ID: 976521990

View in Genome Browser
Species Human (GRCh38)
Location 4:86039406-86039428
Sequence CTGTGGCAGGCCCAGTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 3, 1: 4, 2: 7, 3: 53, 4: 408}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976521990_976521999 21 Left 976521990 4:86039406-86039428 CCCCAACACTGGGCCTGCCACAG 0: 3
1: 4
2: 7
3: 53
4: 408
Right 976521999 4:86039450-86039472 CCCTCACAGCCCTAGACACCAGG 0: 1
1: 1
2: 3
3: 24
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976521990 Original CRISPR CTGTGGCAGGCCCAGTGTTG GGG (reversed) Intronic
900266257 1:1758862-1758884 CGGTGGCTGGCGCAGTGCTGGGG - Intronic
900421247 1:2556889-2556911 CTGTGGTGAGCCCAGTGCTGGGG - Intronic
900608123 1:3532836-3532858 CTGTGCCAGGCCCTGGGTTCTGG + Intronic
900955333 1:5883219-5883241 CTGTGCCAGGGCCAGAGCTGCGG + Intronic
900974365 1:6007936-6007958 CTGAGGCAGGGGCAGTGGTGGGG + Intronic
901659462 1:10789321-10789343 AAGTGGCAGGCCCAGGGTTTGGG - Intronic
901739220 1:11331188-11331210 CTGTGCCAGGCTCTGTGTCGAGG + Intergenic
901850540 1:12012149-12012171 CTGAGGCGGGCCCTGTGCTGGGG + Exonic
902437986 1:16410216-16410238 ATGTGGCAAGTCAAGTGTTGGGG - Intronic
902447139 1:16474552-16474574 CTGGGTTAGGCCCAGAGTTGGGG - Intergenic
902466999 1:16624531-16624553 CTGGGTTAGGCCCAGAGTTGGGG - Intergenic
902507599 1:16948245-16948267 CTGGGTTAGGCCCAGAGTTGGGG + Intronic
902658170 1:17883728-17883750 GTGTGCCAGGCCCAGTGTGAAGG - Intergenic
902897023 1:19485828-19485850 CTGCTGCAGGCCCAGAGTCGGGG - Intergenic
903156139 1:21445073-21445095 CAGTGGCATCCCCAGTGTGGAGG - Exonic
903553925 1:24179750-24179772 CTGTGCCAGGCCAAGTGCTAAGG - Intronic
903781210 1:25820999-25821021 CAGAGGTGGGCCCAGTGTTGGGG + Intronic
903931989 1:26867633-26867655 ATGAGGCAGGCCCAGTCCTGAGG + Intergenic
904424197 1:30413101-30413123 CTGTGGCAGGGCCCGGTTTGTGG + Intergenic
904424373 1:30414105-30414127 CTGTGGCAGGGCCCGGTTTGTGG + Intergenic
904462302 1:30687326-30687348 CTGTGGGAGGAGCAGTCTTGGGG - Intergenic
905886490 1:41494718-41494740 CTGTGTCAGGCCCAGGGCTGGGG + Intergenic
906674014 1:47680113-47680135 CTGTGGCTGGGGCAGTGATGGGG - Intergenic
907354398 1:53860610-53860632 CTGTGCCAGGCCCTGTGCAGGGG - Intronic
907395211 1:54184987-54185009 CTGTGCCAGGCACCATGTTGAGG + Intronic
907551727 1:55310481-55310503 CAGAGGCAGGCCCCGTTTTGAGG + Intergenic
908169720 1:61492555-61492577 ATGTGGAAGGCCAAGTGTGGTGG - Intergenic
908776811 1:67648645-67648667 CTGTGCCACGCCCTGTGCTGGGG + Intergenic
908784375 1:67720596-67720618 CTGTGCCAGGCACTGTGTTAAGG + Intronic
908924642 1:69239539-69239561 CTTTGCCAAGCCCAGTGTTGAGG + Intergenic
911439542 1:97908287-97908309 CTTTGGGAGGCCAAGTGGTGTGG - Intronic
912184516 1:107258787-107258809 CTTTGGCAGGCGCAATCTTGAGG + Intronic
912541789 1:110421787-110421809 CTTTGGCAGATCCAGTCTTGTGG - Intergenic
912562619 1:110561478-110561500 CCCTGGCAGGCCCAGTCTCGGGG + Intergenic
914332712 1:146687177-146687199 ATGTGCTAGGCACAGTGTTGGGG + Intergenic
915304261 1:154968881-154968903 CTGTGGCAGCCCCAGTTGAGTGG - Intronic
915445049 1:155969790-155969812 CTGTGGCAGTCACAGTGGGGGGG + Intronic
915559959 1:156681380-156681402 CTTTGGCAGGCCCTGCCTTGAGG - Intergenic
916080514 1:161229238-161229260 CTGTGGCAGCTCCAGTTCTGAGG - Exonic
916429786 1:164716565-164716587 CTGTGAAAGGCCAAGTGTGGTGG + Intronic
916722283 1:167493476-167493498 CTGTGCCAGGCCCTGTGCTGAGG + Intronic
917161859 1:172066349-172066371 TTATGGAAGACCCAGTGTTGAGG + Intronic
918438948 1:184546469-184546491 CTGTGCCAGACCCTGTGTTAGGG + Intronic
919120478 1:193334157-193334179 GTGTGGTAGGCTCAGTGTTGGGG + Intergenic
919817397 1:201450112-201450134 CTGTGCCAGGGCCAGTTTTCAGG + Intergenic
919885180 1:201928469-201928491 CTTTGGGAGGCCCAGTGCTTGGG - Intronic
920517095 1:206593288-206593310 TTGTGCTAGGCCCATTGTTGGGG - Intronic
920536222 1:206738208-206738230 CTGTGTCATGCCCAGTGCTTAGG + Intergenic
921201406 1:212810118-212810140 CTTTGGGAGGCCAAGGGTTGCGG + Intronic
921324125 1:213973703-213973725 TTGTGCTAGGCACAGTGTTGAGG + Intergenic
922181980 1:223242833-223242855 CTGTGGCAGGGCCAGAGTCATGG - Intronic
922579947 1:226689434-226689456 CTGTGGTAGGCCCAGGGAAGGGG + Intronic
922657264 1:227396599-227396621 CTGTGCCCGGCCCAGTTCTGTGG + Intergenic
