ID: 976526260

View in Genome Browser
Species Human (GRCh38)
Location 4:86093227-86093249
Sequence CTGGAAAATGTTTCCTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 1, 2: 2, 3: 38, 4: 303}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976526256_976526260 16 Left 976526256 4:86093188-86093210 CCACAATTAAATAATTTTGAGAC 0: 1
1: 0
2: 2
3: 46
4: 387
Right 976526260 4:86093227-86093249 CTGGAAAATGTTTCCTCTCTGGG 0: 1
1: 1
2: 2
3: 38
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976526260 Original CRISPR CTGGAAAATGTTTCCTCTCT GGG Intronic
901260856 1:7869514-7869536 CTTGAAAATGCTGCCTTTCTAGG + Intergenic
903688223 1:25148303-25148325 ATAGAAAATGGTCCCTCTCTTGG + Intergenic
906714120 1:47954334-47954356 CTGGAAACTGTCTCCTCAATGGG + Intronic
906771705 1:48490910-48490932 CTTGAAACTCTTTCCTCTATTGG - Intergenic
907194981 1:52679222-52679244 CTGGGAATAGTTTCCACTCTGGG + Intergenic
907886520 1:58597151-58597173 ATGGGAAATGTTCCCTCTCTGGG + Intergenic
909661611 1:78089803-78089825 CTGGAAAATGTTTTCTGTAAAGG + Intronic
911377728 1:97071777-97071799 GTGGAAAATGTTACAGCTCTGGG + Intergenic
911446595 1:98001397-98001419 GTGGAAAACGTTGCCTTTCTTGG - Intergenic
912494388 1:110082123-110082145 TTGGCAAAAGTTCCCTCTCTAGG - Intergenic
915170236 1:153972633-153972655 CTGGAGAGTGTTTCCTCACTGGG - Intronic
917549969 1:176016356-176016378 CTGGAAAAACTTTCCTCGCTTGG - Intronic
917704572 1:177619159-177619181 CTGTAAACTGTTTCTCCTCTTGG - Intergenic
918090639 1:181291145-181291167 ATGGAAGATGTTTTCCCTCTTGG - Intergenic
918138904 1:181703497-181703519 CTGGAATATGTTTCCTGTTTCGG - Intronic
919122476 1:193358426-193358448 CTGCAGAGAGTTTCCTCTCTTGG + Intergenic
920080352 1:203368549-203368571 CTGGAAGCTGTTTCTTCTCCTGG - Intergenic
920838238 1:209531968-209531990 CTCCAAAATGTTTCCTCTATGGG + Intergenic
921407995 1:214801862-214801884 CTGGAACATGTTTTCCCTCACGG + Intergenic
921801194 1:219404340-219404362 CTGGAAAAGGATTACTCTTTTGG - Intergenic
923046777 1:230361595-230361617 AGGGAATCTGTTTCCTCTCTTGG - Intronic
923274863 1:232387042-232387064 GGGGAAAATGTTTCTTCTGTGGG + Intergenic
923331173 1:232926246-232926268 CTGGGCAATGTTTGCTCTCCTGG + Intergenic
924294293 1:242569732-242569754 ATGTAAAATGTTTTCCCTCTTGG - Intergenic
1064457685 10:15503664-15503686 CTGGAAATAGTCTCATCTCTTGG - Intergenic
1064871367 10:19941170-19941192 CTTGAAAATGTCTATTCTCTGGG - Intronic
1065240978 10:23703810-23703832 CTAAAATATGTTTGCTCTCTGGG - Intronic
1065376293 10:25046455-25046477 ATGGAAAGTTTTTCATCTCTAGG - Intronic
1065831581 10:29619250-29619272 TTTGAAAATATTTCTTCTCTGGG - Intronic
1066046433 10:31599509-31599531 CTTGAAACTCTTTCTTCTCTTGG - Intergenic
1066060925 10:31722940-31722962 CTGGAAAATATTTTCCTTCTTGG + Intergenic
1066150288 10:32609044-32609066 CTGGAAAATGTTCCGTGTCCTGG + Intronic
1066289819 10:34003685-34003707 GCGGAAATTATTTCCTCTCTGGG + Intergenic
1066357736 10:34701457-34701479 CTGCAAAATGTGTCGCCTCTGGG - Intronic
1068412282 10:56671960-56671982 CAGGACAATGCTTCTTCTCTTGG - Intergenic
