ID: 976517609

View in Genome Browser
Species Human (GRCh38)
Location 4:85986931-85986953
Sequence CAGTGGGAGCTCAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 756
Summary {0: 1, 1: 0, 2: 13, 3: 91, 4: 651}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976517602_976517609 10 Left 976517602 4:85986898-85986920 CCTCACAAATTTTAAAGCATCTT 0: 2
1: 0
2: 0
3: 50
4: 460
Right 976517609 4:85986931-85986953 CAGTGGGAGCTCAGGGAGGAAGG 0: 1
1: 0
2: 13
3: 91
4: 651

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976517609 Original CRISPR CAGTGGGAGCTCAGGGAGGA AGG Intronic
900159428 1:1216474-1216496 CAGTGGGAGCTCAGGGAAGCCGG - Intergenic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
901024064 1:6269902-6269924 CCCTGGGCACTCAGGGAGGAAGG - Intronic
901328092 1:8381243-8381265 CAGTCGGAGGAAAGGGAGGAGGG - Intronic
901370014 1:8789024-8789046 CAGTGGGTGCTCAGGGTGAGAGG + Intronic
901511799 1:9721352-9721374 CAGAGGGAGGCCAGGCAGGAGGG - Intronic
901749097 1:11395170-11395192 CTGTGGGAGCTTAGGAAGGGCGG + Intergenic
901773933 1:11546143-11546165 CAGTGACAGCTCAGGGAGGAGGG - Intergenic
902288142 1:15419722-15419744 CAGTTCCAGCTCAGGGAGAAGGG + Intronic
902553888 1:17235448-17235470 CGGTAGGACCTCAGGCAGGAGGG + Intronic
902604505 1:17561361-17561383 CAGTGGGGGCACTGGGAGGTGGG + Intronic
902799098 1:18818419-18818441 GAGGGGGAGCTGAGGGAGGTGGG + Intergenic
902996647 1:20230533-20230555 CAGTGGCACTTCAGGCAGGAAGG + Intergenic
903479009 1:23639612-23639634 CCAGGGGAGATCAGGGAGGAAGG - Intronic
903545179 1:24119468-24119490 CTGTGGGGGATCAGGGAGGCTGG + Intergenic
903773776 1:25780331-25780353 CAGAGGGAGCTGAGGAAGGAGGG - Intronic
903789854 1:25885374-25885396 AAGTGGGACCTTAGGAAGGAAGG - Intronic
904565964 1:31428666-31428688 CAGACGGAGAGCAGGGAGGAGGG + Intronic
905873096 1:41416146-41416168 GGGCGGGAGCTCAGGGAGGTTGG + Intergenic
906153658 1:43601876-43601898 CAGTTGGTGCTCAGTGAGGCAGG + Intronic
906196778 1:43934660-43934682 CAGTGGGAGCTCAGGAAGGCTGG + Intronic
906293781 1:44636714-44636736 CAGAGGGCGCCCAGGGAGAAGGG - Intronic
906667409 1:47631649-47631671 CACTGGGAGCACAGGGACAATGG - Intergenic
907188960 1:52633129-52633151 CAGGGGGAGCGCAGTGGGGAGGG + Intergenic
907459123 1:54594743-54594765 CAGTGGGAGCCCGGGGCAGAGGG - Intronic
907562797 1:55406325-55406347 CAGTGAGACCTCAAAGAGGAAGG - Intergenic
908029328 1:59983124-59983146 CAGTGGCAGATGAGGCAGGAGGG + Intergenic
908396840 1:63733026-63733048 CATGGGAAGCTCAGGGTGGAGGG + Intergenic
909595866 1:77405646-77405668 CAGTGGCTGCTCAGAGAGGCTGG + Intronic
909688994 1:78384490-78384512 CAGTGCAAACTCATGGAGGAAGG + Intronic
910830478 1:91456185-91456207 CAGTGGCAACTCAGGCTGGAGGG + Intergenic
910989032 1:93035915-93035937 GAGTGGGAACTGAGGAAGGATGG + Intergenic
911689616 1:100818196-100818218 CTTTGGGAACTCAGGGGGGAAGG + Intergenic
912554190 1:110504271-110504293 CAGGGGGAGGTCAGGGAGGCTGG + Intergenic
912832716 1:112967928-112967950 CAGAGGGAGGGTAGGGAGGAAGG - Intergenic
914264100 1:146022802-146022824 CTTTGGGAGCTGAGGCAGGAGGG + Intergenic
914415579 1:147478451-147478473 CTGTAGAAGCTCCGGGAGGAGGG - Intergenic
915003088 1:152611494-152611516 CATTGGCAGCTGAGGGAGGTAGG - Intergenic
915040683 1:152965946-152965968 GGGAGGGAGCTGAGGGAGGAGGG - Intergenic
915109284 1:153552907-153552929 CAGTGGGGCTTCAGGGAGGGCGG + Intergenic
915966422 1:160312685-160312707 CAGTTGGAGCACAGTGAGTAAGG - Intronic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
916507232 1:165439289-165439311 GAGTGGGAGCGAGGGGAGGAGGG + Intronic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
917342322 1:173992746-173992768 TCGTGGGTGCTCAGGTAGGATGG - Exonic
917661636 1:177182154-177182176 GTGAGGGAGCTAAGGGAGGATGG - Intronic
919914210 1:202130013-202130035 CAGTGGGAGCTCTGGCGGGAAGG - Exonic
920174498 1:204091823-204091845 CTTTGGGAGCTCAGGTGGGAGGG - Intronic
920904047 1:210142755-210142777 CAGTGGGAAATGGGGGAGGAAGG - Intronic
920973050 1:210758753-210758775 CTGTTGGGGCTCAGGGAGCATGG + Intronic
920987141 1:210901428-210901450 CAGTGGGTGGTCAGGTTGGATGG + Intronic
921273022 1:213489657-213489679 CAGTGGCAACTCAGGGAGGCAGG + Intergenic
921360841 1:214329840-214329862 CAGAGGCAGCTGAGGGAGGCAGG + Intronic
922276866 1:224087277-224087299 CTTTGGGAGGTCAGGGAGGGAGG - Intergenic
922812702 1:228426692-228426714 AAGTTGGAGCCCAGGGAGGGGGG + Intergenic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
923314726 1:232768858-232768880 CAGTAGGAGCTGAGGCTGGAAGG - Intergenic
923342807 1:233022043-233022065 GAGTGGGAGAGAAGGGAGGAGGG - Intronic
923482378 1:234397318-234397340 GAGTGGGAGGAGAGGGAGGAGGG + Intronic
924649987 1:245917273-245917295 CCATGGGAGGTCAAGGAGGAAGG - Intronic
924948951 1:248865261-248865283 CTTTGGGAGCTCAAGGAGGGAGG - Intergenic
1063612804 10:7577016-7577038 CAGTGGAAGCACAGGGAGGGAGG + Intronic
1063639929 10:7819007-7819029 CAGTGGAAGCCCAGGGACGTGGG - Intronic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1065111207 10:22441850-22441872 CAGGCGGGGGTCAGGGAGGATGG + Intronic
1065239561 10:23692590-23692612 CAGTGGGAAATAAGGAAGGAGGG + Intergenic
1065272644 10:24051080-24051102 CTTTGGGAACTCAGGGAGAAGGG - Intronic
1065546645 10:26828034-26828056 TAATGGGAGCTTAGCGAGGAAGG - Intronic
1065914850 10:30345801-30345823 CTTTGGGAGGTCAGGGAGGGTGG + Intronic
1066236166 10:33486812-33486834 AAGTGGGAGCTAAGACAGGAAGG + Intergenic
1066300093 10:34088620-34088642 CAGTGGGAGCCCCGGGTGGCAGG - Intergenic
1069491198 10:68862302-68862324 TAGTGAGAGCTCAAGGAGTATGG - Intronic
1069646352 10:70001342-70001364 GAGTGGGAGCTGAGGGAAGGGGG - Intergenic
1069827941 10:71265748-71265770 CAGTGGAAGCACAGGGAAGGTGG - Intronic
1070327724 10:75399380-75399402 CAGTGGTAGCTGAGGCAGTAAGG + Exonic
1070734725 10:78855616-78855638 CAGTGGGAGATGAGGCAGGCAGG + Intergenic
1070828813 10:79406400-79406422 CAGGGGGGTCGCAGGGAGGAAGG + Intronic
1070887709 10:79920068-79920090 CTCTGGGACCTCAGGGAGAATGG + Intergenic
1071358044 10:84818057-84818079 CAGTGGGAGTGCAGGGTGCAGGG + Intergenic
1071379327 10:85042375-85042397 AGGTGGGAGCTAAAGGAGGAGGG + Intergenic
1071499355 10:86192510-86192532 CAGTGGGTGCTGAGGGCTGAAGG + Intronic
1072188201 10:93061504-93061526 CAGTGGGAGCCGGGGGAAGAAGG - Intronic
1072951257 10:99848498-99848520 AAGTTGAAGCTCAGGAAGGAAGG + Intronic
1073563584 10:104517142-104517164 CAGCGGGAGCTCAGGGGGACAGG + Intergenic
1073577412 10:104638479-104638501 CAGGGGCAGCTCAGGGCTGAGGG + Intergenic
1073886951 10:108050318-108050340 CAGTGTGAGCTCATCAAGGAAGG + Intergenic
1074363727 10:112841740-112841762 CAGTGGGAGCTCAGTCACCAGGG + Intergenic
1074629829 10:115239940-115239962 GAGTGGGAGTTGAGGGATGAAGG + Intronic