922706851 1:227794747-227794769 CTGTGGCTGGCTCAGGGCTGAGG + Intergenic
923243489 1:232108818-232108840 CTGTGGAGGCCCCAGGGTTGGGG + Intergenic
923259054 1:232249396-232249418 CTGTGGAAGCCCCTGTGTTTGGG - Intergenic
924185191 1:241481318-241481340 CTGTGGCAGGCACTGTGCTAGGG - Intergenic
924456008 1:244219502-244219524 CAGTGCCAGGCCCAGTGCTGGGG + Intergenic
924949220 1:248867291-248867313 CTGGGGTGGGCCCAGTGTTAGGG - Intergenic
1063677940 10:8158401-8158423 CTGTGGTGGACCCAGTGTTCTGG + Intergenic
1064498132 10:15937479-15937501 CTGTGGGAGGCCAAGTCTTGCGG - Intergenic
1065228424 10:23571297-23571319 CTTTGGCAGGCCCAGTACTGGGG - Intergenic
1065429840 10:25642106-25642128 CTGTGGGAGGCTGAGTCTTGAGG + Intergenic
1066165866 10:32788082-32788104 ATGGGGCAAGCTCAGTGTTGAGG - Intronic
1066527560 10:36297728-36297750 CTGCAGCAGGCACAGTGCTGGGG + Intergenic
1067045873 10:42984935-42984957 CTGTGGCAGGCCCAGGCTCGGGG - Intergenic
1067751963 10:48977605-48977627 CTCTGGCTGGCCCACTGATGTGG - Intronic
1067821882 10:49538179-49538201 CTGCGGGAGCCCCAGTGATGGGG - Intronic
1067826539 10:49578189-49578211 CTGTGCCAGGCCCAGCTTGGTGG - Intergenic
1068000767 10:51331462-51331484 CTGTGGCAGACCCAGTGTTGGGG + Intronic
1068410940 10:56653627-56653649 CTGTGGCAAGCCCAGTGTTGGGG - Intergenic
1068631847 10:59306418-59306440 GTGTGCCTGGTCCAGTGTTGTGG + Intronic
1068726083 10:60305013-60305035 CTGTGGCAGGCACAGTGGGTGGG + Intronic
1070781477 10:79139861-79139883 CTGTGGCTGGACCAGAGCTGAGG + Intronic
1071067897 10:81657168-81657190 CTGGGGTAGGTCTAGTGTTGAGG + Intergenic
1071195484 10:83153962-83153984 CTGTGGCACGCCCTGTGAGGGGG + Intergenic
1071503183 10:86217880-86217902 CTGAGGCAGGCTCTGTGGTGTGG - Intronic
1071508480 10:86246795-86246817 CTGGGGGAGGCCCTGTGTAGGGG - Intronic
1071752873 10:88501387-88501409 CTGTGGAAGGCATAGTGTTTGGG - Intronic
1072020620 10:91395972-91395994 CTGAGGCAGGCCTGGTGCTGGGG - Intergenic
1072531605 10:96324661-96324683 CTGTGTCAGACACAGTGCTGAGG - Intronic
1072850251 10:98882696-98882718 CAGTGGCAGGCCCAGCATAGTGG + Intronic
1073043487 10:100622683-100622705 CTGGGGCAGGGCTAGTGCTGGGG - Intergenic
1073168567 10:101481185-101481207 CTTTGGCAGGCCTAGTGGGGAGG - Intronic
1073510745 10:104041007-104041029 CTGTGGCAGGACAAGGGCTGAGG + Intronic
1074445572 10:113518635-113518657 CTGAGCCAGGCCCTGTGCTGAGG + Intergenic
1074987849 10:118673166-118673188 CTGTGCCAGGCCATGTGTTATGG + Intergenic
1076065090 10:127442235-127442257 CTGTGCCAGGGCCAGTCTGGAGG - Intronic
1076360755 10:129887153-129887175 CTGTTGCAGGCCCAGGGCTGAGG - Intronic
1076399642 10:130173196-130173218 CTGAGTCAGGCCCAGTGTGTCGG - Intronic
1076533904 10:131163621-131163643 ATGTGGCAGCCCCAGCTTTGAGG - Intronic
1076845557 10:133067922-133067944 CTGTGGCCAGCACAGTGCTGGGG - Intergenic
1076978660 11:193637-193659 CTGGGGCAGGTCCAGGGCTGTGG + Intronic
1077226400 11:1440713-1440735 CTGTGGGAGGCCCTGGGATGAGG + Intronic
1077541575 11:3149044-3149066 CTGTGGTGGGCCCAGTGGGGAGG - Intronic
1078003209 11:7513870-7513892 CTGTGGCAGGTCCCGGGGTGGGG + Exonic
1078018022 11:7632066-7632088 CTGCTGAAGGCACAGTGTTGTGG + Intronic
1078048864 11:7944803-7944825 CTGTGGGTGCCTCAGTGTTGTGG + Intergenic
1078059426 11:8033656-8033678 CCGTGCCAGGCCCTGGGTTGGGG - Intronic
1078535595 11:12170890-12170912 CTGTGCCAAGCCCTGTGCTGGGG - Intronic
1078549334 11:12269601-12269623 CTGTGTCTGGCCCAGTGTCCAGG + Intergenic
1078801865 11:14653709-14653731 CTGTCGCTGGCCGAGTGTGGTGG + Intronic
1080455431 11:32414627-32414649 CTTTGGGAGGCCAAGTGTGGCGG + Intronic
1080989385 11:37511895-37511917 CCCAGCCAGGCCCAGTGTTGAGG + Intergenic
1081849693 11:46266378-46266400 GTGTGCCAGGCTCAGTGCTGAGG - Intergenic
1081861134 11:46333881-46333903 CTGTGCCAGGCACAGGCTTGTGG + Intronic
1081997988 11:47377122-47377144 CTGTGGCTGGCCAAGTGAGGAGG + Intronic
1082695777 11:56362976-56362998 CTATAGTAGTCCCAGTGTTGGGG - Intergenic
1083257436 11:61505343-61505365 CTTTGGCAGGGTCAGTGTGGAGG + Intergenic
1083817981 11:65148120-65148142 CTGTGGCAGGCCCTGGGTCTGGG - Intergenic
1085411911 11:76296469-76296491 CTGTGCCCGGCCCAGTGTTGGGG + Intergenic
1085764574 11:79271667-79271689 CTCTGGCAAGTTCAGTGTTGTGG - Intronic
1086072039 11:82810556-82810578 CTGTGGCAGGCACTGTGTTATGG - Intergenic