1069438862 10:68409719-68409741 CTGGAAAATGTTACCACGCTGGG + Intergenic
1070616232 10:77971446-77971468 CTGGAAAATGTTTGGACTCTGGG - Intronic
1070704311 10:78626674-78626696 CTGGAAAATGATTGGTCTTTTGG + Intergenic
1071146347 10:82577665-82577687 ATGCAAAGTGTTTCCTCTCAAGG + Intronic
1071533046 10:86403359-86403381 CTGGATCATGTGTCCACTCTTGG + Intergenic
1071862790 10:89691774-89691796 TTGCAAAATGTTTCCATTCTTGG + Intergenic
1073483552 10:103802372-103802394 CTGGAAAAACTTTTCTCTTTGGG + Intronic
1074104508 10:110378314-110378336 GTGGAGAATTTTGCCTCTCTGGG - Intergenic
1074322940 10:112420491-112420513 GTGGAAAATATTTACTATCTTGG + Intronic
1077891819 11:6423845-6423867 CTTGAAAGTCTTTCCTCTCTTGG - Intergenic
1079872011 11:25809516-25809538 CTGGAAAATTTTTCCATTTTTGG + Intergenic
1080593415 11:33744654-33744676 GTGGAAAATGTTTTCTCTCAAGG - Intronic
1081779462 11:45699909-45699931 CTGGAACATCTCTCATCTCTTGG - Intergenic
1082071671 11:47944318-47944340 CTGGACAGTGGTTCCTCCCTAGG + Intergenic
1083427944 11:62598712-62598734 AGGGAAAATATTTCCTATCTTGG + Intronic
1084049623 11:66591345-66591367 CTGTAAAGTGTTTGCTCTCTGGG + Exonic
1085382447 11:76132413-76132435 CTACAAAATGTTTCCTCTGAGGG - Intronic
1086037176 11:82430848-82430870 CTGGAGGATGTTTTCTCTCAAGG - Intergenic
1086817526 11:91391883-91391905 GGGGAAAATTTTTCTTCTCTTGG - Intergenic
1087949422 11:104202337-104202359 CTGGAACATGTTTCACCTCCAGG + Intergenic
1088158287 11:106836645-106836667 CAGTAAAAAGTTACCTCTCTTGG - Intronic
1089053091 11:115562949-115562971 CTTGAAATTCTTTCCTCCCTTGG - Intergenic
1089554085 11:119305454-119305476 CTTGAAAATGTTCATTCTCTGGG + Exonic
1089620767 11:119720967-119720989 AGGGGAAATGCTTCCTCTCTAGG + Intronic
1090570244 11:128037628-128037650 CTGGAAATGCTTTCCTCTCATGG - Intergenic
1090955943 11:131512888-131512910 CTGCAAAGTTTTTCCTCCCTTGG + Intronic
1091626655 12:2126092-2126114 CTGGAATACTTTTCATCTCTTGG - Intronic
1091890692 12:4051910-4051932 CTGGTAAAAGTTTCCCCTCTTGG - Intergenic
1092838389 12:12514516-12514538 CTTGAAAATGGTTCCTTTTTTGG + Intronic
1093632501 12:21425912-21425934 CTGGTTTATGTCTCCTCTCTTGG + Intergenic
1093827074 12:23705946-23705968 ATGTTAAATGTTCCCTCTCTAGG - Intronic
1093902313 12:24650043-24650065 CTGAAAAAAGTTTCCTTTCCAGG - Intergenic
1094720156 12:33055001-33055023 GTGGAAAATGTATCCTGGCTGGG + Intergenic
1095918782 12:47507939-47507961 CACGAAAATGTTCTCTCTCTCGG - Intergenic
1096407118 12:51351993-51352015 CTGGCCAATGTCTCCTCTGTAGG + Exonic
1096786458 12:54019597-54019619 CTGGAAAAGGTTTTCTTTCGGGG - Intronic
1097220629 12:57448759-57448781 CCTGAAAATCTTTTCTCTCTTGG - Intronic
1097687930 12:62708540-62708562 CAGGAAAATGTTTCCTTGGTGGG + Intronic
1098879951 12:75906966-75906988 ATGGAAAATGTTTGCTCTCGTGG - Intergenic
1098999137 12:77156946-77156968 CCTGAAACTCTTTCCTCTCTAGG + Intergenic
1099130745 12:78827347-78827369 CTGTAGACTGTTTACTCTCTTGG + Intergenic
1100542708 12:95573179-95573201 CCTGAAAATGATTCCTCTCTAGG + Intergenic
1100649020 12:96564405-96564427 TTAAAAAATATTTCCTCTCTTGG + Intronic
1101073296 12:101099123-101099145 CCACAAAATGCTTCCTCTCTTGG - Intronic
