376 AATGAAAAAGCAGTGGTGGTGGG - Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
995822965 5:116258817-116258839 CAGACAAAAGCAGAGGTGCAGGG - Intronic
997578916 5:135005070-135005092 AAGCAAAAAGGACTGGTGGCAGG + Intronic
998939787 5:147268990-147269012 CAGTAAAGAACAGTGTTGGAGGG + Intronic
1000095449 5:157967370-157967392 GTGGAAAAAGCAGTTGTGGATGG - Intergenic
1000567868 5:162873370-162873392 CAGCAAAAAGCAGGGGCTGTGGG + Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004729028 6:18339914-18339936 CAGCATAAAGTAGTACTGGAAGG - Intergenic
1004867289 6:19866594-19866616 CAGCAAAAAGAAATGATGGGTGG + Intergenic
1005044635 6:21629888-21629910 CAGCAAGAAGCGATGGTGGCCGG - Intergenic
1005214451 6:23508808-23508830 CAGCAAAAATAAGTGAGGGAAGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005362146 6:25041012-25041034 TAGCAATAGGCAGTGGTAGAGGG - Intronic
1005554814 6:26965426-26965448 CAGTAAGAAGCAGTGTTTGATGG + Intergenic
1005610934 6:27524424-27524446 CAGCCAAGCCCAGTGGTGGAAGG + Intergenic
1005640543 6:27792163-27792185 CAGCAATCAGCTGTGGTGTAGGG - Intergenic
1005806899 6:29482185-29482207 CAGAAAAAAGCAATGGGGAAAGG - Intergenic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1006563906 6:34937684-34937706 CAGAAAAAAGAAGTTGTGGCTGG + Intronic
1006877230 6:37308377-37308399 CAGCAAAAAGCAGTGGAGAAAGG - Intronic
1006967540 6:38003863-38003885 CAGTAATAAGCAGTGATTGAGGG - Intronic
1007917264 6:45573091-45573113 CAGCCAGAAGCAGAGGAGGAAGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009351426 6:62684253-62684275 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1009423725 6:63491272-63491294 AAGCAAAAAGCATTGCTGTAGGG - Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1010184968 6:73133620-73133642 CAGCCAAAACCAGTGATAGATGG + Exonic
1010202149 6:73291644-73291666 CAACAGAATGCAGTGGTGTATGG + Intronic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011241822 6:85279799-85279821 CAGGAAAAAACAGGGGAGGAGGG - Intergenic
1011519636 6:88191658-88191680 CAGCAACAAGAAGTGGGAGAGGG - Intergenic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012489660 6:99767588-99767610 CAGAAAAATGCAGTGGTAAAAGG - Intergenic
1012666871 6:101982158-101982180 CAGCAAATAGAATTGGTGGGTGG + Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1012964185 6:105655791-105655813 CACTAAAAGGCAGTGGTGAAGGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015206182 6:130642359-130642381 CAGAAAGAAGCAGTGTTGGGGGG - Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1015738373 6:136425967-136425989 AAGGAAAAAGAAGTGGTAGAAGG - Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1016551503 6:145285265-145285287 CAGCAAAAAGCTGACTTGGAAGG + Intergenic
1017715354 6:157207162-157207184 CAGCAAAGATGAGTGGTGGTGGG + Exonic
1018143933 6:160865435-160865457 CAGCACAAAGCTGGGGTGGGAGG - Intergenic
1018177215 6:161187466-161187488 CAGCAAAAATCAGTTAAGGATGG + Intronic
1018481995 6:164200297-164200319 CAGAAAACTGCATTGGTGGATGG + Intergenic
1019135929 6:169907711-169907733 CAGCAGGAAGCAGTGGAGGAAGG + Intergenic
1019541946 7:1555544-1555566 CAGCAGGAAGCAGCGGGGGAGGG + Intronic
1019641324 7:2105323-2105345 CAGCTAAGAGCAGGGGAGGAAGG + Intronic
1019843777 7:3476279-3476301 CAGCAAACAGCTGTGGGTGATGG - Intronic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021134788 7:16952217-16952239 CAGCAGAAAGCACAGCTGGATGG + Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1021935630 7:25628526-25628548 AAGCAAAAAGGAGAGGAGGATGG - Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022192287 7:28027811-28027833 CATCAAAAAGTAGCTGTGGAAGG + Intronic
1022388667 7:29924889-29924911 CTGCATGAAGCAGTGGTGGGCGG - Intronic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1023466978 7:40466729-40466751 CAGAAAAGAGCAGTGGTAGCTGG + Intronic