1086095544 11:83046736-83046758 CTTTGGCAGGCCAAGTGGGGAGG - Intronic
1087139951 11:94755635-94755657 CTGTCGCAGGCCCTGTGACGGGG - Intronic
1088882774 11:113984510-113984532 CTGTGCCAGGCCCTGTGCTGGGG - Intronic
1089455143 11:118621545-118621567 CTGTGGCTGGCCCGGGGCTGAGG - Intronic
1090534316 11:127624181-127624203 CTGTGGGATTCCCAGTGTAGAGG + Intergenic
1092288608 12:7144826-7144848 CTGTGGAAGGCCCCGGGCTGTGG + Intronic
1092917773 12:13203650-13203672 CTGTGCCAGGCACAGAGTGGGGG - Intronic
1097000925 12:55875891-55875913 ATGTAGCAGGCCCAGTTCTGAGG + Intergenic
1097160635 12:57044208-57044230 CTCTGGGAGGGCCAGTGTTGGGG + Exonic
1098264583 12:68705792-68705814 CTTTGGCAGGGCCAGTGGTAGGG + Intronic
1099805851 12:87517963-87517985 CTGTGGCAGTTCCACTCTTGTGG + Intergenic
1099991064 12:89720879-89720901 CTGTGGCTCTTCCAGTGTTGAGG - Intergenic
1100237165 12:92672511-92672533 CTGTGGCAGGCCAGGCGTGGTGG + Intergenic
1101139263 12:101778226-101778248 CTGCAGCAGGCCAAGTGATGTGG + Intronic
1101920942 12:108932493-108932515 CTGAGACAGCTCCAGTGTTGTGG + Intronic
1102762582 12:115401354-115401376 CTCTGGCAGGCACTGTGCTGGGG - Intergenic
1103896567 12:124277490-124277512 GTGTGGCAGGTCCTGGGTTGTGG - Intronic
1104213057 12:126708839-126708861 CTGTGGCTGGGCCAGTGATGGGG - Intergenic
1104858188 12:131911645-131911667 CTCTGGGAGGCCCTGTTTTGGGG - Intronic
1104879584 12:132061271-132061293 CTGTGGCAGGGACATTGGTGAGG + Intronic
1107294598 13:38895870-38895892 CTGTGGCAGACCTAGAGATGGGG - Intergenic
1107834435 13:44402182-44402204 CTGTGCCAGGCCCTGTTTTAAGG + Intergenic
1108385957 13:49899511-49899533 CTTTGGGAGGCCAAGTGGTGTGG - Intergenic
1108945653 13:56019684-56019706 CTGGGGCCAGCCCAGTGCTGGGG + Intergenic
1109652848 13:65352766-65352788 CTGGAGCAAGCCCAGTGTTGGGG - Intergenic
1109756133 13:66762410-66762432 CTGTGGTGGGCCCAGTGTTAAGG + Intronic
1110985914 13:81968130-81968152 CTGTGGCAAGCCTAATGTTGGGG + Intergenic
1111298708 13:86318193-86318215 CTTTGGGAGGCCCAGTGGGGTGG + Intergenic
1111316445 13:86567234-86567256 CTGTGGTGGGCCCAGTGTCTGGG - Intergenic
1111625102 13:90774793-90774815 CTGTCTCAGCCCCAGTGTGGAGG - Intergenic
1112202023 13:97286026-97286048 ATGTGGCAGGCCAAGTGTTCTGG - Intronic
1112433943 13:99377157-99377179 GTGTGTCAGGCTCTGTGTTGGGG + Intronic
1114601333 14:23957792-23957814 CTTTGGTAGGCCCAGTGGGGAGG - Intronic
1114605522 14:23992921-23992943 CTTTGGTAGGCCCAGTGGGGAGG - Intronic
1115826959 14:37289380-37289402 CTGAAGCAGGGCCAGTCTTGTGG - Intronic
1119347783 14:73940691-73940713 CTGTGCCAGGCACAGTGTTAAGG - Intronic
1119380401 14:74224639-74224661 CTGTGGTAGGCGCAGAGGTGAGG - Intergenic
1119602109 14:75983044-75983066 CAGAGGCAAGCCCTGTGTTGCGG - Intronic
1119719849 14:76883338-76883360 CGGGGGCAGGGCCAGTTTTGTGG + Intergenic
1119877544 14:78073736-78073758 ATGTGCCAGGCCAAGTGCTGGGG + Intergenic
1121111873 14:91318127-91318149 CTGTGGCTGACTCAGTGTTTTGG - Intronic
1121438988 14:93937019-93937041 CTGTGCCAGGCACAGTGAAGTGG - Intronic
1123994118 15:25706429-25706451 CTGTGGTAATCCCAGTGTTTTGG - Intronic
1124207532 15:27734490-27734512 CTATGACAGGCCCAGTGCTGGGG - Intergenic
1124504877 15:30264083-30264105 CAGTGCCAGGCCCTGTGCTGAGG + Intergenic
1124738675 15:32274552-32274574 CAGTGCCAGGCCCTGTGCTGAGG - Intergenic
1125624164 15:41092811-41092833 CTTTGGCAGGCCCAGGCATGAGG + Intronic
1125730150 15:41888483-41888505 GTGAGCCAGGCCCAGTGTTATGG + Intronic
1125980544 15:43996316-43996338 CTGGGACAGGCCCAGTGTTGAGG + Intronic
1126292747 15:47099971-47099993 CTGGGGCAGGGGCAGTGTAGGGG + Intergenic
1126709946 15:51443996-51444018 CTGGGGCAGGCCTGGTGTTGGGG + Intergenic
1127037428 15:54933371-54933393 CTGTGGTGGGCCCAGAGTTCAGG + Intergenic
1127121001 15:55772006-55772028 ATATGGCAGGCCAAGTGTGGTGG + Intergenic
1127298575 15:57631010-57631032 CTGTGGCAGGCCAAGTGAACTGG - Intronic
1128080718 15:64855365-64855387 CTGGGGGAGGCCCAGGGCTGAGG + Intronic
1128159373 15:65413434-65413456 TTGTGGCAAGGGCAGTGTTGGGG - Intronic
1128825139 15:70708262-70708284 CTGTGGCAGGAGCAGAGGTGGGG + Intronic
1128946125 15:71822771-71822793 AGGTGACAGGCCCATTGTTGGGG + Exonic
1129542582 15:76363033-76363055 CTGTGGCAGGCACAGTGCTGGGG - Intronic