1102831353 12:116004095-116004117 CTGGTAATTGTTTCTGCTCTGGG - Intronic
1103098587 12:118152485-118152507 CTGGAAGAGGTTTCCTCATTTGG + Intronic
1103985141 12:124761984-124762006 CTGGAAAATGTTACACCTTTAGG + Intergenic
1104269977 12:127274374-127274396 CTAGCAGATGTCTCCTCTCTGGG + Intergenic
1105757879 13:23486276-23486298 CTCCAAAATGTGTCCTTTCTTGG - Intergenic
1105857616 13:24386600-24386622 CTGGCAAAGGCTTCCTCCCTGGG + Intergenic
1106019852 13:25904273-25904295 CTTGAAAAAGTATCATCTCTTGG - Intronic
1106903911 13:34385046-34385068 TCTCAAAATGTTTCCTCTCTTGG + Intergenic
1107191190 13:37588699-37588721 CTGGACAACTTTTGCTCTCTTGG - Intronic
1107948514 13:45441602-45441624 CTGAAAATTGTTTCTTGTCTCGG + Intergenic
1109305934 13:60641692-60641714 CTGGAACAAGTTTCTTTTCTTGG - Intergenic
1110312200 13:74063263-74063285 CTGGAAGAAGTCTCCTTTCTGGG + Intronic
1111626851 13:90798807-90798829 CCAGAAAATGTTTCTTGTCTTGG - Intergenic
1112968628 13:105230981-105231003 ATGGAAAATGTTTGCCCTCAAGG - Intergenic
1114240114 14:20859157-20859179 ATGGAGAATATTTCCTCTTTAGG - Intergenic
1115574569 14:34697962-34697984 CTAGAAAATCTTTTCTCTTTTGG + Intergenic
1116662795 14:47733522-47733544 AAGGAAAATGTTTCCACACTGGG - Intergenic
1117219768 14:53591409-53591431 GTGGGAAATGTTCTCTCTCTAGG + Intergenic
1117436027 14:55716077-55716099 CTGGAACATTTTTCCCCACTGGG + Intergenic
1117512497 14:56467382-56467404 ATGGAAAATGTTTCATGTGTTGG - Intergenic
1118621935 14:67621336-67621358 CTTCAAATTATTTCCTCTCTAGG + Intronic
1118702270 14:68445041-68445063 TTGGCAAATTTTTCCTCTCATGG + Intronic
1122461529 14:101899567-101899589 CTGGAAAAGGTATCATTTCTGGG - Intronic
1202857436 14_GL000225v1_random:59725-59747 CTGGAAAATGCGTCCTCCCCTGG + Intergenic
1202863975 14_GL000225v1_random:103918-103940 CCGGAAAATGCTTCCTCCCATGG - Intergenic
1202865479 14_GL000225v1_random:114433-114455 CCGGAAAATGTGTCCTCCCCTGG + Intergenic
1202867945 14_GL000225v1_random:135416-135438 CTGGAAAATGCGTCCTCCCCTGG - Intergenic
1123916202 15:25030533-25030555 TTAGAAAATGTTTTCTCTCTGGG + Intergenic
1125135292 15:36334174-36334196 CTGGAAACTGTTTTCCCTTTGGG + Intergenic
1125435029 15:39635415-39635437 CTGGAACATGTGTCCTCTTCAGG - Intronic
1126073806 15:44888756-44888778 CTGGAAAATTATACTTCTCTAGG + Intergenic
1130506774 15:84551524-84551546 CTGGAAAATGTTCTCTATATAGG - Intergenic
1131189983 15:90306855-90306877 ATGGAAACAGTTTCCTCTCTTGG + Intronic
1133478282 16:6144927-6144949 CTGGAAAATGAATTCCCTCTAGG + Intronic
1133499760 16:6354705-6354727 CTGGAACATTTCTCCTCCCTCGG + Intronic
1134658931 16:15969332-15969354 CTGATAATTGTTTCCTCTTTAGG + Intronic
1137956057 16:52830976-52830998 TTGTAAAATGTTTCTTTTCTAGG - Intergenic
1137997088 16:53229507-53229529 CTGGAAAAATTTACCTCTCTAGG + Intronic
1138953546 16:61943101-61943123 CTGGAAAATATTTTCTGTATTGG - Intronic
1139260584 16:65589814-65589836 CAGGATTTTGTTTCCTCTCTGGG + Intergenic
1140923544 16:79561628-79561650 GTGTAAAATGTTTCCTTTGTAGG - Intergenic
1141303479 16:82839252-82839274 CTGGAAATTGTTTCCTCCCCTGG + Intronic
