ID: 976515475

View in Genome Browser
Species Human (GRCh38)
Location 4:85959435-85959457
Sequence AAAACGAGGCTGCAAGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 325}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976515475_976515483 10 Left 976515475 4:85959435-85959457 CCAGTAACTTGCAGCCTCGTTTT 0: 1
1: 0
2: 1
3: 22
4: 325
Right 976515483 4:85959468-85959490 TATTCTAGATGGAGTTGCTATGG 0: 2
1: 11
2: 549
3: 778
4: 856
976515475_976515477 -1 Left 976515475 4:85959435-85959457 CCAGTAACTTGCAGCCTCGTTTT 0: 1
1: 0
2: 1
3: 22
4: 325
Right 976515477 4:85959457-85959479 TACCCAGCCCCTATTCTAGATGG 0: 2
1: 350
2: 785
3: 770
4: 552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976515475 Original CRISPR AAAACGAGGCTGCAAGTTAC TGG (reversed) Intronic
900946278 1:5833102-5833124 AAAACGAGGCTGCAGGTGGGCGG - Intergenic
901620302 1:10579919-10579941 AAAATGAGGCTGAAACCTACTGG - Intronic
902947426 1:19851840-19851862 AAAATGAGGCTGAAACCTACTGG - Intergenic
906741237 1:48187457-48187479 AAAACGAGCCTCCAATTTATAGG - Intergenic
907289305 1:53402664-53402686 AAAACTAGGCTGTCAGTTCCAGG + Intergenic
909318776 1:74255398-74255420 AAAATGAGGCTGAGACTTACGGG - Intronic
909801003 1:79806841-79806863 AAAACCAGGCTGCCAGTTCTGGG - Intergenic
909856961 1:80547287-80547309 AAAATGAGGCTGAAACCTACTGG + Intergenic
910645026 1:89505281-89505303 AAAATGAGGCTGGAACTTGCTGG + Intergenic
910796199 1:91100015-91100037 AAAATGAGGCTGAAACCTACTGG - Intergenic
911153002 1:94613031-94613053 AAAATGAGGCTGAAAACTACTGG + Intergenic
912080436 1:105930066-105930088 AAAATGAGGCTGAAACTTGCTGG - Intergenic
915039709 1:152958505-152958527 AAAATGAGGCTGAAACCTACTGG + Intergenic
915180433 1:154054310-154054332 AATAGGAGGGGGCAAGTTACAGG - Exonic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
915697065 1:157754124-157754146 AAAATGAGGCTGAAACCTACTGG + Intronic
916882412 1:169032710-169032732 TAAACGAGGCTGCAAGCATCAGG - Intergenic
917293981 1:173499902-173499924 AAAATGAGGCTGAAAGTTACTGG + Intergenic
918471688 1:184881956-184881978 GAAATGAGGCTGAAACTTACTGG - Intronic
919575998 1:199310655-199310677 AAAATGAGGCTGAAACTTACTGG + Intergenic
920397653 1:205658799-205658821 TAAACGAAGCTGCAGGTTAAGGG + Exonic
920722496 1:208400656-208400678 AAAACAAGGCTGCAGGGTTCTGG - Intergenic
920722759 1:208402921-208402943 AAAGCCAGGCTGCAAGCCACAGG - Intergenic
921962839 1:221054100-221054122 AAAATGAGGCTGAAACCTACTGG - Intergenic
922925975 1:229346822-229346844 GAAACCAGGCTGCAAGATCCAGG - Intergenic
923351086 1:233107798-233107820 AAAATGAGGCTGAAACCTACTGG + Intronic
923617042 1:235546717-235546739 AAAATGAGGCTGAAACCTACTGG - Intergenic
923702570 1:236314259-236314281 AAAATGAGGCTGAAACCTACTGG + Intergenic
923934291 1:238744843-238744865 AAAACCAAGCTGCCAGTTACAGG + Intergenic
924014054 1:239700670-239700692 AAAACGAGTCTGCGGGCTACAGG - Intronic
924208629 1:241742315-241742337 AAAATGAGGCTGAGAGCTACTGG + Intronic
1063012086 10:2032916-2032938 CAAACAAAGCTGCAAGATACAGG - Intergenic
1063472158 10:6296908-6296930 AAAATGAGGCTGAAACCTACTGG - Intergenic
1063979205 10:11440251-11440273 AAAATGAGGCTGAAACCTACTGG + Intergenic