1129542682 15:76363805-76363827 TTGTAGCAGGACCAGTTTTGTGG - Intronic
1129604518 15:77018388-77018410 CTGGGGGAGGCCCAGGTTTGAGG - Intronic
1129937667 15:79464114-79464136 CTGTGGGAGGTACAGTGTGGTGG + Intronic
1130519149 15:84649032-84649054 CTGTGTCAGGCGCAGTGTTTAGG + Intronic
1131399216 15:92111101-92111123 CTGTGGGAAGCACAGTGGTGGGG - Intronic
1131794501 15:96001051-96001073 CTGTGCCAGGCACTGTGCTGGGG + Intergenic
1132040994 15:98524555-98524577 CTGTCGCTGGCCCTGTGTTCTGG + Intergenic
1132110484 15:99099154-99099176 CTGGGCCAGGCACAGTGGTGTGG - Intronic
1132176147 15:99716760-99716782 CTGTTGCATGCACAGTGCTGTGG + Intronic
1133147536 16:3800997-3801019 CTGTGCCAGGCTCTGTGTTCAGG + Intronic
1135050139 16:19185802-19185824 CAGTGGCAGGCCCAGTTGTCAGG + Intronic
1135119208 16:19750966-19750988 CTGTGGCAGGTACGGTGATGAGG + Intronic
1135971223 16:27073456-27073478 CTGTCTCAGGCCAAGTGTAGTGG + Intergenic
1137472861 16:48777190-48777212 CTGGGGTAGGCTTAGTGTTGGGG + Intergenic
1138392142 16:56677573-56677595 TTGAGCCAGGCCCACTGTTGGGG + Intronic
1139460102 16:67115193-67115215 CTGTGCCAGGCACAGTGATTGGG + Intronic
1139652537 16:68369713-68369735 CTCTGCCAGGCCCAGAGTTTGGG - Intronic
1139682396 16:68575163-68575185 CTGTGGCAGGCCCAGGGCCAAGG - Intronic
1139877913 16:70161166-70161188 CTTTGGGAGGCCCAGTGAGGTGG + Exonic
1139961866 16:70722462-70722484 CTGTGACGGGGCCAGGGTTGTGG + Intronic
1140000902 16:71024064-71024086 ATGTGCTAGGCACAGTGTTGGGG - Intronic
1140780756 16:78294268-78294290 CTGTGCCAAGCCCAGTGCCGGGG + Intronic
1141737373 16:85862527-85862549 CAGTGGCAGGCCCTGTCTTGGGG + Intergenic
1141764559 16:86049889-86049911 GTGCGCCAGGCCCAGTGGTGGGG + Intergenic
1141855710 16:86680124-86680146 CTGTGGCAGGCACTATTTTGGGG - Intergenic
1141895038 16:86953854-86953876 CTGTGGCAGGCCCAGATTTACGG + Intergenic
1141994304 16:87627060-87627082 CTGGGGCAGGCCCGGGCTTGAGG - Intronic
1142249035 16:88982773-88982795 CTGGGGAAGGCCCAGAGATGAGG - Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142466088 17:138128-138150 CTGGGGCAGGTCCAGGGCTGTGG + Intronic
1142882023 17:2889352-2889374 CAGTGCCAGGCCCTGTGCTGGGG + Intronic
1142990869 17:3730037-3730059 CTGTGGGAGGGGCAGGGTTGGGG - Intronic
1143067383 17:4261199-4261221 CTGTGGCCGGCCGGGTGTGGTGG + Intronic
1143097755 17:4487575-4487597 CTGTAGGAGGGTCAGTGTTGAGG + Intronic
1143319339 17:6057903-6057925 CAGTGGCAGAACCAGTCTTGGGG + Intronic
1143539045 17:7558696-7558718 CTGGGGCGGCCCCAGGGTTGGGG - Exonic
1143974665 17:10821082-10821104 CTGTGCCAGACCCTGTGCTGGGG - Intergenic
1144046741 17:11460807-11460829 CAGTGGCAGGACCCATGTTGAGG - Intronic
1144330840 17:14222800-14222822 CTGTGGCTGGAGCAGTGTGGGGG - Intergenic
1144662937 17:17083035-17083057 CTGTGGCAGGCATGGTGCTGAGG + Intronic
1146021571 17:29283568-29283590 TTCTGGGAGGCCCAGTGTGGTGG - Intronic
1146049258 17:29536047-29536069 CTTTGGGAGGCCGAGGGTTGGGG + Intronic
1146900354 17:36581634-36581656 CTTTGGGAGGCCCAGGGTGGAGG + Intronic
1147988065 17:44317912-44317934 CTGTGCCAGGCACCGTGCTGGGG - Intronic
1148000399 17:44384280-44384302 CTTCGGGAGGCCCAGTGGTGGGG + Intronic
1149234996 17:54578847-54578869 TTGTGGGAGGCACAGTGCTGTGG + Intergenic
1149447607 17:56725711-56725733 CTGTGCCTGGCCCTGTGTTAAGG + Intergenic
1150218828 17:63484582-63484604 CTGGGCCAAGCCCAGAGTTGAGG - Intergenic
1150227414 17:63531487-63531509 CTGGGGCTGTCCCTGTGTTGGGG + Intronic
1152046841 17:77942344-77942366 CTGTGGCCTGCCGAGTGGTGGGG + Intergenic
1152698605 17:81808135-81808157 CTGTGCCAGGCCAAGTGTGTGGG - Intronic
1155960511 18:31991023-31991045 CTGTGACATGCACAGGGTTGAGG - Intergenic
1156763504 18:40622628-40622650 CTGTGGCAGACAAAGAGTTGTGG - Intergenic
1157472562 18:48001286-48001308 CGGAGGCAGCCCCAGTTTTGTGG - Intergenic
1157622559 18:49024791-49024813 CTGTGCCTGGCCCAGAGATGGGG + Intergenic
1157832648 18:50871144-50871166 CTTTGGCAGGCCCAGCGGGGTGG - Intergenic
1158103550 18:53858969-53858991 ATGTTGCAGTCCCAATGTTGCGG + Intergenic
1160201694 18:76801732-76801754 CCGTGACAGGCGCAGTCTTGAGG + Intronic
1160859674 19:1232350-1232372 CAGTGGGAGACCCTGTGTTGTGG - Intronic
1161176228 19:2843822-2843844 CTGAGGCAGCCCCTGTGTTCGGG - Intronic
1161563490 19:4986570-4986592 CTGTGCCAGGCCAGGTGCTGAGG + Intronic