1023665378 7:42517722-42517744 CAACAAAGAGGAGTGGTAGATGG + Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024339739 7:48245084-48245106 CACCAAGAAGCATTGGTGGGAGG - Intronic
1024470774 7:49767194-49767216 CAGCAGAAAGCAGTGCAGGAAGG - Intergenic
1025075921 7:55943094-55943116 CAGCAAAAAGGAATGTAGGAGGG + Intergenic
1025306800 7:57868443-57868465 CCGCAAAAAGCAGCGGCGGCGGG + Intergenic
1025306993 7:57869190-57869212 CTGCAAAAAGCAGCGGTGGCGGG + Intergenic
1025307004 7:57869254-57869276 CTGCAAAAAGCAGCGGCGGCGGG + Intergenic
1025320131 7:58087004-58087026 CAGCAAAAAGCCGCGGCGGCGGG - Intergenic
1025320136 7:58087036-58087058 GGGCAAAAAGCTGTGGTGGCAGG - Intergenic
1025320207 7:58087328-58087350 CAGCAAAAAGCCGTGGCGGCGGG - Intergenic
1025478488 7:60956241-60956263 CAGCAAAAAGCCGCGGCAGAGGG - Intergenic
1025478494 7:60956273-60956295 CCGTAAAAAGCCGTGGCGGAGGG - Intergenic
1025561249 7:62377038-62377060 CCGCAAAAAGCCGCGGCGGAGGG - Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1026562443 7:71461763-71461785 CAGGAAAAGGCAGAGGAGGAGGG - Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028384316 7:90237201-90237223 CAGGAAAAAGCAGTGGAAGTAGG - Exonic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030059565 7:105612030-105612052 CAGCCAGAAGCGGTGGTGAAAGG - Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031127449 7:117791199-117791221 GAGCAAAAGGCAATGGTGGTAGG + Exonic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1032447557 7:131997660-131997682 GAGCAAACAGGAGTGATGGATGG - Intergenic
1033556919 7:142496181-142496203 AGGCAATAAGCAATGGTGGAGGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034950084 7:155291094-155291116 CAGCAGATAGCAGTGGCAGAGGG - Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035492048 7:159288451-159288473 CAGCAGAAAGGAGGGGTTGATGG - Intergenic
1035825856 8:2643598-2643620 AAGGAACAAGCGGTGGTGGACGG - Intergenic
1036137884 8:6179073-6179095 CAGCAAACAGAAGGGGTTGAAGG - Intergenic
1036217491 8:6892832-6892854 CAGGCAAAAGGAGTGGTGCAGGG + Intergenic
1036489269 8:9210013-9210035 CTGCAGAAAGCAGGGATGGAAGG + Intergenic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037340736 8:17841778-17841800 CAACAAAAAGGACTGGTGAAAGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040768454 8:50944307-50944329 CGCCCAAAAGCAGTGGTGGACGG + Intergenic
1041196939 8:55410206-55410228 CAGCGAGCAGCAGTGGAGGATGG - Intronic
1041269376 8:56096102-56096124 CAGCAAAAAGGAGTTGAGCATGG - Intergenic
1041427111 8:57734410-57734432 CAGAAACAAGCAATGGAGGAAGG - Intergenic
1041725014 8:61010150-61010172 CAGCAACAAGCAGAGGTGAATGG - Intergenic
1041729315 8:61048830-61048852 CAGAAAAAAACAGTGAGGGAGGG - Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042083179 8:65078254-65078276 CAGCAAAGAGCAGAAGTGAAAGG + Intergenic
1044212005 8:89561365-89561387 CACCAAAAGGCAGTGGTAAAAGG - Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1048890913 8:138945658-138945680 CAGAAAAAAACAGTAGTGCAAGG + Intergenic
1050212383 9:3275633-3275655 CAGAAAAAAGCTATTGTGGATGG + Intronic
1050593498 9:7183541-7183563 TAGCAAACAGCAATGGTAGACGG - Intergenic
1050616818 9:7409897-7409919 CAGCATAAAGTAGTGGTGTAGGG + Intergenic
1050813350 9:9778133-9778155 AAACAAAAAGCTGTGGTGGATGG + Intronic
1050863757 9:10470800-10470822 AAGGAAACAGGAGTGGTGGAGGG + Intronic
1051121509 9:13757059-13757081 GAGAGAGAAGCAGTGGTGGAGGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053547400 9:39037548-39037570 CAGCAAAAAGAAATTGTGGTAGG + Intergenic
1053945879 9:43310605-43310627 CGGCAAAAAGCCGCGGTGGCAGG - Intergenic
1053946054 9:43311341-43311363 CGGCAAAAAGCCGTAGTGGCGGG - Intergenic