1074814118 10:117132024-117132046 CAGTGGGAAATTAAGGAGGAGGG + Intronic
1075015643 10:118908445-118908467 CAGTGGGGGCTGGGGGAGGGAGG - Intergenic
1075081210 10:119385105-119385127 CAGTTGGAGGGGAGGGAGGAGGG + Intronic
1075734952 10:124658856-124658878 CAGTGGGGGCACAGGGAGCAGGG - Intronic
1075779459 10:125007517-125007539 CAGGTAGATCTCAGGGAGGATGG + Intronic
1076075619 10:127531678-127531700 CAGAGAGAGCTCAGGGAGATCGG - Intergenic
1076427659 10:130379200-130379222 CAGTGTGAGCTGAGGAGGGAAGG - Intergenic
1077048965 11:558237-558259 CTGTGGGAGCTCCTGGAGGAGGG + Exonic
1077198130 11:1291660-1291682 CAGCGGGGGGTCAGCGAGGACGG - Intronic
1077198143 11:1291697-1291719 CAGAGGGGGGTCAGCGAGGACGG - Intronic
1077252575 11:1567125-1567147 CTGTGGGGGCACAGGGAAGATGG - Intronic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077278970 11:1733400-1733422 GAGGGGGTGCTCAGGGAAGAGGG - Exonic
1077337022 11:2009941-2009963 CAGTGGGATCTGAGCCAGGAAGG + Intergenic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1078357581 11:10643745-10643767 CGGTCGGAGCTTAGGGAGGGAGG - Intronic
1078457600 11:11487245-11487267 CTTTGGGGGCTCAGGGAGAAAGG + Intronic
1079298027 11:19252107-19252129 CAGTGGGAGGTCGGGGAAGGGGG - Intergenic
1079300443 11:19274272-19274294 CTTTGGGAGGTCAAGGAGGATGG + Intergenic
1079930513 11:26554086-26554108 CAGGGGAAGGTCAGGGAGGCAGG - Intronic
1082749119 11:56998943-56998965 CAGTTGGAGCACAGAGAAGAAGG + Intergenic
1082759153 11:57109749-57109771 CACAGGGAGTTCAGGAAGGAGGG - Intergenic
1082895848 11:58189059-58189081 GATTGGAAGCTCAGGGAGAAAGG + Intergenic
1082928774 11:58578701-58578723 CAGTGGCTCCTCAGGGAGGCAGG + Intergenic
1083061652 11:59879195-59879217 GAGTGGGAGATCAGGGTGGGAGG - Intergenic
1083215216 11:61214486-61214508 CCGTGGGAGGCCAGGGTGGAGGG - Intergenic
1083218100 11:61233315-61233337 CCGTGGGAGGCCAGGGTGGAGGG - Intergenic
1083221082 11:61253061-61253083 CCGTGGGAGGCCAGGGTGGACGG - Intergenic
1083250660 11:61464466-61464488 CTTTGGGAGCTCAGGGAGGAAGG - Intronic
1083613168 11:64014038-64014060 CACTGGGAGCTCAGGGGACAGGG + Intronic
1083882507 11:65555491-65555513 GAGAGGGAGCTCAGGGGGGCCGG - Intronic
1083911738 11:65713793-65713815 CAGTGGCAGCCCAGCCAGGACGG + Exonic
1084129060 11:67119420-67119442 CAGGGGACGCTCCGGGAGGAGGG + Intronic
1084951222 11:72666652-72666674 CAATGTGAGCACAGGGATGAGGG - Intronic
1085266847 11:75242321-75242343 CGGTGGGAGCTCTCGGAGGCGGG - Exonic
1085601928 11:77862998-77863020 CATTAGGAGCTCTGGGAGCAAGG - Intronic
1085615501 11:77994923-77994945 CAATGGGAGCTTTGGGAGGCTGG + Intergenic
1086444289 11:86857919-86857941 CAGGGAGAGCCCAGTGAGGACGG + Intronic
1087453475 11:98353631-98353653 CAGAGGGAGCTAAGGAAGCATGG + Intergenic
1088351264 11:108890963-108890985 CAGAGGGAGAGCAGGGAGAAAGG - Intronic
1088651068 11:111958506-111958528 CAGAGGGAGCTAAGGCAGCAGGG - Intronic
1089315485 11:117588339-117588361 CACTGGGTGCTCAAGGAGCAGGG - Intronic
1089396253 11:118137863-118137885 CACGGAGAGCTCAGGGAGGAAGG - Intronic
1090266907 11:125359071-125359093 CTGTGGGAGCAAAGGCAGGAAGG + Intronic
1090309359 11:125721155-125721177 CTGTGGGAGCACAGGGAGAGAGG - Intergenic
1090626131 11:128610563-128610585 CAGAGGTAGTTCTGGGAGGAGGG - Intergenic
1090855524 11:130607043-130607065 CAGTGGGAGGTAAGGGGGCAGGG - Intergenic
1202820006 11_KI270721v1_random:65123-65145 CAGTGGGATCTGAGCCAGGAAGG + Intergenic
1091454688 12:598345-598367 CAGAGGGAGGGCAAGGAGGAGGG - Intronic
1092277554 12:7073282-7073304 CTTTGGGAGGCCAGGGAGGATGG + Intergenic
1092791103 12:12071701-12071723 GACAGGGAGCTCAGGGAGGAGGG - Intronic
1094121053 12:26974540-26974562 CAGAGGGGGTTCGGGGAGGAAGG + Intronic
1096476231 12:51910881-51910903 CAGAGGAAGCCCAGGCAGGAAGG + Intronic
1097176638 12:57147212-57147234 CAGGGGGAGGGCAGGGAGGAAGG - Intronic
1097320486 12:58220473-58220495 CAGCTGGAGCTTAGAGAGGAGGG - Intergenic
1099195270 12:79608299-79608321 CAGGGGGATGGCAGGGAGGATGG + Intronic
1100301900 12:93315308-93315330 CATTGGGTGCTGAGGGAGGCGGG - Intergenic
1100817959 12:98404111-98404133 CAGTGGGGACTCAGAGCGGATGG + Intergenic
1101120781 12:101577532-101577554 CTTTGGGAGGTCAAGGAGGACGG - Intronic
1101264814 12:103073161-103073183 CAGTGGGACCTATTGGAGGATGG + Intergenic
1102474725 12:113181098-113181120 CAGTGGGACCACAGGGGGCAGGG + Intronic
1102519721 12:113470854-113470876 CAGAGGGGGCCCAGCGAGGAAGG - Intronic
1102748983 12:115275670-115275692 CTTTGGGAACTCAGGGAGAAGGG + Intergenic
1102953284 12:117044354-117044376 GAGTGGGAAGACAGGGAGGAAGG - Intronic
1102974596 12:117197443-117197465 CACTGGGAAGCCAGGGAGGAGGG - Intergenic
1103196033 12:119044508-119044530 CTGTGGGGGCTCTGGGAGGCAGG - Intronic
1104541685 12:129671702-129671724 GAGTGGGAGCACGGAGAGGAAGG + Intronic
1104774830 12:131384912-131384934 CTGTGGGAGCCCAGGGATGCTGG + Intergenic
1104906105 12:132214280-132214302 CAGCAGGAGCCCAGGGATGAAGG + Intronic
1106143113 13:27027442-27027464 TAGTGGGAGCTGAGGGAGGGAGG + Intergenic
1107015365 13:35704663-35704685 CTGTGCCAGCTCAGGGAGGAGGG - Intergenic
1107139710 13:36984741-36984763 CGGTGGGAAGGCAGGGAGGAGGG + Intronic
1107822332 13:44297014-44297036 CAGTGTGAGCTTAAGAAGGAGGG - Intergenic
1107953765 13:45488942-45488964 CATTGGGAGGTCAAGGAGGGCGG + Intronic
1108251766 13:48574610-48574632 CAGTGGGAGCTGTGACAGGAAGG + Intergenic
1108506048 13:51113370-51113392 CAGTAGGAGCTCCAGGAGGGAGG - Intergenic
1109288063 13:60435478-60435500 AAGTGGGAGCTAAGGCATGAGGG - Intronic
1109743882 13:66594662-66594684 CACTGGGACCTGATGGAGGAGGG - Intronic
1110633448 13:77737016-77737038 GAGTTGGAGTTCAGGGAAGAGGG - Intronic
1111412629 13:87896238-87896260 CAGTGGGAGCAGAGTCAGGATGG - Intergenic
1111888162 13:94049294-94049316 CAGTGGGGGGTTGGGGAGGAGGG - Intronic
1112327780 13:98454760-98454782 CAGTGGGAGCTTCAGGAGCAGGG + Intronic
1112742533 13:102491502-102491524 CTGTGGGCACTCAGGGAGAAAGG + Intergenic
1113607142 13:111617271-111617293 CAGTCCTAGCTCAGGGAGAAAGG + Intronic
1114673452 14:24426888-24426910 CAGTGAGAGAGCTGGGAGGAAGG + Exonic
1114757520 14:25276575-25276597 CAGAGGAAGCTTAGGCAGGAAGG + Intergenic
1116546748 14:46177463-46177485 CATTGGGAGTTCAAGGAGGGTGG - Intergenic
1116866950 14:50039016-50039038 CAGGAGGAGCTCTGGGAGGGCGG + Intergenic
1118632495 14:67718514-67718536 CAGTGTTAGCCCTGGGAGGATGG + Intronic
1118693740 14:68364131-68364153 CAATCGGAGAGCAGGGAGGATGG - Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1119424572 14:74527384-74527406 CAGCGTGAGCTCAGGGAGGAGGG + Intronic
1119473221 14:74911947-74911969 CAGTGGCAGGGCAGGGAGGGCGG + Intronic
1119828877 14:77683093-77683115 CTCTGGGAGGTCAGGGCGGAAGG - Intronic