1162113283 19:8413081-8413103 CTGGGGCGGGGCCAGTGCTGGGG + Intronic
1162514428 19:11139355-11139377 CTGTGGGAGGCCCAGGGAGGAGG - Intronic
1162772563 19:12958121-12958143 CTGTGGCAGGGCCACTGATATGG + Intergenic
1164523992 19:29000254-29000276 CTGAGGCAGGCTCAGAGCTGTGG + Intergenic
1164761059 19:30728593-30728615 ATATGGGAGGCCCAGTGCTGGGG + Intergenic
1164816936 19:31211525-31211547 CTGGGGCAGGGGCAGTGGTGAGG + Intergenic
1166730190 19:45054848-45054870 CTGTGCCAGGCTCGGTGCTGGGG - Intronic
1166743150 19:45126244-45126266 ATGTGGCAGGCACAGAGTGGTGG + Intronic
1166752747 19:45172482-45172504 CTGTGCCAGGCCCAGGGGTGTGG + Intronic
1166756632 19:45196475-45196497 CCTTGGCAGGCTCAGTGCTGTGG - Intronic
1167015713 19:46839691-46839713 CTGTGCCTGGCCCTGTGCTGGGG + Intronic
925443711 2:3909813-3909835 CTGTGCCAGGCCTTGTGATGGGG + Intergenic
925976111 2:9143254-9143276 GTGTGCCAGGCCCTGTGCTGGGG + Intergenic
926181803 2:10651273-10651295 TTGTGCCTGGCCCAGTGTAGCGG - Intronic
927254033 2:21024372-21024394 CTGTGGGAGGCCCAGGCTGGAGG + Intronic
927693586 2:25225007-25225029 CTGTGACAGGCCGAGTGCAGTGG - Intergenic
929943760 2:46354793-46354815 GTGAGGCAGGCCCAGTGTCCTGG - Intronic
931880917 2:66569875-66569897 CAGTGGCAGGCCTAGTGAAGTGG + Intronic
932293693 2:70606818-70606840 CAGTGGCAGCCCCACTGTTAAGG + Intergenic
932392614 2:71410452-71410474 CTTTGGAAGGCCCAGGGTGGAGG - Intronic
932785229 2:74595256-74595278 CTGTGGGAGGCCAAGTGGGGAGG - Intronic
934771388 2:96909851-96909873 CCAGGGCAGGCCCAGTGTTTTGG - Intronic
934860836 2:97762567-97762589 CTGTGGGAGGTGCAGTGTTCCGG + Intronic
934894274 2:98100410-98100432 CTGTGGCTGATACAGTGTTGGGG + Intronic
934894318 2:98100696-98100718 CTGTGTCAGGCCCTGTATTAGGG + Intronic
935091075 2:99895607-99895629 CTGTGGCTGGCACGGTGGTGAGG - Intronic
935972595 2:108544780-108544802 TTGAGGCTGGCCCAGTGTGGTGG - Intronic
937352485 2:121175053-121175075 TTCTGGCAGGCCCAGTCTGGCGG - Intergenic
937854158 2:126660603-126660625 CTGTGACAGGCCCTGAGTGGGGG - Intronic
937904295 2:127045411-127045433 CAGCAGCAGGGCCAGTGTTGGGG + Intergenic
937985149 2:127635029-127635051 AGGTGGCAGGCGCAGTGTGGGGG + Intronic
939903621 2:147882305-147882327 CTTTGGGAGGCCCAGTGGGGCGG + Intronic
940211956 2:151264122-151264144 CTCTGGAAGGCCCATTGTTGGGG - Intergenic
943811392 2:192194173-192194195 CTGTTGCAGGCCCGGGGGTGAGG - Intronic
944888247 2:204087474-204087496 CTGTGGGAGGCCGAGTGGGGTGG - Intergenic
947973422 2:234343946-234343968 CTGTGGCAGGCCCACTGGAGCGG + Intergenic
948240584 2:236429743-236429765 CTGTGGCAGGAGCAGTCATGTGG + Intronic
948640216 2:239370997-239371019 CTGTGGGAAGCCCTGTGGTGTGG - Intronic
948884756 2:240877108-240877130 CTGAGGCAGGAGCAGTGCTGCGG + Intronic
949025215 2:241764628-241764650 CTGAGGCAGGACCTGAGTTGGGG + Intronic
1168827070 20:821265-821287 CAGTGTCAGGCCCAGAGCTGTGG + Intergenic
1168854437 20:998756-998778 CTGTGCCAGGCTCTGTGTTGGGG - Intronic
1168966853 20:1903969-1903991 GTGTGTCAGGCCCTGTGCTGAGG - Intronic
1169252647 20:4072217-4072239 CTCTGGCAGGGGCAGTGGTGAGG + Intronic
1169664122 20:8015591-8015613 GTGTGTCAGGTTCAGTGTTGGGG - Intronic
1170487020 20:16828776-16828798 CAATGGCAGGCCCAGGGTGGTGG - Intergenic
1171240502 20:23563619-23563641 CTGTGGTAGGTGCAGTGTTGAGG + Intergenic
1171419194 20:25006536-25006558 TTGTGGCAGTGCCAGTGTTCGGG - Exonic
1172597273 20:36157982-36158004 ATGTGCCAGGCCCAGTTTTAAGG + Intronic
1172613152 20:36266505-36266527 CTGTGTCAGGCCCAGGGCTGAGG - Intronic
1172634687 20:36402005-36402027 CAGTGGCAGGGCCAGGGTTGGGG + Intronic
1173963711 20:47094783-47094805 CTGTGGGAGGCCAAGTGGGGAGG + Intronic
1174024591 20:47562987-47563009 CTTTGGGAGGCCCAGTGGAGAGG - Intronic
1174039685 20:47690098-47690120 CTCTGGCAGGCAGAGTGCTGAGG + Intronic
1174536724 20:51257063-51257085 GTGAGGCAGGCACAGTCTTGTGG - Intergenic
1175832617 20:61974521-61974543 CGGCGGGAGGCCCAGTGCTGGGG - Intronic
1176078160 20:63258538-63258560 CTGTGCCAGGCCTAGATTTGGGG + Intronic
1176215420 20:63945493-63945515 CTGTGGCATGCCTGGGGTTGGGG + Intronic
1178950646 21:36982741-36982763 CTCTGGCAGGCCAAGTGCAGTGG + Intronic
1179932315 21:44578927-44578949 CTGGGGCAGTGCCAGTTTTGGGG + Intronic
1179966605 21:44810466-44810488 CCGTGGGAGGCACAGGGTTGTGG - Intronic
1180261706 21:46674787-46674809 CCCTGGCAGGCCCAGGGGTGCGG - Intergenic
1180707521 22:17818482-17818504 CTTTGGCAGGCCCAGCCTTTTGG + Exonic
1181407918 22:22697894-22697916 CTGGGGCAGGGCCAGTGCTGGGG + Intergenic
1181415909 22:22758684-22758706 TGGGGGCAGGCCCAGTGCTGGGG + Intronic
1181420204 22:22792476-22792498 TGGGGGCAGGCCCAGTGCTGGGG + Intronic
1181424245 22:22822764-22822786 TGGGGGCAGGCCCAGTGCTGGGG + Intronic
1181428034 22:22856533-22856555 TGGGGGCAGGCCCAGTGCTGGGG + Intronic
1181519131 22:23435329-23435351 CTGTGCCTGGCCCAGAGATGTGG + Intergenic
1182025352 22:27114023-27114045 ATGTGCCAGGCCCTGTGTTAGGG + Intergenic
1182645761 22:31808133-31808155 CTCTGTCATGCCCAGTGTAGTGG + Intronic
1182947376 22:34335935-34335957 CTGTGGCGGACCCAGTGTTAGGG + Intergenic
1183247962 22:36708606-36708628 CTGTGTCAGGCCCTGTGCTGAGG + Intergenic
1183374304 22:37454081-37454103 CTGTGGCAGTTCCAGCCTTGGGG - Intergenic
1183769075 22:39907950-39907972 CTGTGTTTGGACCAGTGTTGTGG - Intronic
1183969405 22:41465451-41465473 CTGTGCCTGGCCCAATGGTGTGG + Intronic
1184107696 22:42377906-42377928 ATGTGTCAAGCCCAGTGCTGTGG - Intergenic
1184612694 22:45615137-45615159 CTGTCTCAGGCCCAGTGTGGTGG - Intergenic
1184902617 22:47457189-47457211 GTGTGGCAGGCCCAGCCTGGGGG - Intergenic
1185372819 22:50468832-50468854 CTGGGGGATGCCCACTGTTGGGG - Intronic
949641948 3:6046423-6046445 CTGTGGCAGGCCCAGTTGTTGGG - Intergenic
950151574 3:10691586-10691608 CTTTGTCAGGCCCAGAGTCGGGG - Intronic
952512293 3:34069594-34069616 ATGTGTCAGGCACTGTGTTGGGG + Intergenic
953203874 3:40803304-40803326 CTGGGTCAGCTCCAGTGTTGGGG + Intergenic
953340320 3:42128874-42128896 GTGTGGAAGGCTGAGTGTTGTGG + Intronic
954290949 3:49649781-49649803 CTGTTTCAGGCCCAGTGCTGGGG - Intronic
954630914 3:52047233-52047255 CTTAGCCAGGCCCAGTGCTGAGG + Intergenic
954700285 3:52447247-52447269 CTGTGTCAGGCCCTGTGTTGGGG + Intergenic
954851717 3:53606561-53606583 CAGTGGCAGGCCAAGGGCTGTGG + Intronic
955194877 3:56795921-56795943 CTGTGTCATGCCCAGTGTGGTGG - Intronic
956372554 3:68579305-68579327 CTGTGGTAGTCTCAGTGTTGGGG + Intergenic
957728957 3:84107091-84107113 CTTTGGGAGGCCCTGTCTTGTGG + Intergenic
957864030 3:85999253-85999275 CTTTGGGAGGCCGAGGGTTGGGG + Intronic
958950262 3:100408712-100408734 CTGTGACAGGCCTGGTATTGGGG + Intronic
959059223 3:101601032-101601054 CTGTGGGAGGCCAAGGGTGGGGG - Intergenic
960021327 3:112957034-112957056 CTCTGGTGGGCCCAGAGTTGGGG + Intronic
960057052 3:113283447-113283469 CTGTGGTGGGGCCAGAGTTGGGG - Exonic
960570302 3:119179093-119179115 CTTTGGAAGGCCAAGTCTTGAGG + Intronic
960739267 3:120814953-120814975 CTGGAGCAGCCCCAGTGTCGTGG + Intergenic
961374100 3:126450943-126450965 CTGTGGCTGGAGCACTGTTGTGG - Intronic
961519927 3:127461202-127461224 CTGTGCTAGGCCCTGTGCTGGGG + Intergenic
961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG + Intronic
962319475 3:134378535-134378557 CTGGGGCAGGGCCAGTGTGATGG + Intergenic
962629642 3:137263291-137263313 ATGTGCCAGGCTCTGTGTTGGGG - Intergenic
962742568 3:138372623-138372645 ATGTGCCAGGCCTGGTGTTGAGG - Intronic
962886212 3:139630350-139630372 CTGTGGCTGCCACAGAGTTGGGG + Intronic
962894844 3:139704852-139704874 CAGTGGCAGGCATAGAGTTGTGG + Intergenic
962924081 3:139975830-139975852 TTGTGGCAGCTCCTGTGTTGTGG - Intronic
963460735 3:145611492-145611514 CTGTGGCTGGCCCAGTGTTGAGG + Intergenic
963661557 3:148133358-148133380 GTGTGGCAGGCTGAGTGCTGTGG + Intergenic
963825671 3:149950761-149950783 CTGAGACAGGCCAAGTGTGGTGG - Intronic
963901565 3:150737969-150737991 CTGGGCCAGGACCACTGTTGGGG - Intergenic
964159862 3:153633996-153634018 CTGTGGCAGCCACATTTTTGGGG + Intergenic
965827117 3:172742519-172742541 CTGTGGCAGCCTTGGTGTTGTGG + Intergenic
967070819 3:185961039-185961061 CTGTGGCACACCCTGTGGTGGGG - Intergenic
968229311 3:196995972-196995994 CTGTGGCTGGGCCAGGGTGGAGG + Intronic
968495527 4:913365-913387 CTGTGGCAGGGGCTGTGCTGGGG - Intronic
968976633 4:3825488-3825510 ATGTGGCAGGCCCTGTTTTAGGG - Intergenic
969297606 4:6279055-6279077 CAGCTGCAGGCCCAGTGGTGGGG - Intronic
969550332 4:7862043-7862065 CTGTTTCAGGCCGAGTGTGGTGG + Intronic
971294095 4:25374027-25374049 CTTTGGGAGGCCAAGGGTTGGGG + Intergenic
972920477 4:43934399-43934421 CTGTTGCAGGCCAGGTGCTGTGG + Intergenic
973549529 4:52019160-52019182 CTGTGGCTGGCCGGGTGTGGTGG - Intergenic
974104479 4:57454067-57454089 TTGTGGCAGGCCCAATGTTGGGG + Intergenic
975766575 4:77674884-77674906 CTGTGGCAGGCCAGGTGCAGTGG + Intergenic
976521990 4:86039406-86039428 CTGTGGCAGGCCCAGTGTTGGGG - Intronic
980283764 4:130756149-130756171 CTGTGGCAGGCCCAGTGTTGAGG + Intergenic
981669902 4:147275095-147275117 CTGGGGCTGGCCCAGTGCTGGGG + Intergenic
982110209 4:152046391-152046413 CTGTGTCAGGCTCAGTATTTGGG - Intergenic
982613146 4:157603701-157603723 TTGTGGTGGGCCCAATGTTGAGG - Intergenic
982703808 4:158686056-158686078 CTTTGGCAGGTCCAGTCTTAAGG + Intronic
982804620 4:159748457-159748479 CTGTGGCAGGCCTAGATTTGGGG + Intergenic
983918395 4:173316539-173316561 CTGTGGCATGCCCATTACTGGGG + Intronic
985810208 5:2077793-2077815 CAGGGGCAGACCCAGTGTAGGGG - Intergenic
986195544 5:5534067-5534089 CTGTGGCAGGTGCAGTAGTGCGG - Intergenic
986464637 5:8008672-8008694 CTGGGGCAGGCCTGGTGTTAAGG + Intergenic
986758746 5:10860845-10860867 CTGTGGCAGCCCCACAGTGGTGG - Intergenic
988168536 5:27625728-27625750 CTTTGGGAGGCCGAGGGTTGAGG - Intergenic
990236230 5:53771367-53771389 CTGGATCAGGCCCAGTGTTGGGG - Intergenic
990902750 5:60770985-60771007 CTGTGGCTGGCCAGGTGTGGTGG - Intronic
992006013 5:72478208-72478230 CTGTGCCAGGCCTTGTGTGGGGG + Intronic
994497211 5:100528665-100528687 CTGTGGGAGGGGCGGTGTTGTGG - Intergenic
994895845 5:105701383-105701405 CAGTGGCTGGCCCAATGTTGGGG - Intergenic
995142419 5:108748921-108748943 CTGTGGCAGCCCCCGTGACGCGG + Intronic
995573211 5:113503182-113503204 CTGTGGCTGAGCTAGTGTTGAGG + Intergenic
996267938 5:121564861-121564883 CTGGGGCAGGCTTAGTTTTGAGG - Intergenic
996517737 5:124391834-124391856 CTTTGGGAGGCCGAGGGTTGGGG + Intergenic
997423908 5:133789966-133789988 TTGTGGCAGACCCAGCGTTATGG - Intergenic
997443737 5:133926579-133926601 CTGTGCCAGGAACAGTGGTGGGG - Intergenic
998766422 5:145492933-145492955 GGGTGGTAAGCCCAGTGTTGGGG + Intronic
1000263711 5:159615065-159615087 CTCTAGCTGGCCCAGTGATGGGG + Intergenic
1001757144 5:174179270-174179292 CTGGGCCAAGCCCAGTGCTGGGG - Intronic
1001896693 5:175388641-175388663 GTGTGGCACTCCCAGTGTGGGGG - Intergenic
1002951907 6:1821825-1821847 CAGTGGCGGGCTCAGTCTTGCGG + Intronic
1004426337 6:15509697-15509719 CTGTGGCATGGCCTGTGTTCTGG + Intronic
1004660528 6:17706084-17706106 CTGAGACAGGCCCAGCCTTGCGG - Intronic
1005957492 6:30674420-30674442 CTGTCTCAGGCCCAGTGCGGTGG - Intergenic
1006058396 6:31402539-31402561 CTGAGGCAGGCACCGTGTTTAGG + Intronic
1006070836 6:31497082-31497104 CTGAGGCAGGCACAGTGTTTAGG + Intronic
1006190157 6:32202478-32202500 CTGAGGCAGGCACAGCGTGGTGG + Exonic
1006316225 6:33293463-33293485 CTGTGACCGGCCCAGTACTGGGG - Exonic
1006375040 6:33667367-33667389 CTGTGCCAGGCACTGTTTTGGGG + Intronic
1006497797 6:34436492-34436514 GGGTGGCAGGGGCAGTGTTGGGG - Intergenic
1006501337 6:34460965-34460987 CTGAGGAAGGCCCAGTTCTGAGG + Intergenic
1006924068 6:37644518-37644540 CGGTGGGGGGACCAGTGTTGGGG + Exonic
1007472130 6:42097812-42097834 CTGTGGCTGGCTCACTGGTGGGG + Intergenic
1007570680 6:42888399-42888421 CTTTGGGAGGCCCAGGCTTGTGG - Exonic
1009663547 6:66647074-66647096 CTGTGGAAGACCCAGAGTTCAGG - Intergenic
1011335105 6:86251539-86251561 ATGAGCCAGGCCCTGTGTTGGGG + Intergenic
1011469497 6:87693484-87693506 CTGTGGCAGGCCCAGACGGGCGG + Intronic
1013403781 6:109824151-109824173 CTGTGGCAGCCCAAGTGGGGTGG + Intronic
1014997620 6:128170200-128170222 CTGTGGGAGCCCGAGTGTTGGGG + Intronic
1017899465 6:158706491-158706513 GGGTGGCAGGCCCGGTGTTCTGG + Intronic
1019518599 7:1450544-1450566 CTGTGGCAGGAGCACTGGTGAGG - Intronic
1021070360 7:16231080-16231102 TTGTGGTGGGCCAAGTGTTGGGG + Intronic
1024312963 7:47986561-47986583 CTTTGGGAGGCCAAGGGTTGGGG - Intergenic
1026256744 7:68718795-68718817 ATGTGCCAGGCCCTATGTTGAGG - Intergenic
1027561138 7:79731957-79731979 CTGTGGCAGGCCTGGTTTTAGGG - Intergenic
1028388292 7:90285206-90285228 CTGCTGGAGGCCCAGTGCTGGGG - Intronic
1028649789 7:93138739-93138761 CTATGGCAGGCCCAGTGCCCTGG - Intronic
1029335768 7:99898034-99898056 CCATGGCAGGCCCATTGTGGAGG - Intronic
1029380441 7:100210964-100210986 CTGTCGCAGGCCCTGGGCTGTGG + Intronic
1029435800 7:100563439-100563461 GTGTGGTGGGCCCAGTGCTGAGG + Intronic
1029485563 7:100837765-100837787 CTTTGGGAGGCCAAGTGTGGAGG - Intronic
1029655681 7:101922842-101922864 CTGTGGCCAGCCCAGTGCAGAGG - Intronic
1030258971 7:107543378-107543400 ATGGGGCAGGCCTAGTGTTGGGG - Intronic
1030931454 7:115527924-115527946 CTTTGGCAGGTCCAGAGTTTAGG + Intergenic
1032411455 7:131696067-131696089 CTGTGTCAGGCTCTGTTTTGGGG + Intergenic
1035299254 7:157886759-157886781 CTGGGGCAGCCCCACTGTGGTGG - Intronic
1035324227 7:158054629-158054651 CTTTGGCGGGCCCAGTAATGGGG + Intronic
1036100779 8:5781958-5781980 CTTTGGGAGGCCCAGTGGGGTGG + Intergenic
1036489205 8:9209255-9209277 CTGTGGCAGTCCTAGTCTTCTGG + Intergenic
1037453853 8:19044070-19044092 CTGTGGCTGAACCAGAGTTGAGG - Intronic
1038259630 8:25981515-25981537 CTGTGGAAGGCCCGATGTGGTGG + Intronic
1039010272 8:33086099-33086121 CTGGGGCTGGCTCACTGTTGAGG + Intergenic
1039388578 8:37158703-37158725 CTGTTGCCTCCCCAGTGTTGTGG - Intergenic
1039557322 8:38485806-38485828 CAGTGGCAGGGGCTGTGTTGTGG - Intergenic
1041390459 8:57343122-57343144 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1041746422 8:61212899-61212921 CTCTGGCAGTGCCAGTGTCGGGG + Intronic
1043307714 8:78817898-78817920 CTGTGGTGGGCCCAGTGTTGGGG + Intergenic
1046880360 8:119300518-119300540 CTGGTGCAGGACCAGTGTTAGGG - Intergenic
1047533192 8:125695892-125695914 CTGTGGCAGGACCAGTGAGGCGG + Intergenic
1047756170 8:127919969-127919991 GTGTGTCAGGCCAAGTGTTTTGG - Intergenic
1048062255 8:130932433-130932455 CTGTGGCAGGCCCAGTGTTGGGG + Intronic
1049617958 8:143584260-143584282 CTGTGCCCGGCCCAGTCTAGGGG - Intronic
1050684768 9:8155574-8155596 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1051207536 9:14704192-14704214 CAATGGTAGGCCCAGTGTTGGGG - Intergenic
1052234025 9:26188736-26188758 ATGTGGCAGGCCCAGTGCTGGGG - Intergenic
1053268057 9:36730353-36730375 CTGTGCCAGGCACAGGGTTCTGG + Intergenic
1055722421 9:79190592-79190614 CTGTGCCTGGCCGAGAGTTGCGG - Intergenic
1056105386 9:83341933-83341955 CAGTGACAAGCTCAGTGTTGTGG + Intronic
1056678956 9:88700611-88700633 CAGTGGCAGGCCAAGTGTGATGG + Intergenic
1056991743 9:91419673-91419695 ATGTGCCAGGCACAGTGTTGAGG - Intronic
1058133367 9:101278617-101278639 CTGTGGTGGGCCCAGGGTTGGGG - Intronic
1058835070 9:108853464-108853486 GTGGGTCAGGCCCAGTGCTGGGG - Intergenic
1060421528 9:123472796-123472818 CCGTGGCTGGCCCCGTGTTATGG - Intronic
1060447235 9:123701462-123701484 TGGTGGCAGGCTCAGTATTGGGG - Intronic
1061017947 9:127993516-127993538 ATGTGCCAGGCCCTGGGTTGGGG - Intergenic
1061240190 9:129365672-129365694 CTGTGGCAGGCCAGGTGCGGTGG + Intergenic
1061281628 9:129601011-129601033 CTGTGGCAGGCTCTGTGTTAGGG + Intergenic
1061389859 9:130311443-130311465 GTGTGCCAGGCCCTGTGCTGGGG + Intronic
1062105648 9:134753438-134753460 CTGAGTCAGGCCCTGTGTGGAGG - Intronic
1062619766 9:137415173-137415195 CTGTGACAGGCCCAGCGCAGTGG - Intronic
1186756592 X:12678216-12678238 ATGTGAAAGGCCCAGTGATGGGG - Intronic
1187043817 X:15625672-15625694 CTTTAGCAGGCCCTGTGTTAAGG + Intergenic
1188343117 X:29029303-29029325 CTGGGGTAGGCCAAGTGTTGTGG + Intronic
1189011094 X:37046322-37046344 CTGTGTGAGGCCCAGGGTTCAGG + Intergenic
1189035307 X:37489223-37489245 CTGTGTGAGGCCCAGGGTTAAGG - Intronic
1189522230 X:41781809-41781831 CTGTGCAAGGCCAATTGTTGAGG + Intronic
1189748680 X:44196158-44196180 CTGTGGCAGGCCAAGGCTGGTGG - Intronic
1189855747 X:45223532-45223554 TTGAGGCAGACCCAGTGTTGGGG + Intergenic
1190913654 X:54794136-54794158 CTGTGGCTGGGCTAGTGTGGGGG + Intronic
1193943750 X:87707675-87707697 GTGTGGCTTCCCCAGTGTTGGGG + Intergenic
1196126688 X:112108947-112108969 CTGTGGCAGGCCCAGTATTGAGG + Intergenic
1198311672 X:135430844-135430866 CTGTGGCAAGCACAGTGCTAGGG + Intergenic
1198740377 X:139835739-139835761 ATGTGGCCGGCCGAGTGTGGTGG + Intronic
1199681729 X:150229411-150229433 CTGTGCCAAGCCCTGTGCTGAGG - Intergenic
1200164542 X:154027092-154027114 CTGTGTCCGGCCCAGTTTTGGGG - Intronic
1200329596 X:155282441-155282463 CTGTGTTGGGCCCAGTGTTTGGG - Intronic
1201785604 Y:17774602-17774624 TTGTGGCATGCCCAGTTCTGTGG - Intergenic
1201815949 Y:18131386-18131408 TTGTGGCATGCCCAGTTCTGTGG + Intergenic
1202583286 Y:26403278-26403300 CTGGGGCAGGGCCAGGGCTGGGG + Intergenic