1064952760 10:20872580-20872602 AAAATGAGGCTGAAACCTACTGG + Intronic
1067328410 10:45291869-45291891 AAAATGAGGCTGAAACCTACTGG - Intergenic
1068325800 10:55484657-55484679 TAAACAAGACAGCAAGTTACTGG + Intronic
1068977353 10:63024084-63024106 AAAATGAGGCTGAAATCTACTGG - Intergenic
1068999182 10:63244367-63244389 AAAAGGAGGCAGCAAACTACTGG + Intronic
1070507700 10:77128957-77128979 AAAACAAGGCTGCAAGGCAGTGG + Intronic
1070830422 10:79414899-79414921 AAACAGAGACTGCAAGTAACTGG + Intronic
1071013571 10:80967680-80967702 AAAATGAGGCTGAAACCTACTGG - Intergenic
1071392623 10:85190755-85190777 AAAATGAGGCTGAAACCTACTGG - Intergenic
1071874784 10:89833458-89833480 AAAACCAGGGAGCAAGTGACAGG - Intergenic
1072109916 10:92308493-92308515 AAAATGAGGCTGAAACCTACTGG - Intronic
1073489714 10:103844916-103844938 AAAACAAGGCTGAAACCTACTGG + Intronic
1073531470 10:104236424-104236446 AAAACGAGGCTGAAACCTACTGG + Intronic
1074738982 10:116465656-116465678 AAAACGAAGCTGCCAGTTCCAGG - Intronic
1074821800 10:117185328-117185350 AAGATGAGGCTGCAATGTACAGG - Intergenic
1075928047 10:126269325-126269347 AAAATGAGGCTGAAACCTACTGG - Intronic
1079027546 11:16960932-16960954 GAAACGAAGCTGGAAGTTTCAGG - Intronic
1079412252 11:20200549-20200571 AAAATGAGGCTGAAACCTACTGG + Intergenic
1081424185 11:42906878-42906900 AAAATGAGGCTGAAAGCTACTGG - Intergenic
1084367211 11:68709745-68709767 AAGACGAGGCTCCAATGTACAGG + Intronic
1084553212 11:69861310-69861332 AAAGGGAGGCAGCAAGGTACAGG + Intergenic
1084635791 11:70391660-70391682 AAAATGAGGCTGAAACCTACTGG - Intergenic
1086920635 11:92582307-92582329 AAAATGAGGCTGAAACCTACTGG - Intronic
1087227986 11:95625668-95625690 GAAAGGAGGCTGCTAGTTCCAGG + Intergenic
1088253525 11:107881862-107881884 AAAATGAGGCTGAAACCTACTGG - Intronic
1089472771 11:118734183-118734205 AAAATGAGGCTGAAACCTACTGG - Intergenic
1092354918 12:7786818-7786840 AAAATGAGGCTGAAACCTACTGG - Intergenic
1092367626 12:7890146-7890168 AAAATGAGGCTGAAACCTACTGG - Intronic
1093179440 12:15950551-15950573 AAAATGAGGCTGAAACTTACTGG - Intronic
1093298012 12:17416038-17416060 AAAACCAGGCTGCCAGTTCTTGG + Intergenic
1093461871 12:19414277-19414299 AAAATGAGGCTGAAACCTACGGG - Intronic
1093585442 12:20830064-20830086 AAAATGAGGCTGAAACCTACTGG - Intronic
1096337245 12:50765601-50765623 AAAATGAGGCTGAAACCTACTGG + Intronic
1097845675 12:64363104-64363126 AAAATGAGGCTGCGACCTACTGG - Intronic
1098535627 12:71591142-71591164 AAAATGAGGCTGAAACCTACTGG - Intergenic
1099172064 12:79376615-79376637 AAAATGAGGCTGAAACCTACTGG - Intronic
1102074677 12:110050394-110050416 AAAATGAGGCTGAAACCTACTGG + Intronic
1102871521 12:116417801-116417823 AAAATGAGGCTGAGACTTACTGG + Intergenic
1103044252 12:117722349-117722371 AAAATGAGGCTGAAACCTACTGG + Intronic
1103056090 12:117821883-117821905 AAAATGAGGCTGAAACCTACTGG + Intronic
1103962271 12:124616528-124616550 AAAATGAGGCTGAAACCTACTGG - Intergenic
1104127767 12:125863661-125863683 AAAATGAGGCTGAAACCTACTGG - Intergenic
1104648527 12:130514270-130514292 TAAACAAGGCTGCAAGGCACAGG - Intronic
1106240681 13:27910377-27910399 AAAATGAGGCTGAGACTTACTGG - Intergenic
1106927662 13:34630444-34630466 AAAATGAGGCTGAAACCTACTGG - Intergenic