1119831870 14:77710395-77710417 CAGTGGGAAATAAGGCAGGAAGG + Intronic
1120862479 14:89267196-89267218 CAGTGGGTTCTCAGGGTAGACGG + Intronic
1121030529 14:90654794-90654816 GAATGGGAGGGCAGGGAGGAAGG - Intronic
1121237643 14:92404440-92404462 GACTGGGGGCTCAGGGAGGCAGG - Intronic
1121401980 14:93688030-93688052 CAGTGTGAGCTCAGTGGGAAGGG - Intronic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1121772163 14:96555931-96555953 CAGTGAAAGCTCAGGGGGTAAGG + Exonic
1121780293 14:96617821-96617843 CAGTAGGGGATCAGGGAGCAGGG + Intergenic
1121947402 14:98136375-98136397 CCGTGGGAGCCCAGGGAGCTGGG - Intergenic
1122172744 14:99890340-99890362 CCAAGGGAGCTCAGGGAGGGGGG - Intronic
1122306885 14:100772162-100772184 GAGTGGGAGAACAGGGAGGCTGG - Intergenic
1122374080 14:101247150-101247172 CAGTGAGAGAGCTGGGAGGATGG - Intergenic
1122742406 14:103879950-103879972 CCGTGTGAGGTCAGGGAGGGTGG - Intergenic
1122861979 14:104586806-104586828 AAGAGGCAGCTCAGGGAGGAGGG + Intronic
1122871315 14:104640371-104640393 GGGTGGAAGCTCAGGCAGGAGGG - Intergenic
1122898227 14:104770998-104771020 CAGAGGCAGCTCTGGGAGGGAGG + Intronic
1123072730 14:105649549-105649571 AAGTGGGAGGTAAGGGGGGATGG + Intergenic
1123992891 15:25696489-25696511 CAGTGGGAGCAACGGGATGAAGG - Intronic
1123995180 15:25713266-25713288 CAGTGGGGGCCCAGGAAGTAAGG - Intronic
1124102846 15:26712091-26712113 AAGTGGGAGGCCAGGGAGGTGGG + Intronic
1124114385 15:26827646-26827668 CAGTGTGAGCTGGGGCAGGAGGG - Intronic
1124142592 15:27089660-27089682 CAGTGGCAGATCATGCAGGAAGG + Intronic
1124200078 15:27671906-27671928 GCGTGGGAGCCCAGGAAGGATGG - Intergenic
1125796233 15:42406062-42406084 CAGCAGAAGCTCAGGAAGGAGGG - Intronic
1125802860 15:42465518-42465540 CTTTGGGAGCCCAGGGTGGAAGG - Intronic
1126114787 15:45198905-45198927 CAGTGGGAGTTTAGGGGAGACGG + Exonic
1126158478 15:45587153-45587175 TGGTGGGAGCTGGGGGAGGACGG - Exonic
1126305046 15:47246344-47246366 CAGTGGGAGCTAAAGCATGAGGG + Intronic
1127119227 15:55757035-55757057 CAGAGGAAGAACAGGGAGGAAGG + Intergenic
1127329286 15:57922974-57922996 CAGGATCAGCTCAGGGAGGAGGG + Intergenic
1127382923 15:58445102-58445124 GAGTGGGGGCTCAGGGAGCCTGG + Intronic
1127816771 15:62617550-62617572 CACAGGGAGCTCAGAGAGGCTGG - Intronic
1127898164 15:63321199-63321221 CTGTGGGAGCTCTGGGAGCTTGG + Intergenic
1128348100 15:66867492-66867514 CAGTTGGAGCACAGGAAAGATGG + Intergenic
1128638052 15:69315785-69315807 CAGTTGGAGCTCTGGGGGCAGGG + Intronic
1128648325 15:69393079-69393101 AAGTGGGAGCTGAGGGGAGAGGG + Intronic
1128713102 15:69886664-69886686 TGCTGGGAGCTCTGGGAGGATGG - Intergenic
1128904177 15:71452455-71452477 CTTTGAGAGCTGAGGGAGGAGGG - Intronic
1129183909 15:73894239-73894261 CAGTGTGGGCTGCGGGAGGATGG - Intergenic
1129192018 15:73942821-73942843 CAGTGGGAGAGAAGGGGGGAGGG - Intronic
1129239443 15:74242816-74242838 CAGTGGGGACTCAGAGAAGACGG - Intronic
1129347270 15:74930615-74930637 CTTTGGGAGCCAAGGGAGGAAGG - Intronic
1129516525 15:76160737-76160759 AGGTGGGGGCTCAGGGAGCACGG + Intronic
1129579945 15:76798114-76798136 CATTGGGAGCCCAAGGAGGGTGG + Intronic
1129608184 15:77034975-77034997 CCGTGGGCCCACAGGGAGGAGGG + Intronic
1129683251 15:77670473-77670495 GAGTGGAAGCTCTGGGAGGGTGG + Intronic
1129850803 15:78792571-78792593 CAAGGGGAGGTCAGAGAGGAAGG - Intronic
1130074100 15:80673990-80674012 CTGCGGGACCTCCGGGAGGAGGG - Intergenic
1130172657 15:81531692-81531714 CAGTGGGCACTGAGGGAGGAGGG - Intergenic
1130179432 15:81610129-81610151 CAGAGGCTTCTCAGGGAGGAAGG + Intergenic
1130209801 15:81912553-81912575 CAGAAGGAGGTCAGGAAGGAGGG - Intergenic
1130458799 15:84142388-84142410 CAGTGGGAGCTCTGGCAAGTTGG + Intergenic
1130636608 15:85627487-85627509 CAATGGGAGAGTAGGGAGGAAGG - Intronic
1130919933 15:88335445-88335467 CTGTGGGAACTCAGGGAGCAGGG + Intergenic
1130956570 15:88631014-88631036 CAGGCACAGCTCAGGGAGGAGGG + Exonic
1130987569 15:88854856-88854878 CAGTGGGAGGCCAAGTAGGAAGG - Exonic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1132101152 15:99024403-99024425 CAGAGGGAGCCCCAGGAGGATGG - Intergenic
1132735765 16:1385166-1385188 CAGAAGGAGGTCAGGGAGAAAGG + Intronic
1133285491 16:4688769-4688791 AGGTGGGAGCAGAGGGAGGAGGG - Intronic
1133430733 16:5734795-5734817 CAGTGGGAGCTCATCCAAGAAGG + Intergenic
1133503942 16:6391812-6391834 CAGTGTGAGCTCTTCGAGGATGG - Intronic
1133566628 16:7001698-7001720 CCGTGGGAGGCCAAGGAGGATGG - Intronic
1133914819 16:10099925-10099947 TTGAGGGAGCTCAGGGAGGCAGG + Intronic
1134090122 16:11387063-11387085 CAGGGGGCTCTCAGGGAGGAGGG + Intronic
1134167480 16:11941888-11941910 CCCTGGGAGCTCAGGAAGGAAGG - Intronic
1134444474 16:14320458-14320480 CTGTGGGCGCTTAGGGAAGAAGG - Intergenic
1134493219 16:14711824-14711846 CCCTGGGAGCTCAGGAAGGAAGG + Intronic
1134498600 16:14750948-14750970 CCCTGGGAGCTCAGGAAGGAAGG + Intronic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134525154 16:14937578-14937600 CCCTGGGAGCTCAGGAAGGAAGG + Intronic
1134547740 16:15123341-15123363 CCCTGGGAGCTCAGGAAGGAAGG - Intronic
1134581974 16:15378137-15378159 CCCTGGGAGCTCAGGAAGGAAGG - Intronic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134712742 16:16336065-16336087 CCCTGGGAGCTCAGGAAGGAAGG + Intergenic
1134720606 16:16379380-16379402 CCCTGGGAGCTCAGGAAGGAAGG + Intronic
1134946821 16:18332505-18332527 CCCTGGGAGCTCAGGAAGGAAGG - Intronic
1134954085 16:18372628-18372650 CCCTGGGAGCTCAGGAAGGAAGG - Intergenic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1135053258 16:19209535-19209557 CACTGGGGGCTTATGGAGGAAGG + Intronic
1135312910 16:21419540-21419562 CCCTGGGAGCTCAGGAAGGAAGG - Intronic
1135365833 16:21851820-21851842 CCCTGGGAGCTCAGGAAGGAAGG - Intronic
1135385378 16:22034975-22034997 CTTTGGGAGGTCAAGGAGGATGG - Intronic
1135445981 16:22519342-22519364 CCCTGGGAGCTCAGGAAGGAAGG + Intronic
1135917694 16:26620969-26620991 GAGTGGCAGTTCAGGGAGGGTGG - Intergenic
1136152066 16:28357271-28357293 CCCTGGGAGCTCAGGAAGGAAGG - Intronic
1136168319 16:28471139-28471161 CCCTGGGAGCTCAGGAAGGAAGG - Exonic
1136194682 16:28643912-28643934 CCCTGGGAGCTCAGGAAGGAAGG + Intronic
1136211014 16:28758011-28758033 CCCTGGGAGCTCAGGAAGGAAGG + Exonic
1136255735 16:29037969-29037991 CCCTGGGAGCTCAGGAAGGAAGG + Intergenic
1136309575 16:29398267-29398289 CCCTGGGAGCTCAGGAAGGAAGG - Intronic
1136323023 16:29500048-29500070 CCCTGGGAGCTCAGGAAGGAAGG - Intronic
1136366778 16:29812585-29812607 GCCTGGGAGCCCAGGGAGGAGGG + Intronic
1136437707 16:30240016-30240038 CCCTGGGAGCTCAGGAAGGAAGG - Intronic
1136595573 16:31247193-31247215 CTTTGGGAGGCCAGGGAGGATGG - Intergenic
