ID: 976522063

View in Genome Browser
Species Human (GRCh38)
Location 4:86039808-86039830
Sequence AGGTTTCAGGCCTATCCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976522056_976522063 -10 Left 976522056 4:86039795-86039817 CCCTTGTGTACCCAGGTTTCAGG 0: 1
1: 1
2: 3
3: 21
4: 220
Right 976522063 4:86039808-86039830 AGGTTTCAGGCCTATCCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976522063 Original CRISPR AGGTTTCAGGCCTATCCATG GGG Intronic
No off target data available for this crispr