ID: 976517010

View in Genome Browser
Species Human (GRCh38)
Location 4:85980500-85980522
Sequence TGCAGTAACCATACTGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976517010 Original CRISPR TGCAGTAACCATACTGGTGT TGG (reversed) Intronic
900986583 1:6076695-6076717 TGGGGTAACCGTACTGGGGTAGG + Intronic
901966783 1:12874840-12874862 TGCTGTAAACATCCAGGTGTGGG - Intronic
901982181 1:13045089-13045111 TGCTGTAAACATCCAGGTGTGGG - Intronic
901999902 1:13183824-13183846 TGCTGTAAACATCCAGGTGTGGG + Intergenic
902018389 1:13326971-13326993 TGCTGTAAACATCCAGGTGTGGG + Intergenic
910716283 1:90235277-90235299 TGCAAAAACCATAGTGCTGTTGG - Intergenic
912521345 1:110247206-110247228 TGCAGTAAACATACGAGTGCAGG + Intronic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
914891208 1:151625204-151625226 TGCTTTAAAAATACTGGTGTAGG + Intronic
916576613 1:166072589-166072611 TGAAATAACCATACTGGAGTCGG + Intronic
917148888 1:171924129-171924151 TGCAGTAAACATACAAGTATAGG + Intronic
918454227 1:184690660-184690682 TGCTGTAACACTACTGTTGTTGG - Exonic
920891543 1:209992043-209992065 TGCAATAAACATACAGGTGCAGG - Intronic
923001211 1:230007808-230007830 TGCAATAAACATACGAGTGTAGG - Intergenic
1064346176 10:14534579-14534601 TGCTGTAAGCATGCTGGTGGAGG - Intronic
1065195278 10:23258221-23258243 TCCAGTAGCCAGATTGGTGTGGG - Intergenic
1070017180 10:72544796-72544818 TGGAGTAATCATACTTGAGTAGG - Intronic
1071989270 10:91084526-91084548 TGCAATAAACATACCAGTGTGGG + Intergenic
1074300220 10:112226583-112226605 TGCAGCTTCCATACTAGTGTTGG - Intergenic
1078978876 11:16508394-16508416 TGCAGTAAACATGGAGGTGTAGG - Intronic
1079242938 11:18733458-18733480 GGCAGGAGCCAGACTGGTGTAGG + Intronic
1079861666 11:25680021-25680043 TTCAGTAAACATAGTGGTCTGGG + Intergenic
1079924992 11:26483020-26483042 TGCAATAAACATACTAGTGCAGG + Intronic
1085117950 11:73946954-73946976 CGCAGCTGCCATACTGGTGTTGG - Intergenic
1086456364 11:86962535-86962557 TGCAGTAAACATACATGTGCAGG + Intergenic
1090325031 11:125878399-125878421 TTTAGTAAACATACTGGTGAAGG + Intergenic
1093532856 12:20187798-20187820 TCCAGAAACCATAGTGGTTTGGG + Intergenic
1093857657 12:24125846-24125868 TACAGAAACCAGAATGGTGTGGG - Intergenic
1094739995 12:33277915-33277937 TGCTGTAACCATTCTTGTATAGG - Intergenic
1097755006 12:63399186-63399208 TGCAGCCTCCATACTAGTGTTGG - Intergenic
1099130711 12:78826864-78826886 TGCAGTAAACATACACATGTAGG + Intergenic
1099216539 12:79860845-79860867 TTCAGTAATCATACTGGTGGTGG + Intronic
1100918774 12:99458160-99458182 TGCAGTAATCATTCAGGAGTAGG - Intronic
1104383854 12:128331720-128331742 TGCAATAAACATACCAGTGTAGG + Intronic
1104505162 12:129325145-129325167 CTCAGTAACCATGCTGGTGCTGG - Intronic
1105609848 13:21958715-21958737 TGCAATAAACATACTGGTGCAGG + Intergenic
1107450216 13:40501484-40501506 TGCAGTAAACATGGGGGTGTAGG - Intergenic
1109446746 13:62449201-62449223 TGCTGTATCCATTCTGTTGTAGG - Intergenic
1116401842 14:44516428-44516450 TGCGGTAAACATACTAGTATAGG + Intergenic
1117357679 14:54941333-54941355 TGTAGTAATTATATTGGTGTAGG - Exonic
1124256864 15:28151110-28151132 TTCAGTAATTATACTGATGTTGG + Intronic
1124567472 15:30829407-30829429 TTCAGTAATTATACTGATGTTGG - Intergenic
1128004022 15:64221005-64221027 TGGAGTAACCATGCTAATGTTGG + Intronic
1128032246 15:64491304-64491326 TGTAGTAACCATACTGAAGCTGG + Intronic
1129527477 15:76229384-76229406 TGAAGTAAGGAGACTGGTGTTGG - Intronic