1137782960 16:51113567-51113589 CAGAGGGAGGTCACGGAGGCCGG + Intergenic
1138457637 16:57130632-57130654 CAGTCAGGGCTCGGGGAGGAGGG + Intronic
1139349980 16:66328796-66328818 CATAGGCAGGTCAGGGAGGAGGG + Intergenic
1139549909 16:67667386-67667408 GAGTCGGAGCTCCAGGAGGAAGG + Exonic
1139857259 16:69990647-69990669 CCCTGGGAGCTCAGGAAGGAAGG - Intergenic
1140283011 16:73572802-73572824 CTTTGGGATCCCAGGGAGGAAGG - Intergenic
1140365413 16:74377274-74377296 CCCTGGGAGCTCAGGAAGGAAGG + Intergenic
1140829411 16:78737592-78737614 CTTTGGGAACTCAGGGAGAAGGG - Intronic
1141778148 16:86138177-86138199 CAGTGGAAGCCCAAGGAGTAGGG + Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1142169600 16:88614839-88614861 CAGTGGGGTCTCAGGGGAGAAGG - Intronic
1142360438 16:89623793-89623815 CAGACGGAGCTCAGAAAGGAGGG + Intronic
1142469883 17:157350-157372 CAGTGGGCGCGCAGAGGGGACGG - Intronic
1142676051 17:1513994-1514016 CAGAGGGAAGTCATGGAGGAAGG + Intronic
1143018425 17:3904083-3904105 CACTGGGAGCTCCTGGAGAAGGG - Intronic
1143032845 17:3977266-3977288 CAGTGGGGGCTCAGGGTGGGAGG + Intergenic
1143390591 17:6556972-6556994 CAGAGGGAGCGGAGAGAGGAAGG + Intergenic
1143620016 17:8075403-8075425 CAGTGGCATCTCAGAGAGGTTGG - Intronic
1144390672 17:14790739-14790761 CTGTTAGAGCTCAGGGAGGAAGG + Intergenic
1145788735 17:27611062-27611084 CAGTTAAAGGTCAGGGAGGAAGG - Intronic
1146287884 17:31586639-31586661 CAGTGGAGGATCAGGGAGTATGG - Intergenic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1146662579 17:34674480-34674502 GAGTGGGACACCAGGGAGGATGG - Intergenic
1147725545 17:42564271-42564293 AAGTGGGGGCTCAGGGTGGTGGG + Intronic
1147916049 17:43887107-43887129 CTTTGGGAGGTCAAGGAGGAAGG + Intronic
1147948114 17:44091935-44091957 CAGTGGGAGCTCAGGGTAGAGGG - Intronic
1148357550 17:46985743-46985765 CAATGGAAGCCCAGAGAGGATGG - Intronic
1148689104 17:49516468-49516490 CAGTGGGGCCTCAGCGGGGAGGG + Intergenic
1148747002 17:49924140-49924162 CAGTGGGAGCTGTGTGGGGAGGG - Intergenic
1149040952 17:52187565-52187587 CAGTGTGAGCTCAGGGACATGGG + Intergenic
1149066810 17:52490254-52490276 TAGTGGCAACTCAGGGAAGAGGG + Intergenic
1150429844 17:65106261-65106283 CAGAGGGAGCTAACGGTGGATGG - Intergenic
1150505898 17:65698880-65698902 CAGTGCAAGCCCAGGGAAGAGGG + Intronic
1150885862 17:69084888-69084910 CAGTGGCAGAGCAGGGATGAGGG - Intronic
1151185238 17:72359397-72359419 CAATGGGAGGTGAGGGAGGCTGG - Intergenic
1151268210 17:72972926-72972948 CTGTGGTAGGTCAGGCAGGAAGG + Intronic
1151606067 17:75136869-75136891 CAGTGGGACCTCTGGGAATAGGG - Intronic
1151933730 17:77248701-77248723 TAGGGGGAGGTCATGGAGGAGGG - Intergenic
1152126412 17:78450017-78450039 CAGGGGAAGAGCAGGGAGGAGGG + Intronic
1152198684 17:78932764-78932786 CAATGGGAACTCAGGTAGGTGGG + Intergenic
1152728702 17:81959832-81959854 CACGGGGAGCTCAGGGACGGCGG + Intronic
1153532529 18:6062992-6063014 CTCTGGGGACTCAGGGAGGAAGG - Intronic
1153567598 18:6434373-6434395 CAGTGGGAGGTCAAGGCAGAAGG - Intergenic
1153767983 18:8392776-8392798 CAGTGGGAGCTCCGTCAGGCTGG - Intronic
1154118710 18:11633897-11633919 CCCTGGGAGCTCAGGAAGGAAGG - Intergenic
1154293019 18:13127157-13127179 CAGCTGGAGCTCAGGGAGGACGG - Intergenic
1154428268 18:14288661-14288683 CAGTGGGAGCTGGGGGTGGGGGG + Intergenic
1154428757 18:14292153-14292175 CAGTGGGAGTTGAGGGTGGGTGG + Intergenic
1155930507 18:31702730-31702752 CAGTGGTATCTCAGGAAGGCAGG + Intergenic
1155971241 18:32085755-32085777 CAATGAGAGATCAGGAAGGAAGG - Intergenic
1157517442 18:48320919-48320941 TGGTTGGAGCTCAGGGAGGCAGG - Intronic
1158414958 18:57242133-57242155 CAGTGGTAACTCAGAGAGGCAGG + Intergenic
1158440967 18:57473962-57473984 CAGTGGGAACTCAGACAGAAAGG - Intronic
1158813658 18:61068338-61068360 AAGGGGGAGCCCAGGGAAGAAGG - Intergenic
1158898008 18:61933714-61933736 CAATGGGAGCACAGGGAATAGGG + Intergenic
1159039480 18:63310104-63310126 CTGTGGGAGCTCAAGGTGGGTGG - Intronic
1159122512 18:64187248-64187270 CTGTGGAAACTCAGGGAGAATGG + Intergenic
1159279713 18:66270107-66270129 TATTGGGAGCTCTGGGAGCAAGG - Intergenic
1160134616 18:76261873-76261895 CAGTGGGAGCGCTGGGAGGGAGG + Intergenic
1160265925 18:77340879-77340901 CAGTGAGAAATTAGGGAGGAAGG + Intergenic
1160489731 18:79326579-79326601 CCATGTGAGCTCAGGGAGGGAGG - Intronic
1161526560 19:4759731-4759753 GAGCGGGAGCTGAGGGAGGGAGG + Intergenic
1161562040 19:4978798-4978820 CACTGGGAGCTCGGGCAGCATGG + Intronic
1161585850 19:5105071-5105093 CAGGGGCAGCTCAGGGAGCGGGG - Intronic
1161849616 19:6731676-6731698 AAGGGGGAGATCAGAGAGGAGGG + Intronic
1161973911 19:7598344-7598366 CGGTGGGAGATAAGGGAGGCTGG + Intronic
1162340536 19:10089211-10089233 CAGTGGGAACCCAGGGGGCAGGG + Intronic
1162364206 19:10238122-10238144 CAGTGGAGGCCCAGGGAGGATGG - Intergenic
1162942702 19:14022920-14022942 CACTGGGAGGCCAAGGAGGACGG - Intergenic
1163202614 19:15779669-15779691 CTCTGGGATCTCAGGGTGGATGG - Intergenic
1163232860 19:16015865-16015887 CAGTTGGGGCTCAGTCAGGAGGG + Intergenic
1163248357 19:16111277-16111299 CAGTGGGGGCCTAGGGAGGAAGG - Intergenic
1163462303 19:17446486-17446508 TGGTGGGAGCTGAGTGAGGATGG - Intronic
1163575025 19:18105859-18105881 CAGTGGGGGCGTGGGGAGGACGG - Intronic
1164757696 19:30702643-30702665 CAGGGGAAGCTCAGTGGGGAGGG - Intronic
1165102593 19:33447645-33447667 CAGAGGGAGCTGCGAGAGGACGG + Intronic
1165878465 19:39026177-39026199 ATGTGGTTGCTCAGGGAGGAGGG - Intronic
1166211284 19:41308212-41308234 GAGTGGGAGCTCTGTGAGAACGG - Intronic
1166831316 19:45641450-45641472 CAGTGGAAGGTCTGGGAGGGCGG - Intronic
1166894750 19:46016403-46016425 CAGGGGCAGGTGAGGGAGGAAGG - Intronic
1167314621 19:48756414-48756436 CACCTGGAGATCAGGGAGGATGG + Exonic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
1167668946 19:50838837-50838859 CTGGGGGATCTGAGGGAGGAGGG + Intergenic
1168153607 19:54461589-54461611 CACTGGGGGCAGAGGGAGGAGGG - Exonic
1168284287 19:55322688-55322710 CTGGGTGAGCTCAGGGAAGAAGG + Exonic
925021601 2:574002-574024 CGGTGGGTTTTCAGGGAGGAGGG - Intergenic
925185370 2:1843083-1843105 CAGGGAGAGCCCAGCGAGGATGG - Intronic
925318565 2:2943464-2943486 CTTTGGGAGGTCAAGGAGGACGG + Intergenic
925838212 2:7966086-7966108 CAGTGTGAGCTCAAGGAGGTTGG - Intergenic
925983860 2:9199118-9199140 CAGTGGGAGCTCTGGGAGCAAGG - Intergenic
926217873 2:10916135-10916157 CGGGGGAAGCTCAGGGAGGGCGG + Intergenic
926226679 2:10971784-10971806 ATGGGGGAGCTCAGGGAAGAGGG + Intergenic
926783363 2:16496214-16496236 TAGTTGCAGCTCAGGGAGCAAGG - Intergenic
927899927 2:26811939-26811961 AAGTGGGAGCCCAGGGAGCCTGG + Intergenic
928167527 2:28981782-28981804 CACTGGGAGCCAAGGAAGGAGGG + Intronic
928267859 2:29827170-29827192 CAGAGGCAGCTCTGGGAGCATGG + Intronic