1108528331 13:51304589-51304611 AAAATGAGGCTGAAACCTACTGG + Intergenic
1108769373 13:53680068-53680090 AAAAAGAGGCAGCAAAGTACTGG - Intergenic
1110058831 13:71015246-71015268 AAAATGAGGCTGAAACCTACCGG - Intergenic
1110264172 13:73519318-73519340 AAAATGAGGCTGAAACCTACTGG - Intergenic
1110684617 13:78357623-78357645 AAAACAAGGCTGAAACCTACTGG + Intergenic
1111150726 13:84251094-84251116 GAAATGAGGCTGCTAGTTAGGGG + Intergenic
1111563010 13:89977360-89977382 AAAATGAGGCTGAAACCTACTGG - Intergenic
1111618199 13:90689270-90689292 AAAAAGATGCTGCAAGTGAGTGG + Intergenic
1111760057 13:92452149-92452171 AAAACGATGGTGAAAGTAACTGG + Intronic
1112365965 13:98755728-98755750 AAATGGGGGCTGCAAGTCACAGG + Intergenic
1114344020 14:21776858-21776880 AAAATGAGGCTGAGACTTACTGG + Intergenic
1114764535 14:25356022-25356044 AAAATGAGGCTGAAATCTACTGG + Intergenic
1114963693 14:27928747-27928769 AAAATGAGGCTGAGAGTTACTGG + Intergenic
1115239147 14:31237472-31237494 AAAATGAGGCTGCAACCTACTGG - Intergenic
1115239745 14:31242671-31242693 AAAATGAGGCTGAAACCTACTGG - Intergenic
1115315805 14:32023819-32023841 AAAATGAGGCTGAAATCTACTGG + Intergenic
1115917457 14:38331624-38331646 AAAATGAGGCTGAAACCTACTGG + Intergenic
1116229518 14:42198522-42198544 AAAATGAGGCTGAAACCTACTGG - Intergenic
1116329308 14:43576528-43576550 AAAATGATGCTGAAACTTACTGG + Intergenic
1116641325 14:47467177-47467199 AAAATAAGGCTGGAAGTTAGAGG + Intronic
1117449188 14:55834586-55834608 AAAATGAGGCTGAAACCTACTGG - Intergenic
1117772382 14:59147368-59147390 AAAGCCAGGCTGCAAGTCATTGG - Intergenic
1117969279 14:61236288-61236310 AAAATGAGGCTGAAACCTACTGG + Intronic
1118001406 14:61526870-61526892 ACAAGGAGGCTGCAGGTCACGGG - Intronic
1118118220 14:62805926-62805948 AAAATGAGGCTGAAAGCTACTGG + Intronic
1118174798 14:63427640-63427662 AAAAGGAGGCTTGAAGTCACTGG + Intronic
1118304022 14:64639577-64639599 AAAATGAGGCTGAAACCTACTGG - Intergenic
1119000346 14:70876154-70876176 AAAATGAGGCTGAAACCTACTGG - Intergenic
1119221032 14:72907516-72907538 AAAATGAGGCTGAAACCTACTGG + Intergenic
1119246781 14:73116610-73116632 AAAACGGGGCTGGAAGCTTCAGG - Intronic
1121194056 14:92054262-92054284 AAAATGAGGCTGAAACCTACTGG + Exonic
1121496382 14:94394330-94394352 ATCACCAGGCTGCAAGTAACCGG + Intergenic
1122221774 14:100243736-100243758 AAATCGAGGCTGCAAGTCAGCGG + Intronic
1122949315 14:105032503-105032525 AAAATGAGGCTGAAACCTACTGG + Intergenic
1124465204 15:29932152-29932174 AAAATGAGGCTGAGATTTACTGG - Intronic
1125083283 15:35700420-35700442 AAAATGAGGCTGAAACCTACGGG - Intergenic
1127162426 15:56203514-56203536 AAAATGAGGCTGAAACCTACTGG + Intronic
1129124721 15:73429095-73429117 ATAATGAGGCTGTATGTTACTGG - Intergenic
1130074832 15:80679665-80679687 AAAATGAGGCTGAAACTTGCTGG - Intronic
1130583342 15:85158300-85158322 AAAATGAGGCTGAAACCTACTGG - Intergenic
1131146526 15:90017369-90017391 AATACAAGGCTGTAATTTACAGG + Intronic
1133943003 16:10326039-10326061 AAAATGAGGCTGAGACTTACTGG - Intergenic
1133943342 16:10328529-10328551 AAAATGAGGCTGGGACTTACGGG + Intronic
1134000216 16:10777060-10777082 AAAACGAGGCTGAGACCTACTGG - Intronic
1134128673 16:11633387-11633409 AAAATGAGGCTGAAACCTACTGG + Intronic
1135916411 16:26609286-26609308 AAAATGAGGCTGAGACTTACTGG - Intergenic
1136011371 16:27365487-27365509 AAAATGAGGCTGAGACTTACTGG - Intergenic
1138174675 16:54885989-54886011 AAAATGAGGCTGAAATCTACTGG + Intergenic
1140236442 16:73163359-73163381 AAAACCAGGCTGCAGATTAGGGG + Intergenic
1140641383 16:76977502-76977524 AAAATGAGGCTGAGACTTACTGG + Intergenic
1144473064 17:15561778-15561800 AAAATGAGGCTGAAACCTACTGG + Intronic
1144923418 17:18782942-18782964 AAAATGAGGCTGAAACCTACTGG - Intronic
1145114219 17:20193344-20193366 AAAATGAGGCTGAAACCTACTGG - Intronic
1145405178 17:22583882-22583904 AAAATGAGGCTGAAACCTACTGG - Intergenic
1146693968 17:34895102-34895124 AAAACGATGTAGCAAGTTCCCGG + Intergenic
1146704510 17:34991168-34991190 AAAAAGAGGCTGCAGGTGCCTGG - Intronic
1147925850 17:43945305-43945327 AAAATGAGGCTGCAACCTGCTGG + Intergenic
1148830671 17:50428915-50428937 CCTACGAGGCTGCAAGTTCCTGG - Intronic
1148855550 17:50577169-50577191 AAAACGTGGGTGCATGTGACTGG - Intronic
1149106417 17:52972854-52972876 AAAATGAGGCTGAAACTTACTGG - Intergenic
1149888917 17:60368489-60368511 AAAACAAGACTACTAGTTACAGG + Intronic
1150122370 17:62615019-62615041 AAAAAAAGGCAGGAAGTTACTGG - Intronic
1150844225 17:68638775-68638797 AAAATGAGGCTGAAACCTACTGG + Intergenic
1151224632 17:72639550-72639572 AAAATGAGGCTGAAACTTACTGG - Intergenic
1151831619 17:76555682-76555704 GAAACGAGGCTGAAACCTACTGG - Intergenic
1152997164 18:418487-418509 AAAATGAGGCTGAAACCTACTGG + Intronic
1153437419 18:5082597-5082619 AAAATGAGGCTGAAACCTACTGG + Intergenic
1155113729 18:22742801-22742823 AAAACGAGGCAGCAACATAGTGG + Intergenic
1155286831 18:24297931-24297953 AAAATGAGGCTGAAACCTACTGG + Intronic
1155850616 18:30769541-30769563 AAAATAAGGCTGAAACTTACTGG + Intergenic
1156072715 18:33232175-33232197 AAAACCAGGCTGCAGGTCAAAGG - Intronic
1160335723 18:78037329-78037351 AAAAAAAGGGTGCAAGTAACTGG + Intergenic
1163434451 19:17286911-17286933 AAAATGAGGCTGAAACCTACTGG + Exonic
1164687536 19:30177716-30177738 AAAATGAGGCTGAAACCTACTGG - Intergenic
1164900578 19:31917782-31917804 AAAATGAGGCTGAAACCTACTGG - Intergenic
1164947490 19:32308827-32308849 AAAATGAGGCTGAAACCTACTGG - Intergenic
1165241355 19:34470896-34470918 AATTCAAGGCTCCAAGTTACTGG - Exonic
1165340071 19:35205147-35205169 AAAATGAGGCTGAGACTTACTGG - Intergenic
1166321248 19:42020508-42020530 AAAATGAGGCTGAAACCTACTGG + Intronic
1166459245 19:42971657-42971679 AAAACGAGGCTTGAACTTGCTGG + Intronic
925395961 2:3533938-3533960 AAAACCAAGCTGCCAGTTCCAGG + Intronic
927223491 2:20737777-20737799 AAAATGAGGCTGAAACTTGCTGG + Intronic
927321335 2:21749430-21749452 AAAATGAGGCTGAGACTTACTGG + Intergenic
927892538 2:26761121-26761143 AAAACGAGGCTGAGACCTACTGG + Intergenic
928348290 2:30520937-30520959 AAAATGAGGCTGAAACCTACTGG + Intronic
931541633 2:63335752-63335774 AAAATGAGGCTGAAACCTACTGG + Intronic
932845669 2:75133777-75133799 AAAATGAGGCTGAAACCTACCGG + Intronic
932860779 2:75289155-75289177 AAAATGAGGCTGAAACCTACTGG + Intergenic
932960270 2:76405764-76405786 AAAACCAAGCTGCCAGTTCCAGG + Intergenic
933228769 2:79781429-79781451 AAAATAAGGCTGAAAGCTACTGG - Intronic
933614572 2:84470723-84470745 AAAATGAGGCTGAAACCTACTGG - Intergenic
934888553 2:98046206-98046228 AAAATGAGGCTGAAACCTACTGG + Intergenic
935095461 2:99940352-99940374 AAAATGAGGCTGAAACCTACTGG + Intronic
935325266 2:101929993-101930015 AAAACAAGACTGCATGATACAGG + Intergenic
935597083 2:104887317-104887339 AAAATGAGGCTGAAACCTACTGG - Intergenic
935602009 2:104932275-104932297 AAAACAAGGCAGGAAGTTCCAGG + Intergenic
936108137 2:109643337-109643359 AAAATGAGGCTGAAACCTACTGG + Intergenic
936819119 2:116497376-116497398 AAAATGAGGCTGAGACTTACTGG + Intergenic
938781834 2:134591525-134591547 AAAATGAGGCTGAAACCTACTGG - Intronic
941706597 2:168664860-168664882 AAAATGAGGCTGAAACCTACTGG - Intronic
942127278 2:172839671-172839693 AAAAGGAGGCTGAAACCTACCGG - Intronic
945994672 2:216425877-216425899 AAAACCAGGCTGTCAGTTCCAGG - Intronic
1169958738 20:11134947-11134969 AAGATAAGGCTGCCAGTTACAGG - Intergenic
1170802729 20:19603784-19603806 AAAACAAGGCTGTGAGTTCCAGG + Intronic
1170895736 20:20412594-20412616 AATAAGAAGATGCAAGTTACTGG + Intronic
1175097346 20:56552074-56552096 AAAATGAGGCTGAAACCTACTGG + Intergenic
1178043994 21:28673958-28673980 AAAATGAGGCTGAAACCTACTGG + Intergenic
1178112997 21:29387752-29387774 AAAATGAGGCTGAAACCTACTGG - Intronic
1179444547 21:41422056-41422078 AAAACGAGGCTGATACCTACTGG + Exonic
1185276179 22:49951062-49951084 GAACCGAGGCTGGAGGTTACCGG + Intergenic
949194727 3:1290988-1291010 AAAATGAGGCTGAAACCTACTGG - Intronic
950511448 3:13430737-13430759 AAAATGAGGCTGAGACTTACTGG - Intergenic
952377105 3:32777030-32777052 AAAATAAGGCTGAAAGCTACTGG + Intergenic
952666187 3:35907044-35907066 AAAATGAGGCTGAAACCTACTGG - Intergenic
953147453 3:40291508-40291530 AAAACTGGGCTGCCAGTTCCAGG - Intergenic
953609774 3:44437939-44437961 AAAATGAGGCTGAGACTTACTGG - Intergenic
954247340 3:49341947-49341969 AAGATGAGGATGCATGTTACAGG + Intergenic
954287392 3:49628810-49628832 AAAATGAGGCTGCAAATCCCTGG - Intronic
955416501 3:58696779-58696801 AAAATGAGGCTGAAACCTACTGG + Intergenic
955515899 3:59726113-59726135 AAAATGAGGCTGAAACCTACTGG - Intergenic
956414854 3:69014816-69014838 AAAATGAGGCTGAAACCTACTGG + Intergenic
957218189 3:77348559-77348581 AAAATAAGGCTGAAACTTACCGG - Intronic
958069091 3:88586064-88586086 ATAACTAGGCTGCCAGTTACTGG + Intergenic
960386267 3:117025534-117025556 AAAATGAGGCTGAAACCTACTGG + Intronic
961561422 3:127733008-127733030 AAAATGAGGCTGAGAGCTACTGG + Intronic
964474586 3:157087255-157087277 CAAACTTGGCTGGAAGTTACTGG + Intergenic
964985899 3:162738338-162738360 AAAACTACATTGCAAGTTACAGG - Intergenic
965068548 3:163885235-163885257 AAAACAAGGGTGAAACTTACTGG + Intergenic
969303508 4:6311294-6311316 AAAATGAGGCTGAAACCTACTGG + Intergenic
969419665 4:7084953-7084975 AAAATGAGGCTGAGACTTACTGG - Intergenic
969420493 4:7091589-7091611 AAAATGAGGCTGAAACCTACTGG - Intergenic
970054044 4:11950965-11950987 AAAATGAGGCTGAAACCTACTGG + Intergenic
971005814 4:22373589-22373611 AAAATGAGGCTGAAACCTACTGG + Intronic
971998413 4:33996472-33996494 AAAATGAGGCTGAAACCTACTGG + Intergenic
972170708 4:36342309-36342331 AAAATCAGGGTGCAATTTACAGG + Intronic
973609762 4:52624455-52624477 AAAAAGAGACTAAAAGTTACCGG - Intronic
973942803 4:55927340-55927362 AAAATGAGGCTGAAACCTACTGG + Intergenic
976515475 4:85959435-85959457 AAAACGAGGCTGCAAGTTACTGG - Intronic
976644016 4:87368592-87368614 AAAATGAGGCTGAAACCTACCGG + Intronic
977553565 4:98466985-98467007 AAAATGAGGCTGAAACCTACTGG - Intergenic
977673880 4:99726607-99726629 AAAATGAGGCTGAAACCTACTGG - Intergenic
977674785 4:99734853-99734875 AAAATGAGGCTGAAACCTACTGG - Intergenic
979724259 4:123942008-123942030 AAAACCGGGCTGCCAGTTCCAGG + Intergenic
981710521 4:147704823-147704845 TAAAAGAGGCTGCATGTTGCTGG - Intergenic
981710991 4:147708886-147708908 AAAATGAGGCTGAGAGCTACTGG + Intergenic
982236238 4:153253564-153253586 AAAATGAGGCTGAAACCTACTGG + Intronic
982265848 4:153537766-153537788 AAAACGAGGCTGAAACCTACTGG - Intronic
983401176 4:167268231-167268253 AAAATGAGGCTGAAACCTACTGG + Intergenic
983787006 4:171745133-171745155 AAAACAAGACTGTAACTTACAGG + Intergenic
984650121 4:182262326-182262348 AAAATGAGGCTGAAACCTACTGG + Intronic
987322382 5:16782625-16782647 AAAAACAGGCTGCAAGATATGGG + Intronic
988182712 5:27817770-27817792 AAAATGAGGCTGAAACCTACTGG + Intergenic
988210146 5:28193213-28193235 AAAATGAGGCTGAAACCTACTGG - Intergenic
989425420 5:41290719-41290741 GAAACCAGGCTGCCAGTTCCAGG - Intergenic
989742120 5:44785597-44785619 AAAATGAGGCTGGAACTTGCTGG - Intergenic
990384748 5:55249505-55249527 AAAATGAGGCTGAAACCTACTGG + Intergenic
992865842 5:80956468-80956490 AAAATGAGGCTGAAACCTACTGG - Intergenic
994874139 5:105393113-105393135 AAAACCGGGCTGCCAGTTCCAGG - Intergenic
994959936 5:106586777-106586799 AAAATGAGGCTGAAACCTACTGG + Intergenic
996293295 5:121879995-121880017 AAAATGAGGCTGAGACTTACTGG - Intergenic
996367590 5:122719505-122719527 AAAATGAGGCTGAAACCTACTGG + Intergenic
996925720 5:128823983-128824005 AAAATGAGGCTGAAACCTACTGG + Intronic
999091384 5:148939232-148939254 ACAAGGAGGCTGCATGTTCCAGG + Intronic
1000060916 5:157654588-157654610 AAAATGAGGCTGAAACATACTGG + Intronic
1000065928 5:157693446-157693468 AAAATGAGGCTGAAATCTACTGG + Intergenic
1001388735 5:171361338-171361360 AAAATGAGGCTGAAACCTACTGG + Intergenic
1002029657 5:176418443-176418465 AAAATGAGGCTGAAACCTACTGG + Intergenic
1002106881 5:176883878-176883900 AAAAGGATGCTGCTAGTTGCTGG + Intronic
1002185566 5:177453339-177453361 AACACGATGCTGCCAGTCACTGG - Intronic
1003123826 6:3339476-3339498 AAAATGAGGCTGAAACCTACTGG + Intronic
1003375450 6:5572619-5572641 AAAATGAGGCTACTTGTTACGGG - Intronic
1005154442 6:22788122-22788144 CAAACGAGGCTGCAAGTCATAGG - Intergenic
1005902303 6:30227408-30227430 AAAATGAGGCTGCAACTTGGCGG - Intergenic
1006329230 6:33377808-33377830 AAAATGAGGCTGAAACGTACTGG - Intergenic
1008084769 6:47232933-47232955 AAAGATAGGCTGCAAGTCACAGG + Exonic
1010445989 6:75949182-75949204 AAAATGAGGCTGAAACCTACTGG + Intronic
1011285253 6:85715841-85715863 AAAACCAAGCTGCTAGTTCCAGG - Intergenic
1011508217 6:88071709-88071731 AAAAGGAGGCAGCAACTTAGTGG - Intergenic
1012328828 6:97958685-97958707 AAAACCAAGCTGCAGGTTTCAGG - Intergenic
1014200310 6:118601974-118601996 AAAATGAGGCTGAAACCTACTGG - Intronic
1014242941 6:119038324-119038346 AAAATGAGGCTGAAACCTACTGG + Intronic
1015398114 6:132757957-132757979 AACATGTGGCTGCCAGTTACTGG + Exonic
1016012902 6:139157365-139157387 AAAATGAGGCTGAAACCTACTGG - Intronic
1016156579 6:140817475-140817497 AAAACGTGGTTGCAAGCTAACGG - Intergenic
1016733376 6:147449744-147449766 AAAATGAGGCTGAGACTTACTGG - Intergenic
1017752582 6:157502182-157502204 GAAAGGAGGCTGCAAAGTACAGG + Intronic
1019007299 6:168809714-168809736 AAAACGAGGCTGAGACCTACTGG - Intergenic
1021386729 7:20039801-20039823 AAAATGAGGCTGAAACCTACTGG - Intergenic
1021574087 7:22091742-22091764 AAAACGAGGCTGGGACTTGCTGG - Intergenic
1022478607 7:30728188-30728210 AAAATGAGGCTGAAACCTACTGG + Intronic
1024722229 7:52149979-52150001 AAAATGAGGCTGAAACCTACAGG - Intergenic
1025768497 7:64481739-64481761 AAAATGAGGCTGAAACCTACTGG + Intergenic
1025769185 7:64488276-64488298 AAAATGAGGCTGAAACCTACTGG + Intergenic
1026253723 7:68692693-68692715 AAAATGAGGCTGAAACCTACTGG + Intergenic
1027616437 7:80430311-80430333 AAAATGAGGCTGAAACCTACTGG - Intronic
1027958435 7:84913113-84913135 AAAACGAGGCTGAAACCTGCTGG + Intergenic
1028026845 7:85853681-85853703 AACATGAGGATGTAAGTTACTGG - Intergenic
1028441077 7:90861544-90861566 TAAAGGAGGCTGAAAGTGACTGG + Intronic
1028486563 7:91365117-91365139 AAAATGAGGCTGAAACCTACTGG + Intergenic
1029369736 7:100141361-100141383 AAACTGAAGCTGCCAGTTACTGG + Intergenic
1030316321 7:108118035-108118057 AAAATGAGGCTGAAACCTACTGG - Intronic
1031196832 7:118626815-118626837 AAAACCAGGCTGCCAGTTCCTGG + Intergenic
1031533735 7:122908483-122908505 AAAATGAGGCTGAAATCTACTGG - Intergenic
1032794209 7:135264467-135264489 AAAACTGGGCTGCCAGTTCCAGG - Intergenic
1033351468 7:140565713-140565735 AAAATGAGGCTGAAACCTACTGG + Intronic
1033995657 7:147343460-147343482 AAAATGAGGCTCCAAGATAGTGG - Intronic
1034970424 7:155415840-155415862 AAACTGAGGCTGCAAATTTCTGG - Intergenic
1035127695 7:156620341-156620363 AAAACGAGGCTGAAACCTACTGG - Intergenic
1035872672 8:3152998-3153020 AAAACAAGGCTGAAACGTACTGG + Intronic
1037539760 8:19859617-19859639 AAAACCAGGCTGCCAGTTTCAGG - Intergenic
1038439631 8:27562359-27562381 AAAATGAGGCTGAAACCTACTGG - Intergenic
1038548367 8:28443640-28443662 AAAATGAGGCTGAAACCTACTGG + Intronic
1039241008 8:35556859-35556881 AAAATGAGGCTGGAACTTGCAGG - Intronic
1039302256 8:36222014-36222036 AAAATGAGGCTGAAACCTACTGG - Intergenic
1039499467 8:38005207-38005229 AAAATGAGGCTGAGACTTACCGG - Intergenic
1039963533 8:42267953-42267975 AAAATGAGGATTCAAATTACAGG + Intergenic
1040335931 8:46415969-46415991 GAAACGGGGCTGCAAGTTGGCGG + Intergenic
1040854631 8:51936197-51936219 AAAATGAGGCTGAAACCTACTGG + Intergenic
1041742176 8:61167628-61167650 AAAATGAGGCTGAAACTTACTGG + Intronic
1042002370 8:64138881-64138903 AAAAGGAGGCAGCAAGCTAGGGG + Intergenic
1042264320 8:66892705-66892727 AAAACCAGGCTGCCAGTTCTGGG - Intronic
1042916949 8:73884782-73884804 AGAACGAGGCTGCTTATTACTGG + Intergenic
1042991694 8:74647479-74647501 AAAACCAAGCTGTAAGTTTCTGG + Intronic
1043004896 8:74807404-74807426 AAAACGAGGCTGAGACCTACTGG + Intronic
1043070659 8:75631695-75631717 AAAATGAGGCTGAAACCTACTGG - Intergenic
1043297027 8:78678204-78678226 AAAATGAGGCTGAAACCTACTGG - Intronic
1043535217 8:81195990-81196012 AAAATGAGGCTGGAACCTACTGG + Intergenic
1043777818 8:84292474-84292496 AAAATGAGGCTGAAACCTACTGG + Intronic
1045688503 8:104736458-104736480 AAAATGAGGCTGAAACCTACTGG + Intronic
1046249658 8:111612729-111612751 AAAACCAGGCTGCCAGTTCTGGG - Intergenic
1046670122 8:117047717-117047739 AAAATGAGGCTGAAACCTACTGG + Intronic
1047390907 8:124450502-124450524 AAAATGAGGCTGAAACCTACTGG - Intergenic
1048696353 8:137032345-137032367 AAAATGAGGCTGAAACCTACTGG - Intergenic
1048875232 8:138831891-138831913 AAAATGAGGCTGAAACTTACTGG + Intronic
1049451022 8:142661551-142661573 AAACTGAGGCTGCAACTTGCAGG + Intronic
1051974526 9:22933509-22933531 AAAATGAGGCTGAAACTTACTGG - Intergenic
1052158667 9:25227091-25227113 AAAACCCGGCTGCCAGTTCCAGG - Intergenic
1052171179 9:25399077-25399099 AAAAGGAGGCTGTAAGATATTGG - Intergenic
1052521531 9:29554097-29554119 AAAATGAGGCTGAAACCTACTGG + Intergenic
1052663392 9:31464705-31464727 AAAATGAGGCTGAAAACTACTGG - Intergenic
1052773417 9:32710089-32710111 AAAATGAGGCTGAAACCTACTGG + Intergenic
1055451749 9:76437216-76437238 AAAATAAGGCTGAAACTTACTGG + Intronic
1056528607 9:87467360-87467382 AAAAGGAGGCTGAAACCTACTGG + Intergenic
1057531069 9:95847306-95847328 AAAACGAGGCTGAGACCTACTGG + Intergenic
1057596730 9:96420899-96420921 AAAATGAGGCTGAAACCTACTGG + Intergenic
1060681256 9:125567242-125567264 AAAATGAGGCTGAAACCTACTGG + Intronic
1062383498 9:136298973-136298995 AAAACGAGGCTGCCAGGAGCCGG + Intronic
1062674521 9:137732663-137732685 AAAACCGGGCTGCCAGTTCCCGG - Intronic
1185651878 X:1653999-1654021 AAAATGAGGCTGAGACTTACTGG + Intergenic
1185841783 X:3398743-3398765 AAAATGAGGCTGAAACCTACTGG + Intergenic
1186011732 X:5142199-5142221 AAAATGAGGCTGGAACTTGCTGG - Intergenic
1186116881 X:6313547-6313569 AAAATGAGGCTGGAACTTCCTGG + Intergenic
1186161653 X:6783019-6783041 AAAATGAGGCTGGAACTTGCTGG + Intergenic
1186205709 X:7197784-7197806 AAAATGAGGCTGGAACTTGCTGG - Intergenic
1186696001 X:12032705-12032727 AAAACGATGATGGAAGTTGCTGG + Intergenic
1188433961 X:30139290-30139312 AAAATGAGGCTGAAACCTACTGG - Intergenic
1189086175 X:38026869-38026891 AAAATGAGGCTGAAACCTACTGG - Intronic
1189419784 X:40846607-40846629 AAAACGAGGCTGAGACCTACTGG - Intergenic
1189965543 X:46368759-46368781 AAAATGAGGCTGAAACCTACTGG - Intergenic
1190815068 X:53922682-53922704 AAAATGAGGCTGAAACCTACCGG + Intergenic
1190815835 X:53928428-53928450 AAAATGAGGCTGAAACCTACTGG + Intergenic
1190947593 X:55110934-55110956 AAAATGAGGCTGAAATCTACTGG + Intronic
1190970013 X:55339639-55339661 AAAACCAGCCACCAAGTTACAGG + Intergenic
1194997857 X:100611292-100611314 AAAATGAGGCTGAAACCTACTGG - Intergenic
1195134223 X:101887714-101887736 AAAATGAGGCTGCACACTACTGG + Intronic
1198862752 X:141088492-141088514 AAAATGAGGCTGAAACCTACTGG - Intergenic
1198899941 X:141498894-141498916 AAAATGAGGCTGAAACCTACTGG + Intergenic
1201383482 Y:13412974-13412996 AAAACTGGGCTGCCAGTTACAGG + Intronic
1201537664 Y:15068377-15068399 AAAATGAGGCTGAGACTTACTGG + Intergenic
1201710986 Y:16991618-16991640 AAAATAATGCTGCAAGGTACTGG + Intergenic