1140566223 16:76045936-76045958 TGCAGTAAACATACATGTGCAGG - Intergenic
1143395724 17:6593932-6593954 TGTGGTAACCATCCTGGTGAAGG - Intronic
1144599944 17:16602982-16603004 TGCAATAAACATACACGTGTAGG - Intergenic
1145159226 17:20563220-20563242 TGCAGCCTCCATACTAGTGTTGG - Intergenic
1150372897 17:64656690-64656712 TGCTGTAAACATCTTGGTGTAGG - Intronic
1150779375 17:68107858-68107880 TGCTGTAAGCATCTTGGTGTAGG + Intergenic
1155605733 18:27603636-27603658 AGCAGTAACCATACCAGAGTGGG + Intergenic
1156960642 18:43025472-43025494 TGCAATAAACATACAGGTGTAGG - Intronic
1160884786 19:1340803-1340825 TGCAGTCCCCGTGCTGGTGTGGG - Intergenic
1162880746 19:13657247-13657269 TTCAGTAAACATACAGGTGCAGG + Intergenic
1168198441 19:54794105-54794127 TGCAATAAACATACAGGTGCAGG + Intronic
1168601377 19:57721501-57721523 GGCAGAAACCATACTTGTGTGGG - Exonic
1168624247 19:57904342-57904364 TGCAGCCTCCATACTGGCGTTGG + Intronic
927526314 2:23744573-23744595 TGCAGTAACCACCATGGGGTTGG + Intergenic
930209776 2:48623605-48623627 TGCAATAAACATACAAGTGTGGG - Intronic
932324541 2:70848951-70848973 TGCAATAAACATACAAGTGTAGG - Intergenic
936752910 2:115667714-115667736 TGCAGTAACCAAAATGGCATGGG - Intronic
937255021 2:120549178-120549200 TACAGTCATCATTCTGGTGTGGG + Intergenic
937545345 2:123010783-123010805 TGCAGTAAGCATGCAGGTGCAGG - Intergenic
938859352 2:135351196-135351218 TGCAGTAGCCATAGTGGTTCTGG - Intronic
941307397 2:163888081-163888103 TGCAGTAGCTATACTGCTATAGG + Intergenic
941672449 2:168309815-168309837 TGCAGGAACCATAGTGTTATTGG - Intergenic
942896684 2:181064777-181064799 GGCTGTGTCCATACTGGTGTGGG + Intronic
943245666 2:185447581-185447603 TGCAGTAAACATACAAGTGCAGG - Intergenic
945722457 2:213435001-213435023 TGCAATAACCATACAAGTGTAGG - Intronic
1169014052 20:2277167-2277189 TGCAATAAACATACACGTGTAGG + Intergenic
1170368813 20:15626075-15626097 TGCATTAACCATACAGATGAAGG + Intronic
1172836428 20:37876278-37876300 TGCAGTGATCATCCTTGTGTAGG + Intergenic
1175445965 20:59019419-59019441 TGCAGTGACCACAGTTGTGTTGG + Exonic
1182921024 22:34079239-34079261 TGCAATAAACATACAAGTGTAGG - Intergenic
949506528 3:4733458-4733480 TGCAGTGACCATCTTGGTGATGG + Intronic
952522161 3:34172264-34172286 TGCAGTAAACATACATGTGCAGG + Intergenic
956069947 3:65438068-65438090 TGCAGTAAACATACAAGTGTAGG - Intronic
957481003 3:80793550-80793572 TGCAATAAGCATACAAGTGTAGG - Intergenic
959279339 3:104317559-104317581 GGCAGTAGCCATACTGGGCTTGG + Intergenic
959450746 3:106496623-106496645 TGCAGAGACCTTCCTGGTGTTGG - Intergenic
960508593 3:118522436-118522458 TGCAGTAAACATACATGTGCAGG - Intergenic
962517151 3:136162869-136162891 TTCAGTAACCACACTGTTGGCGG + Intronic
962730304 3:138276111-138276133 TGCAAAAACAATACTGTTGTTGG - Intronic
963878939 3:150505474-150505496 TGTAGAGACCATAGTGGTGTAGG - Intergenic
966220208 3:177544209-177544231 TGCAGGCACCACCCTGGTGTAGG + Intergenic
966960636 3:184934548-184934570 TACAGTAAACATACTTATGTTGG - Intronic
967251055 3:187538939-187538961 TCCAGTAATCATATTGGTGATGG + Intergenic
971094972 4:23390435-23390457 TGTCGTAAGCATTCTGGTGTTGG - Intergenic
974473313 4:62346916-62346938 AGCAGTAACCATAGTGATATGGG - Intergenic
975267074 4:72382574-72382596 TGCAGTAAACGTACAGGTTTAGG - Intronic
976517010 4:85980500-85980522 TGCAGTAACCATACTGGTGTTGG - Intronic
977013354 4:91660817-91660839 TGCAATAAACATACTAGTCTTGG + Intergenic
977256724 4:94749139-94749161 TGCAGTAAATAAACTTGTGTAGG + Intergenic
977655357 4:99515238-99515260 TGCAGTGAACATACAGGTGCAGG - Intronic
977829561 4:101574581-101574603 TGCAATAAACATGCTGGTGTAGG + Intronic
982491316 4:156033035-156033057 TGCAGTAAACATCCATGTGTAGG + Intergenic
982762655 4:159305129-159305151 TGCAATAAACATACAGGTGCAGG + Intronic
984222957 4:177000694-177000716 GGCAGTAACCAAACTGTTCTGGG - Intergenic
988465631 5:31488865-31488887 TACAGTGACCATTCTGATGTGGG + Intronic
988906440 5:35795564-35795586 TGCAGAAACCACAGGGGTGTAGG - Intronic
993212652 5:84974208-84974230 TGCAATAAACATACCAGTGTAGG + Intergenic
996031617 5:118711775-118711797 TGCAGGTACCAGACTGGAGTCGG - Intergenic
996649955 5:125863763-125863785 TGCCGTAACCATAGTGTAGTAGG + Intergenic
999413566 5:151374524-151374546 TGCAGTAAACATGCTAGTGCAGG + Intergenic
1000265033 5:159627935-159627957 TGCAGCAACCTGAGTGGTGTTGG + Intergenic
1000870587 5:166572371-166572393 TGCATTAACAATACTGGCATGGG + Intergenic
1008361673 6:50626386-50626408 TGCAGTAACCAGGATGGAGTTGG + Intergenic
1009351368 6:62683880-62683902 TCCAGTAACAATAGTGGAGTAGG - Intergenic
1009423873 6:63492764-63492786 TTCAGTAAACACACAGGTGTAGG + Intergenic
1013382334 6:109587743-109587765 TGCAATAAGCATACTAGTGCAGG + Intronic
1013545596 6:111153900-111153922 TGCAGAAACCATATGGGTGGTGG - Intronic
1015151386 6:130042893-130042915 AGCATTAATCATAGTGGTGTAGG + Intronic
1016784802 6:147998879-147998901 TACAATAAGCATACTTGTGTAGG + Intergenic
1022431919 7:30332825-30332847 TGCAGTAAACATACGAGTGCAGG + Intronic
1027789785 7:82624939-82624961 TGCAGTAGAGATTCTGGTGTTGG - Intergenic
1031022794 7:116646305-116646327 AGCAGTACCCATCCTGATGTAGG - Intergenic
1031023321 7:116651696-116651718 TACAGTGACCATACCGGTGAAGG - Intergenic
1037209327 8:16366564-16366586 TGCAGTAAACATACGTGTGCAGG - Intronic
1039836160 8:41258006-41258028 TGTAATAAACATACAGGTGTAGG + Intergenic
1041854788 8:62438941-62438963 TGCAGGAGCAATGCTGGTGTTGG + Intronic
1042095148 8:65207129-65207151 TGCAGCAACCCTAATGGAGTTGG - Intergenic
1046368286 8:113267293-113267315 TGCAGTAACCATGTTAGTGCAGG - Intronic
1050389456 9:5123600-5123622 TGCAATAAACATACAGGTGGAGG + Intronic
1050668683 9:7971098-7971120 GGCAGAAACAATACTGGTGATGG + Intergenic
1051691481 9:19717791-19717813 TGCAGTGATTATACTGGAGTAGG + Intronic
1051820372 9:21158942-21158964 GGCAGAAACCAGACTGGAGTAGG - Intergenic
1051820778 9:21164535-21164557 AGCAGAAACCATACTGAGGTAGG - Intergenic
1051826471 9:21226297-21226319 AGCAGAAGCCATACTGGGGTAGG - Intronic
1051827650 9:21238214-21238236 AGCAGAAGCCATACTGGGGTAGG - Intronic
1053703141 9:40721394-40721416 TGCAATAAACATACAAGTGTAGG - Intergenic
1188780231 X:34274252-34274274 TGCAATAAACATACTTGTGCAGG + Intergenic
1190079019 X:47340664-47340686 TTTTGTAACCATACTTGTGTGGG + Intergenic
1190837446 X:54113941-54113963 TGCAATAAACATACAGGTGCAGG - Intronic
1191908510 X:66122167-66122189 TGCAGTAAACATACGTTTGTAGG + Intergenic
1193976299 X:88123622-88123644 TGCAGCAACATTAATGGTGTTGG + Intergenic
1195139797 X:101947833-101947855 CACAGTAACCATGGTGGTGTTGG - Intergenic
1195250610 X:103041541-103041563 TGCAGTAAACATACAGGTGCAGG + Intergenic
1196577854 X:117341184-117341206 TGCAATAAACATAAAGGTGTAGG - Intergenic
1197324968 X:125081684-125081706 TGCAATAAACATACAAGTGTAGG - Intergenic
1197861520 X:130976041-130976063 TGCAGTAACCATACTTGGCATGG - Intergenic
1198967599 X:142244324-142244346 TGCAGGAGCCATACTGGTGCTGG - Intergenic