928328845 2:30341812-30341834 CACTGGGAGAGCAGGTAGGAGGG + Intergenic
928436746 2:31259443-31259465 CAGTAGGAGCTGAAGTAGGAGGG - Intronic
928889660 2:36189031-36189053 GACTGGGAGCTAAGGGAAGAGGG - Intergenic
929517592 2:42618189-42618211 CGGTGGGAGGCCAGGGTGGAAGG - Intronic
929611076 2:43271017-43271039 CAGACGGGGCTCTGGGAGGAAGG + Intronic
929618064 2:43327893-43327915 CAGTGGGATCTCTGGGAGAAGGG - Intronic
930171407 2:48255368-48255390 CAGTGGGGGCTAAGGTAGGTTGG + Intergenic
931251431 2:60534197-60534219 CACTGGGAGCCCAGGGAGCCTGG + Intronic
931476206 2:62590237-62590259 CAGAGGGAGCTGAGGGGTGAAGG + Intergenic
932233366 2:70101191-70101213 CTTTGGGAGGTCATGGAGGAAGG + Intergenic
932749715 2:74363552-74363574 GAGTTGGAGCTAAGGGAGCAGGG - Intronic
932968874 2:76514091-76514113 CAGTAGGAGTTGTGGGAGGAAGG - Intergenic
934560893 2:95312792-95312814 TGGTGGGAGCTGAGGGACGAGGG + Intronic
934590585 2:95546660-95546682 CAGGGACAGCCCAGGGAGGACGG - Intergenic
935099021 2:99974796-99974818 CAGTGGGTGCACTGGGAGAAGGG - Intronic
935987513 2:108689034-108689056 AAGAGGGAGCTCCGGGAGGTCGG + Intergenic
936126339 2:109791731-109791753 AAGAGGGAGCTCCGGGAGGTCGG + Intergenic
936218354 2:110579737-110579759 AAGAGGGAGCTCCGGGAGGTCGG - Intergenic
936437790 2:112522942-112522964 CACTGGCTGCTCTGGGAGGATGG - Intronic
936529335 2:113264725-113264747 CAGTGGGAAGTCAGACAGGATGG + Intronic
937321023 2:120960840-120960862 CACTGGGAGACCAGGGAGGGTGG - Intronic
937543680 2:122989300-122989322 CAGGGGGAGCTGAGGCAGCAGGG - Intergenic
937879532 2:126855043-126855065 CACTGGTGGCTCAGGGAGGGAGG - Intergenic
937911319 2:127077009-127077031 CAGTGTGAGATCAGCTAGGAGGG - Intronic
937956895 2:127426711-127426733 CAGTGGGACCACAGCCAGGACGG + Intronic
938093314 2:128447188-128447210 CAGTGGGAGCCCAGTGTGGCTGG + Intergenic
938263662 2:129911761-129911783 GAGTGGGAGCTCCGGCAGGGAGG - Intergenic
938318771 2:130348071-130348093 CACTGGGTACCCAGGGAGGAGGG + Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938894184 2:135734469-135734491 CTTTGGGAGGTCAGGGAGGGGGG - Intergenic
939294607 2:140244080-140244102 CAGAGGCAGGTCAGTGAGGAAGG - Intronic
941017502 2:160373873-160373895 CAAGGGAAGATCAGGGAGGAGGG + Intronic
942135991 2:172925971-172925993 CAGAGGGAGGGAAGGGAGGAAGG + Intronic
943626437 2:190206413-190206435 CAGTGGGATCTCAAGGAGACAGG - Intronic
944832132 2:203543400-203543422 CAGTAGGAGTTAAGGGAAGAGGG + Intergenic
945745698 2:213718361-213718383 AAGTGGGAGCCCAGGCAGGGGGG - Intronic
946152733 2:217787344-217787366 CGGTGGGAGCGCAGGGAGGACGG + Intergenic
946412550 2:219522466-219522488 CAGTGGGGGCTCACGGGGGAAGG + Intronic
947083118 2:226420819-226420841 GAGTGGGAGCTCAGGGCACAGGG + Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947716063 2:232339378-232339400 AAGTGGGAGGCCAGGCAGGAGGG + Intronic
947735087 2:232450119-232450141 AAGTGGGAGGCCAGGCAGGAGGG + Intergenic
947871481 2:233441215-233441237 CAGGGGGAGCCCAGGAAGGAAGG + Intronic
948823828 2:240564760-240564782 CAGTGAGAGGTCTGGGAGGTGGG - Intronic
949006674 2:241653383-241653405 CAGGTGGAGCTGATGGAGGAGGG + Intronic
949049173 2:241888157-241888179 GAGTGGGACCTCATGGAGAAAGG - Intergenic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1169619034 20:7483884-7483906 CATTGGCACCTCAGTGAGGAAGG - Intergenic
1170286708 20:14717856-14717878 TAGTTGGAGCTAGGGGAGGAAGG + Intronic
1170418342 20:16168417-16168439 CAGTGGGAGGCCAAGGAGGGAGG - Intergenic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171031729 20:21682654-21682676 GGGTGGGGGCTGAGGGAGGAGGG - Intergenic
1171958652 20:31477790-31477812 GAGCTGGATCTCAGGGAGGACGG - Intronic
1172134779 20:32679643-32679665 CAGTGGGAGCTAAGGGGAGGAGG - Intergenic
1172488188 20:35312543-35312565 CTGTGAGAGTGCAGGGAGGATGG + Intronic
1172667353 20:36609680-36609702 ACGTGGGAGCTCACGAAGGAAGG + Exonic
1173078831 20:39846672-39846694 CATTGGGAGCAGAGGGAGAAAGG - Intergenic
1173190980 20:40875421-40875443 CGGGGGAAGCTCAGGGAGGGAGG - Intergenic
1173502157 20:43561867-43561889 CAATGGGGGCTCAGGCAGGGCGG + Intronic
1173716514 20:45211573-45211595 GAGTGGGAGGGAAGGGAGGAGGG + Intergenic
1173978605 20:47206039-47206061 CAGTGAGAGGCCAGGTAGGAGGG - Intergenic
1174318061 20:49718184-49718206 CAGAGTGAGGGCAGGGAGGAAGG - Intergenic
1174359606 20:50019763-50019785 CAGTAGTTGCTCAGGGAAGAAGG + Intergenic
1175191295 20:57213730-57213752 CAGTGGGTGCTCAGGGATGTAGG + Intronic
1175440046 20:58983925-58983947 CAGTGGGCTCTCATGGATGAGGG + Intronic
1175909016 20:62395766-62395788 CAGGGGGAGCTCCAGAAGGAAGG + Intronic
1176078451 20:63259828-63259850 CAGTGGGAGCTCTGGGCGGGTGG + Intronic
1176100526 20:63362371-63362393 CAGTGGCTGCTCAGGGAAGCTGG - Intronic
1177894854 21:26845849-26845871 AAGAGGGAACTGAGGGAGGAGGG - Intergenic
1177991997 21:28047953-28047975 CATTGTGAGCTCAAGGAAGAAGG - Intergenic
1178246902 21:30961617-30961639 CATTGGGAGATGAGGGAAGAAGG - Intergenic
1178584408 21:33860382-33860404 CAGTGGGGGCTGGGGGAGGCGGG + Intronic
1178921060 21:36738587-36738609 AAGTGGCAGCTGTGGGAGGAGGG - Intronic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179443780 21:41417177-41417199 CATTGGGAACTCAGGGGGAAGGG + Intergenic
1179617950 21:42593810-42593832 CAGAAGGAGCCCTGGGAGGAGGG - Intergenic
1179977337 21:44875856-44875878 GAGAAGGAGCTGAGGGAGGAGGG - Intergenic
1180051297 21:45332100-45332122 CAGTGGGAGGGCAGGGGGAAGGG + Intergenic
1180931094 22:19592354-19592376 CTGTGGAAGCTGAGGCAGGAGGG - Intergenic
1181165250 22:20979735-20979757 CAGCGGGAGCTCAGTCGGGAAGG + Intronic
1181262536 22:21608823-21608845 CTGTGGGAGGCCAGGGAGGGAGG - Intronic
1181484736 22:23223601-23223623 CAGGGGGTACTCAGGGAGGAGGG + Intronic
1182008253 22:26979364-26979386 CAGTGGGAGCTGTGGAAGGCAGG - Intergenic
1182092287 22:27604038-27604060 CAGTGCCAGCCCAGGGAGGGGGG - Intergenic
1183058607 22:35321845-35321867 CAGGTGGGGCACAGGGAGGATGG + Intronic
1183315781 22:37136184-37136206 GAGAGGGGGCTCAGGCAGGAGGG - Intronic
1183642698 22:39101728-39101750 CTGTGGGAGGCCAGGAAGGAAGG + Intronic
1183738252 22:39655715-39655737 AAGTGGGAGCCCAAGGAGGAGGG - Intronic
1183748046 22:39703699-39703721 CAGTGGGCACTCAGGAAGGCTGG - Intergenic
1184195664 22:42925994-42926016 CAGTGGGCGCTCAGGAAGTAAGG + Intronic
1184327182 22:43797816-43797838 CAGAGGGAGCCGGGGGAGGATGG - Intronic
1184342518 22:43893733-43893755 CAGTGTGAGTTCAGGAAGGGAGG + Intergenic
1184818138 22:46887910-46887932 CAGTGGAAGCTTAAGGAGGATGG + Intronic
1184856573 22:47149677-47149699 CAGTGGCGAGTCAGGGAGGAAGG + Intronic
1185179391 22:49350339-49350361 GTGTGAGAGCCCAGGGAGGAGGG + Intergenic
1185416742 22:50714788-50714810 GGGTGGGAGCTCAAGGAGGGAGG + Intergenic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
950498534 3:13349195-13349217 GGGTGGGAGGTCAGGGAGGATGG - Intronic
950528158 3:13536619-13536641 CAGTGGAAGGACAGGAAGGAGGG - Intergenic
950837713 3:15936396-15936418 AACTGGGAGCTCAGGCTGGATGG + Intergenic
951135962 3:19104510-19104532 AAGTGGGTGCTCAGGAATGAAGG - Intergenic
951688899 3:25374728-25374750 CAGAGGGAGCCAATGGAGGATGG - Intronic
953756261 3:45648259-45648281 CAGTGGTTGCTTAGGGATGAGGG - Intronic
953961017 3:47265696-47265718 CAGTTGCTGCCCAGGGAGGAGGG - Intronic
954411656 3:50373824-50373846 AAGTGGGAACTGAGTGAGGATGG + Intronic
954569164 3:51626131-51626153 CATTTGGATCTCAGGCAGGAAGG - Intronic
954692843 3:52404920-52404942 CAGCAGGAGCTTAGGGAGGCAGG - Intronic
954776774 3:53026591-53026613 CTGTGGGGGCACAGGGAGGGAGG - Intronic
955404649 3:58618483-58618505 GAGTGGGAGCCCAGAGAGGGAGG + Intronic
955488250 3:59456691-59456713 CAGTAGGAGCTCAGCGATCATGG - Intergenic
955753414 3:62204728-62204750 CAATGGGAGCTCTGGGAGAGAGG - Intronic
956111980 3:65878976-65878998 CAGCAGGAGCTCAGGCAGCAGGG - Intronic
959334689 3:105049261-105049283 AAAAGGGAGCTCAGGGATGAAGG - Intergenic
960052662 3:113252828-113252850 CTGTGAGTGCTCAGGGAGGGAGG + Intronic
960293169 3:115911585-115911607 CTCTGGGAGGTCAAGGAGGATGG - Intronic
961371401 3:126434040-126434062 CAGTGGGAGCTCTGAGAACATGG - Intronic
961427037 3:126856507-126856529 CAGTGGGAGCACAGCTAAGATGG - Intronic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
961820368 3:129572740-129572762 CAGGGGCAGCTGTGGGAGGAAGG + Exonic
962270757 3:133976407-133976429 GAAGGGGATCTCAGGGAGGAGGG + Intronic
962975108 3:140439285-140439307 CAGTGAGAGGCCAGGGAGGAGGG + Intronic
963068474 3:141282404-141282426 CTGTGGGAGACCAGGGTGGAAGG - Intronic
963325858 3:143862370-143862392 CAGTGAGAGCTCAGAGAGAGAGG - Intergenic
963433028 3:145233906-145233928 CTGTGGGAGTTCAGTCAGGATGG + Intergenic
964142721 3:153421947-153421969 CAGTGGGAGCTCCAGTAGGGTGG + Intergenic
964853972 3:161125551-161125573 CTTTGGGAGGTCAGGGAGGGAGG + Intronic
966402543 3:179562687-179562709 CAGTGGGAGAAGAAGGAGGAAGG - Intergenic
966942637 3:184756608-184756630 CAGGGGCAGCACAGGGAGAACGG - Intergenic
967529603 3:190533491-190533513 CAGGGGAAGCACAGGGGGGAGGG - Intronic
967972999 3:195012875-195012897 CAGTGGGAGAGGATGGAGGAGGG + Intergenic
968486129 4:863424-863446 CAGTGGCAGGTTTGGGAGGACGG + Intronic
968556190 4:1247652-1247674 CGCTAGGAGCTCAGCGAGGACGG + Intronic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968624191 4:1619142-1619164 GTGCTGGAGCTCAGGGAGGATGG - Intronic
968905791 4:3449956-3449978 CTGTGGGGGCTGAGGGAGGGAGG + Intergenic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
968967290 4:3775580-3775602 CTGTGGGAGGTCAGGGGGGTGGG - Intergenic
968977751 4:3830751-3830773 CATGGGGAGCTCTGGGTGGAGGG + Intergenic
969044585 4:4327685-4327707 CCCTGGGAGTTCAGGGAAGAGGG - Intergenic
969065926 4:4480996-4481018 CAAAGGGAGCTCTGGGAGCATGG + Intronic
969092204 4:4703100-4703122 CAGTGGGAGCTCACGTGGGAAGG - Intergenic
969178887 4:5422219-5422241 CAGTGGGAGTTTAGTGGGGAAGG + Intronic
969252723 4:5980235-5980257 CAGTGCCAGCTCAGGGACCAGGG - Exonic
969471303 4:7390957-7390979 CAGTGACCACTCAGGGAGGAGGG + Intronic
969616501 4:8255957-8255979 CAGGGGGAGGACAGGGAGGCAGG - Intergenic
969914398 4:10475576-10475598 CTTTGGGAGGCCAGGGAGGACGG + Intergenic
970182526 4:13415275-13415297 AAGTGGGAGCTCAGGCAGAGAGG - Intronic
970334059 4:15014836-15014858 TAGTGGAAGCACAGGGAAGATGG + Intronic
971452409 4:26812288-26812310 CAGAGGAAGCTGAGGAAGGAAGG - Intergenic
972447636 4:39161041-39161063 CTGTGGGAGCTGAGGCTGGAAGG - Intergenic
973339531 4:48989665-48989687 CTGTGGGAGGCCAGGGAGAATGG - Intronic
974188683 4:58474803-58474825 AAGTGGGGGCTGAGGGATGAGGG + Intergenic
975131820 4:70839313-70839335 CAATAGGAGCACAGGGTGGACGG + Intronic
975669244 4:76763618-76763640 CAGTGGGAGATGAGGCTGGAAGG + Intronic
976303439 4:83536427-83536449 GAGGAGGAGCCCAGGGAGGAAGG + Intronic
976517609 4:85986931-85986953 CAGTGGGAGCTCAGGGAGGAAGG + Intronic
979304942 4:119131700-119131722 CAGTGCTAACTCTGGGAGGAAGG - Intergenic
979560030 4:122091056-122091078 CTTTGGGAACTCAGGGTGGAAGG - Intergenic
979690577 4:123554486-123554508 CAGTTGGAGGTCAGGGAGGCAGG + Intergenic
980379466 4:131993036-131993058 CAATTGGAGCTAAGAGAGGAGGG + Intergenic
980790492 4:137613615-137613637 TCGTGGGAGCTCTGGGAGCAAGG + Intergenic
981195904 4:141920110-141920132 CAGTGGGACCACAGGGAGTGGGG - Intergenic
981233210 4:142383767-142383789 CAGTGGTTGCACAGGCAGGAGGG + Intronic
981568944 4:146131521-146131543 CAGTGAGAGCACTGGGAGGTAGG - Intergenic
982371516 4:154638718-154638740 CAGTGGGAGGCCATGAAGGAAGG - Intronic
983054311 4:163083765-163083787 CAGTGGCAGAGCTGGGAGGAGGG + Intergenic
983509085 4:168588193-168588215 CACTGTGAGCCCTGGGAGGATGG + Intronic
983678791 4:170328340-170328362 CAGAAGGACCTCATGGAGGAAGG + Intergenic
983746407 4:171205527-171205549 CACTGGGGCCTCATGGAGGATGG + Intergenic
984947117 4:184978336-184978358 CACTGGGACCTCGGGGAGGGCGG - Intergenic
985548313 5:520871-520893 CAGAGGAAGCCCAGGAAGGAAGG + Intronic
985626485 5:991588-991610 CATGGTGAGCTCAGGGAGGTGGG + Intergenic
985711504 5:1432185-1432207 CAGCGGCAGCTCAGGGTGGGAGG - Intronic
985968949 5:3360347-3360369 CAGTGGGTATTTAGGGAGGAAGG - Intergenic
986174053 5:5336963-5336985 CATGGGCAGCACAGGGAGGAGGG + Intergenic
986175391 5:5348068-5348090 CTCTAGGAGCTCAGGGAGGTAGG + Intergenic
986310996 5:6551087-6551109 CAGTAGGAGCTTAGAGGGGAGGG - Intergenic
986325548 5:6670596-6670618 CAGTGGGTGCTGAGGACGGATGG + Intergenic
986482332 5:8202174-8202196 CAGGGGGAGCTCCGGGAAGGGGG + Intergenic
986503913 5:8429896-8429918 GAGTGGGGGCTGAGGGAGGCTGG - Intergenic
986703607 5:10435959-10435981 CTTTGGGAGCCCAAGGAGGACGG - Exonic
989113942 5:37933515-37933537 CAGTGGGAGATCAGGCTGGATGG + Intergenic
989170552 5:38467708-38467730 CTGTCGGAGCTCAGAGAGGCTGG - Intergenic
989369579 5:40692092-40692114 CAGTGAGAGGTCTGGCAGGAGGG - Exonic
991447744 5:66717971-66717993 CAGTGAGAACTCAGGGATGGAGG - Intronic
991975242 5:72178505-72178527 CAGTGGGAGCTGACAGAGCAGGG + Intronic
992078515 5:73213775-73213797 CAGTGGGAGGTCTGCGAGGGTGG + Intergenic
992167948 5:74073492-74073514 GAGTTGGAGCTGAGGGAGAAGGG + Intergenic
992679982 5:79143928-79143950 GAGTGGGATTTCAGGGTGGAAGG - Intronic
993130830 5:83896244-83896266 CAGAGGGAGCAGAGGGAGCAGGG + Intergenic
993211905 5:84962223-84962245 CAGAGGGAGTTCAGGCAGCAGGG + Intergenic
993258653 5:85628223-85628245 CAGTAGGGGCTCTGGGAGGCAGG + Intergenic
993898975 5:93571620-93571642 TTATGTGAGCTCAGGGAGGAAGG + Intergenic
994987206 5:106951823-106951845 CAGTTGGAGTTTAGGGAAGAAGG - Intergenic
996425773 5:123312570-123312592 GAGACGGAGCTCACGGAGGAAGG - Intergenic
997398374 5:133582385-133582407 CAGTGAGAGCTGAGAGAGGAGGG + Intronic
997445278 5:133935727-133935749 CAGTGGGGGTTTGGGGAGGAGGG - Intergenic
997932479 5:138083895-138083917 CAGTGGGGGATCTGGGAGGAGGG - Intronic
997949972 5:138234648-138234670 CTGTGGGAGGTCAGTGAGGATGG + Intergenic
998006783 5:138662316-138662338 CAGGGGGAGATTATGGAGGAAGG + Intronic
998352019 5:141508118-141508140 CAGAGGGAGGTCAGGGAGCTGGG + Intronic
998881738 5:146652261-146652283 TAGTGAGAGCACAGGGAGCATGG - Intronic
999202194 5:149824482-149824504 TTCTGGGAGCCCAGGGAGGAAGG + Intronic
999274303 5:150318822-150318844 CAGTGGGACTGCAGGGAGAAGGG + Intronic
999692244 5:154158114-154158136 CAGAGGGAGGGCAGGCAGGAAGG - Intronic
1001080600 5:168664695-168664717 CAGTGGAAGCTCCTGGGGGAAGG + Intronic
1001096926 5:168782574-168782596 CACTGGAAGCTCAGGGTGAATGG - Intronic
1001559981 5:172662787-172662809 CTGTGGGTGGTTAGGGAGGAGGG - Intronic
1001650299 5:173311176-173311198 CAGAGGGAGCCCTGGCAGGAAGG + Intergenic
1001757377 5:174180930-174180952 CAGCTGGAACTCAGGAAGGAGGG - Intronic
1002172625 5:177383971-177383993 CAGGGGGAGCTCAGAGGAGAGGG - Intronic
1002186918 5:177458857-177458879 CCTTGGCAGCTCCGGGAGGAAGG + Intronic
1002335110 5:178472046-178472068 CTGTGGGAGCTCAAGGAGGGAGG + Intronic
1002427552 5:179185184-179185206 CAGTGGGAGGACATGGAGGAAGG + Intronic
1002435095 5:179226518-179226540 CTGTGGGAGGCCAGGGTGGATGG - Intronic
1003311865 6:4975649-4975671 CAGGGGGAGTCCAGGGAGGAAGG - Intergenic
1003335499 6:5168129-5168151 CAGTGGGAGAAGAGAGAGGAAGG + Intronic
1003555621 6:7137257-7137279 CCCTGGGGGCTCAGGGGGGAAGG - Intronic
1004615341 6:17282642-17282664 AAATGGGAGATCAAGGAGGAGGG + Intronic
1005989222 6:30892920-30892942 CAGTGGGGGCTGGGGGAGCAGGG - Intronic
1006151476 6:31992383-31992405 CAGCTGGAGCTCAGCGTGGACGG + Exonic
1006157777 6:32025121-32025143 CAGCTGGAGCTCAGCGTGGACGG + Exonic
1006242379 6:32695576-32695598 TAGTGGGGGATCAGGGAGGGAGG + Intergenic
1006626955 6:35404465-35404487 CAGATGGAGCCCATGGAGGATGG + Intronic
1007013932 6:38443838-38443860 TAGAGGGAGCTCAGAGTGGATGG - Intronic
1007425631 6:41744299-41744321 CAGAGGGAGCTCAGGACTGAGGG - Intronic
1007663604 6:43501437-43501459 CAGAGTGGGCTCAGGAAGGAAGG - Intronic
1007838873 6:44699248-44699270 CAGAGGGTGCTCAGGCAGGTGGG + Intergenic
1007983625 6:46185305-46185327 CAGGCAGAGCTGAGGGAGGAAGG - Intergenic
1008298554 6:49806249-49806271 GAGATGGAGCTCTGGGAGGAAGG + Intergenic
1008617686 6:53242049-53242071 CTAAGGGAGCTCAGGGAGCAGGG + Intergenic
1011499165 6:87968934-87968956 GAGAGGGAGATCGGGGAGGAGGG - Intergenic
1011713051 6:90074407-90074429 CGCTGGGAACTCAGGGACGATGG + Intronic
1012288956 6:97427014-97427036 CAGAGGGAGCTTAGAGAGGAGGG + Intergenic
1013428516 6:110035758-110035780 CTGTGGGAGGTCAAGGTGGAAGG + Intergenic
1013731684 6:113175653-113175675 CAATGTGAGGTCAGAGAGGATGG + Intergenic
1014513168 6:122349649-122349671 CAGTGGCAGCTCAGGGGGTGTGG + Intergenic
1015513342 6:134060890-134060912 CAGTGGGAGGGAAGGCAGGATGG + Intergenic
1015552416 6:134426017-134426039 ATGTGGGAGCTAAGGTAGGAAGG - Intergenic
1015739767 6:136441670-136441692 CATTGGGTGCTCAGGGAGAGGGG - Intronic
1015975468 6:138786075-138786097 AAGTTGGAGCTCAGGGTGGCAGG + Intronic
1016216965 6:141616477-141616499 CAGTGGTAGCTCAGAAAGGAGGG - Intergenic
1016967033 6:149728723-149728745 CGGTTGGAGCTCAGGCAGCAGGG - Intronic
1017441506 6:154468321-154468343 CTGTGGGAGATCAAGGAGGGTGG - Intronic
1017795470 6:157840268-157840290 CTGAGGGAGCTCAGGGAAGAGGG + Intronic
1017950848 6:159133402-159133424 CATGGGGAGCTCTGTGAGGATGG + Intergenic
1018722064 6:166580684-166580706 CAGTGGGTCCCCAGTGAGGACGG + Intronic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019182841 6:170202630-170202652 CACTGTAAGCTCAGGGAGGGCGG - Intergenic
1019335474 7:480641-480663 CAGGGGCAGCTCAGGCAGGCAGG + Intergenic
1019397041 7:826539-826561 CAGATGGCGCTCTGGGAGGAGGG + Intronic
1019406626 7:887452-887474 CAGTGGGGGCTCCGGGAAGCTGG + Exonic
1019502618 7:1372230-1372252 TGGTGGGAGGGCAGGGAGGAAGG + Intergenic
1019759616 7:2800820-2800842 CAGTGGGGGAGCCGGGAGGAAGG - Intronic
1021829596 7:24591103-24591125 CAGTGGGACCTCAGGAGGGAGGG + Intronic
1022423510 7:30246225-30246247 CAGAGGGGGCTGAGGGAGCAGGG + Intergenic
1022909327 7:34884878-34884900 CAGTGAGGGCACAGGCAGGAAGG - Intergenic
1023465201 7:40447105-40447127 CAGTGGAAGCTGGGGGAAGATGG - Intronic
1023953192 7:44864267-44864289 CAGTCCCATCTCAGGGAGGATGG + Intergenic
1023990301 7:45124646-45124668 CAGGGGAAGCTCAGGGAGAAAGG + Intergenic
1024085063 7:45885681-45885703 AAGTGAGACCTCAGGGAGGATGG + Intergenic
1024242785 7:47448236-47448258 GAGGGGGAGCACAGGGAGGAGGG + Intronic
1026688497 7:72532983-72533005 CAGTGGAAGGCCAAGGAGGAAGG - Intergenic
1026723731 7:72854874-72854896 CAGTGGAAGGCCAAGGAGGAAGG - Intergenic
1027238777 7:76314046-76314068 GGGTGGGAGCTCAGGGAAGACGG - Intergenic
1028450015 7:90971318-90971340 CAGTGGCAGCTCAGAGGTGAAGG + Intronic
1029045851 7:97627486-97627508 CAGTGGCAGAGCAGGGAGAAAGG + Intergenic
1029514258 7:101016095-101016117 CAGTGGGAGCCCAGTAAGCAGGG + Intronic
1031500279 7:122506081-122506103 AAGTGGGAGCACAGGGAGCAGGG - Intronic
1032158647 7:129492363-129492385 CAGAGGGAGTTGAGGGAGAAGGG - Intergenic
1032173024 7:129601499-129601521 CATTGGGAGGTCAAGGAGGGTGG - Intergenic
1033029188 7:137808555-137808577 CAGTGGGGGCTAGGGGAGGCAGG - Intronic
1033180774 7:139175754-139175776 GAGTGGGAGGGCAGTGAGGATGG + Intronic
1033453520 7:141482301-141482323 AGGTGGGTGTTCAGGGAGGAAGG - Intergenic
1034301738 7:150021677-150021699 AAGTGGGAGCTCAGCTATGAGGG - Intergenic
1034479621 7:151309256-151309278 CAGCGGGTGCTCAGGGTGAAAGG + Intergenic
1034804308 7:154075590-154075612 AAGTGGGAGCTCAGCTATGAGGG + Intronic
1035385620 7:158470702-158470724 CAGTGGGAGGTGAGGCAAGAGGG + Intronic
1035399512 7:158555610-158555632 CCATGGGAGCTGAGGGAGGCTGG - Intronic
1035472271 7:159118050-159118072 CACGGGGAGCTCAGAGAGGCCGG + Intronic
1036207539 8:6816008-6816030 CAGTGGGCACTCAGGATGGAGGG - Intronic
1036660093 8:10702297-10702319 CAGTGGGGGCTGAGGGAGGAGGG - Intronic
1037123360 8:15316653-15316675 TCGTGGGAGCTCTGGGAGCAAGG - Intergenic
1037404128 8:18523359-18523381 CTTTGGGAGCTCAAGGTGGAAGG + Intergenic
1037821593 8:22137726-22137748 CAGTGGGAGCACAGGCAGGAGGG - Intergenic
1038027236 8:23602615-23602637 CTTTGGGAGGTCGGGGAGGATGG - Intergenic
1038397727 8:27259328-27259350 AAGTGGGAGCTAAGCTAGGAGGG - Intergenic
1038770415 8:30473870-30473892 AAGTGGGAGCTGAAGGATGAGGG + Intronic