1053946086 9:43311497-43311519 CTGCAAAAAGCCATGGCGGAGGG - Intergenic
1053946121 9:43311653-43311675 CCGCAAAAAGCAGCGGCGGCAGG - Intergenic
1053946177 9:43311929-43311951 CCGCAAAAAGCAGCGGTGGCGGG - Intergenic
1053946192 9:43311983-43312005 CGGCAAAAAGCCGTAGTGGCGGG - Intergenic
1055275320 9:74609325-74609347 GAGAAAAAAGCAATGGTGAAAGG - Intronic
1055682939 9:78736746-78736768 CAAAAACAAGCAGTGGGGGAAGG + Intergenic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1057702992 9:97376993-97377015 CGGCACAGAGCAGGGGTGGAGGG - Intronic
1058041975 9:100312595-100312617 CTGCAAAAAACAGTGGAGAATGG - Intronic
1058274979 9:103028507-103028529 CAGCAAAAAGCAGTTCTAAAAGG + Intergenic
1058638510 9:107060061-107060083 CATCAAAAAGCCAAGGTGGAAGG - Intergenic
1059367781 9:113800177-113800199 CAGAAAACAGCAGCTGTGGAGGG + Intergenic
1060027240 9:120183549-120183571 CAGTAGAAAGCAGTTGCGGATGG + Intergenic
1061302994 9:129716812-129716834 TTGCAAAAAGCAATGCTGGAGGG + Intronic
1061684201 9:132261147-132261169 CTGCCAGAAGCACTGGTGGAGGG - Intergenic
1203589014 Un_KI270747v1:39185-39207 CGGCAAAAAGCCGCGGTGGCAGG - Intergenic
1203589189 Un_KI270747v1:39921-39943 CGGCAAAAAGCCGTAGTGGCGGG - Intergenic
1203589249 Un_KI270747v1:40211-40233 CCGCAAAAAGCAGCGGCGGCAGG - Intergenic
1203589307 Un_KI270747v1:40487-40509 CCGCAAAAAGCAGCGGTGGCGGG - Intergenic
1203589322 Un_KI270747v1:40541-40563 CGGCAAAAAGCCGTAGTGGCGGG - Intergenic
1203612886 Un_KI270749v1:26637-26659 CAGCAAAAAGCCGCGGCGGCGGG - Intergenic
1203612989 Un_KI270749v1:27065-27087 CAGCAAAAAGCCGTGGCGGCGGG - Intergenic
1203613167 Un_KI270749v1:27828-27850 CCGCAAAAAGTAGTGGCGGCGGG - Intergenic
1203616509 Un_KI270749v1:72211-72233 CGGCAAAAAGCCGTGGCGGCGGG - Intergenic
1185917043 X:4047223-4047245 CAACAAAGAGAAGTGGTGTATGG + Intergenic
1187366279 X:18668064-18668086 CAGAAAATAGCATTGTTGGAAGG + Intronic
1187463998 X:19512935-19512957 CATCAAAAAGCAGTGAGTGATGG + Intronic
1187982683 X:24775235-24775257 CAGCAAAATGCGGTGGTGCCAGG - Intronic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1188413687 X:29905628-29905650 CAGCAACAAGCAATGGGGAAAGG - Intronic
1188987681 X:36781952-36781974 CAGAAAAATGCATGGGTGGATGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG + Intergenic
1189954702 X:46265321-46265343 GCTCAAAGAGCAGTGGTGGAGGG + Intergenic
1190001208 X:46689171-46689193 AAACAAAAAGCAGTGGTTGCTGG - Intronic
1190616994 X:52244050-52244072 CAGAAACAAGCAGTGGAGAAAGG + Intergenic
1190683545 X:52850639-52850661 CAGCAGTAAGCAGTGGAGCATGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192116583 X:68417444-68417466 GAGCAAAAAGCAAAGGTGCAAGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192282216 X:69699064-69699086 TAGGAAAAGGCAGTGGCGGAGGG + Intronic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195023753 X:100855187-100855209 CAGCCAAACACAGTGGTGGCAGG - Intronic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1195869709 X:109473197-109473219 CAGCAACAGGAAGTGGAGGAGGG - Intronic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1197493543 X:127149704-127149726 TACCAAAAAGTAGTGGTGGGAGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199317481 X:146397487-146397509 CAGCAAAAAGCAGTGCTAAGAGG - Intergenic
1199334490 X:146602216-146602238 CAGAGACAAGCATTGGTGGATGG + Intergenic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199420933 X:147643943-147643965 CAGGAACAATCATTGGTGGAAGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1199729349 X:150615833-150615855 CAAAAAAAAGCTGAGGTGGATGG - Intronic
1200946706 Y:8848171-8848193 TAGCAATAAGGAGGGGTGGAGGG - Intergenic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic