ID: 976522063 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:86039808-86039830 |
| Sequence | AGGTTTCAGGCCTATCCATG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 976522056_976522063 | -10 | Left | 976522056 | 4:86039795-86039817 | CCCTTGTGTACCCAGGTTTCAGG | 0: 1 1: 1 2: 3 3: 21 4: 220 |
||
| Right | 976522063 | 4:86039808-86039830 | AGGTTTCAGGCCTATCCATGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 976522063 | Original CRISPR | AGGTTTCAGGCCTATCCATG GGG | Intronic | ||
| No off target data available for this crispr | |||||