1039130727 8:34261468-34261490 CTTTGGGAGCTTGGGGAGGAAGG - Intergenic
1039435675 8:37557652-37557674 CTGCGGGAGATCAGGGAGAAGGG - Intergenic
1039453402 8:37693450-37693472 CACTGGGAGCTCAGGGAGTGAGG + Intergenic
1039772678 8:40703577-40703599 CAGTGGGGGAGCAGGGAGGAGGG + Intronic
1040554988 8:48470187-48470209 CAGCGGGAGGCCAGGGAGCAAGG + Intergenic
1040809550 8:51436491-51436513 CAGTGGGATCACATGGAAGAAGG - Intronic
1040850259 8:51893904-51893926 CAGTGGGTGCTCAGGAAGTATGG - Intronic
1041467470 8:58171327-58171349 CAGTGGGTGTCCAGGGATGAAGG - Intronic
1041479259 8:58299731-58299753 CACTGGCAGCTCAGGGTGCAAGG + Intergenic
1042380449 8:68107312-68107334 CAGAAGGAGCTTAGGGAGCAAGG + Intronic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1047715533 8:127591636-127591658 CTGGAGGACCTCAGGGAGGAGGG + Intergenic
1048260785 8:132943522-132943544 CAGGTGGAGAGCAGGGAGGAGGG - Intronic
1048578333 8:135710239-135710261 CACAGGGAGGTCAGGGAGCACGG - Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049161593 8:141101684-141101706 CAGTGGGAGGGCAGTGGGGAAGG - Intergenic
1049255681 8:141612418-141612440 CAGGAGGAGCTCAGAGGGGAGGG - Intergenic
1049702804 8:144022770-144022792 AAGTGGGTCCTCAGGGAAGAGGG - Intronic
1050312923 9:4371588-4371610 CAGTGAGAGATCAGCAAGGAGGG - Intergenic
1051154231 9:14123003-14123025 CTGTGGGAGGTCAGGGTGGGTGG + Intronic
1051612858 9:18978453-18978475 GAGTTTGAGCTCAGGCAGGAAGG - Intronic
1052751935 9:32500843-32500865 CTGTTGGAGCTCCAGGAGGAAGG - Exonic
1052792829 9:32892207-32892229 CAGCGGTAGCCCAGGAAGGAGGG - Intergenic
1053152845 9:35753941-35753963 CAGAGAGGGCACAGGGAGGATGG - Exonic
1053235705 9:36451971-36451993 CTTTGGGAGGCCAGGGAGGATGG + Intronic
1053623042 9:39840439-39840461 CATTGGAGGCTCAGAGAGGAAGG - Intergenic
1053881829 9:42602789-42602811 CATTGGAGGCTCAGAGAGGAAGG + Intergenic
1053890844 9:42691502-42691524 CATTGGAGGCTCAGAGAGGAAGG - Intergenic
1054220853 9:62410252-62410274 CATTGGAGGCTCAGAGAGGAAGG + Intergenic
1054229861 9:62498920-62498942 CATTGGAGGCTCAGAGAGGAAGG - Intergenic
1055442934 9:76354272-76354294 CAATGGGAGCAGAGGGAGGGGGG + Intronic
1056285846 9:85087585-85087607 AATTGGGAGCCCAGGGTGGAAGG + Intergenic
1056433533 9:86552628-86552650 CAGTGGGAGCTGGGTAAGGATGG + Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057676083 9:97137284-97137306 CAGTGGGAGCTGGGGGTGGAGGG - Intergenic
1058005325 9:99907368-99907390 AAGTGGGAGCTCTGGGCCGATGG + Intronic
1059399829 9:114061955-114061977 CAGTGGGAGCAAAGGCAGGGTGG - Intronic
1059551638 9:115234909-115234931 CTTTGGGAGCTCAAGGTGGAAGG - Intronic
1059559306 9:115316938-115316960 CAGTGAGAGCTAAGGGTGGCTGG - Intronic
1059692092 9:116695376-116695398 AAGTGGGATATCAGGGAGGAAGG + Intronic
1059778538 9:117501659-117501681 CATTGGGACCTGAGGGTGGAGGG - Intergenic
1059807646 9:117820984-117821006 CACTGGAAGCTGAGGGAGCAAGG + Intergenic
1060119041 9:120970926-120970948 CATTGGGAGGTCAAGGTGGACGG + Intronic
1060193307 9:121606721-121606743 CAGTGGGGGGTGAGGGAGGTGGG + Intronic
1060268410 9:122125592-122125614 CAGTGGGGCCCCAGGCAGGACGG + Intergenic
1060593652 9:124835023-124835045 CGGAGGGAGCTCAGGAGGGAAGG - Intergenic
1061279030 9:129586566-129586588 TAGTAGGTGCTCAGGAAGGAAGG + Intergenic
1061609179 9:131735018-131735040 CGCTGGGAGCACAGAGAGGAAGG + Intronic
1061903308 9:133683991-133684013 CAGATGGAGCTCAGAGAGGCTGG - Intronic
1062000780 9:134214671-134214693 CAGTGGGAGCTCAGGTGGGGGGG + Intergenic
1062006181 9:134239622-134239644 CAGTGGGAACACAGGCGGGATGG - Intergenic
1062053598 9:134459422-134459444 CAGGGTGAGGTCAGGGAGAATGG + Intergenic
1062154307 9:135037945-135037967 CACTGAGAGCTCCAGGAGGAAGG - Intergenic
1062527003 9:136981971-136981993 CAGTGGCAGCTGAGGGGGTATGG - Intronic
1062554609 9:137108265-137108287 CAGCGCAAGCTCAGGGTGGAGGG - Intronic
1062572322 9:137191377-137191399 CAGTGCCAGCTCTGGGAGGCTGG + Intergenic
1185461577 X:335130-335152 CAGTGGGAGCTCAGGTCCGTGGG - Intronic
1185528693 X:799861-799883 CTTTGGGAGGTCAGGGTGGATGG - Intergenic
1185834360 X:3331147-3331169 CTTTGGGAGCCCAGGCAGGAGGG - Intronic
1186336513 X:8595483-8595505 AAGTGGGAGCTAAAGGAAGATGG + Intronic
1186864005 X:13701204-13701226 CAGTGGCAGGTAAAGGAGGAGGG - Intronic
1186873852 X:13797982-13798004 GAGTGGGAGCATAGGAAGGATGG + Intronic
1187023247 X:15406598-15406620 CAGTGGGCACTCAGGAAGTAAGG + Intronic
1187048072 X:15667824-15667846 CTCTGGGAGCTGAGGCAGGAGGG - Intergenic
1188153216 X:26705505-26705527 CTTTGGGAGCTCGAGGAGGAAGG + Intergenic
1188440988 X:30215315-30215337 CAGTGGGGGCTGAGGGAGGTGGG + Intergenic
1189278357 X:39803691-39803713 GAGTGGGAGCCCAGGTATGAAGG + Intergenic
1189309323 X:40008912-40008934 CAGCGGGAGCCGCGGGAGGAAGG - Intergenic
1190739381 X:53279468-53279490 CAGCAGGGGCTCAGGGAGGTGGG + Intronic
1191858206 X:65644593-65644615 CAGTGGCAGCTCAGGGCAGGGGG + Intronic
1191972260 X:66829596-66829618 CAGTTTTAGCCCAGGGAGGATGG - Intergenic
1192972332 X:76246157-76246179 TCGTTGGAGCTCAGGGAAGAAGG + Intergenic
1195036554 X:100975379-100975401 GAGTGGGAGCTGAGGAAGGAGGG - Intronic
1195399793 X:104448965-104448987 CGGTGGAAGCTCAGAGAGTAAGG + Intergenic
1195599253 X:106727097-106727119 GTGTGGGAGCTGAGCGAGGAGGG + Exonic
1195903206 X:109819529-109819551 CTGAGGGAGCACAGGGAAGATGG + Intergenic
1197087057 X:122491118-122491140 CATTGGGAACTCAGGGAGAAGGG - Intergenic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1197292490 X:124675995-124676017 CAGTGTGAGCTCAGTCAGAAAGG + Intronic
1197707799 X:129646803-129646825 CAGGGGTAGGTCAGGGAGGTGGG + Exonic
1198287195 X:135202888-135202910 CAGTGGGGGATCGGGGAGAAAGG - Intergenic
1198827117 X:140711128-140711150 CACTGGAAGCACAGAGAGGAAGG - Intergenic
1198857769 X:141035917-141035939 CTTTGGGAGGTCAGGGTGGATGG - Intergenic
1198890336 X:141387828-141387850 CAGGGGGAGTTGAAGGAGGAGGG - Intergenic
1198904927 X:141551454-141551476 CTTTGGGAGGTCAGGGTGGATGG + Intergenic
1199157277 X:144565301-144565323 TAGAGGGAAATCAGGGAGGAAGG - Intergenic
1199575504 X:149310203-149310225 CAGAAGGATCTCAGGGAGGTAGG + Intergenic
1199663749 X:150080567-150080589 GAGTGGCAGCTGAGGGAGAATGG - Intergenic
1199722102 X:150549440-150549462 CCCTGAGAGCTCAGGGAGGTTGG + Intergenic
1199980655 X:152918664-152918686 CACTGCATGCTCAGGGAGGAGGG + Intronic
1200039533 X:153355473-153355495 CACAGGGAGCCCAGGGAGGAGGG - Intronic
1200149256 X:153943316-153943338 CACAGGGAGCCCAGGGAGGAGGG + Intronic
1200211192 X:154347263-154347285 CAGCGGCAGTTCAGGCAGGATGG - Intergenic
1201303651 Y:12532196-12532218 CAGTGTGGACTCAGAGAGGAAGG + Intergenic
1202062431 Y:20901170-20901192 TCTTGGGAGCTCTGGGAGGAAGG + Intergenic