1141501104 16:84444705-84444727 CTGGAACCTCTCTCCTCTCTAGG - Intronic
1141587473 16:85044402-85044424 GTTGACAATGTTTCCTTTCTTGG + Intronic
1144229511 17:13187052-13187074 CTTGAAAACATTTCCTCTCCTGG - Intergenic
1145352739 17:22100818-22100840 CTGGAAAAAGTTGGCTCTGTGGG - Intergenic
1146715229 17:35080469-35080491 TTGGAAAATCTTTCCAGTCTTGG - Intronic
1147545246 17:41396231-41396253 GTGAAAGATGTTTCCTGTCTGGG + Intronic
1148521054 17:48275322-48275344 CTTGAAATTATTTCCTCCCTGGG + Intronic
1148818672 17:50347626-50347648 CTGGAATATGTGACCACTCTGGG + Intronic
1149399810 17:56284452-56284474 GTGTAAAATGTTTCCTATCAGGG + Intronic
1149408324 17:56377823-56377845 CTCGAAAATGTTTCATCTTGTGG - Intronic
1150289881 17:63974954-63974976 CTGGAAGATGCTTCTTCTCTGGG + Intergenic
1152459125 17:80432144-80432166 CTGGAACCTGTTTCCTCACCGGG + Intronic
1153464829 18:5377847-5377869 CTGGAAACTGTTTTTTCTTTTGG + Intergenic
1155811909 18:30247806-30247828 CTGGAAAATTTGTTCTCTTTAGG - Intergenic
1156316456 18:35973117-35973139 CTTGAAATAGTTTCCTCCCTTGG + Intronic
1156650912 18:39226544-39226566 ATGGAATCTGTTTCCTCTCTGGG - Intergenic
1156798076 18:41073235-41073257 CTGCAAAGTCTCTCCTCTCTTGG - Intergenic
1158976149 18:62713551-62713573 CTTGAAAATGTTATCACTCTTGG + Intergenic
1159153351 18:64549723-64549745 CTGGAAAATGTTCCATGTTTTGG + Intergenic
1159855484 18:73582867-73582889 CTGGAAAAAGATTCCTGTATTGG + Intergenic
1163246013 19:16094836-16094858 CTGAAGAATGTGTCCTTTCTGGG - Intronic
1164227238 19:23256520-23256542 CAGGAAAATGTTACATCACTTGG + Intergenic
1164594478 19:29524818-29524840 CTGGAGAGTGTTTTCCCTCTGGG + Intergenic
1164798327 19:31054609-31054631 GTGGAAACTGTTCCCTCTGTAGG + Intergenic
1165808245 19:38595364-38595386 TTGGAAGATGTTTCCCCTCCAGG + Intronic
1166417417 19:42606439-42606461 CAGTAAAATCTTTCATCTCTTGG - Intronic
1167553536 19:50177830-50177852 GTTTAAAATATTTCCTCTCTGGG + Intergenic
925408748 2:3626698-3626720 CTGGATAATGTTTATTCTCAAGG + Intronic
925902454 2:8518198-8518220 CTGGGAAATGACTCCTCCCTCGG - Intergenic
926036357 2:9638807-9638829 CTGCAAAAGGTTTCTTCACTGGG - Intergenic
926220065 2:10929992-10930014 GTGGAAAAAGTTTACTTTCTAGG - Intergenic
927128459 2:20035716-20035738 CTGGAAGGTATTTCCTCTGTTGG - Intronic
929063104 2:37943343-37943365 CTGGAAATCTTGTCCTCTCTTGG - Intronic
930099900 2:47595492-47595514 ATGTAATCTGTTTCCTCTCTGGG - Intergenic
930248134 2:49005672-49005694 CTGGAATATGTTTCATCTCTGGG - Intronic
930266764 2:49209403-49209425 CTGGAAGCTGCTTGCTCTCTGGG + Intergenic
931055004 2:58459796-58459818 CTGGCAAATAATTTCTCTCTTGG + Intergenic
931637720 2:64355627-64355649 CAGAAAAATGTATCCACTCTAGG - Intergenic
931682415 2:64762427-64762449 ATGGAAAATGTGACCTCTCAGGG + Intergenic
932111867 2:69009246-69009268 GTGGCAAATATTTCTTCTCTAGG + Intergenic
933012227 2:77080895-77080917 CTGGAGAGTGTTTCCTGTCATGG - Intronic
933106189 2:78328507-78328529 TGGGAAAATGTTGCCTCTATAGG - Intergenic
935352133 2:102160472-102160494 CTGGAAGATGTTTCATATCTAGG + Intronic
935451845 2:103218707-103218729 ATAGAAAAGGTTTGCTCTCTGGG + Intergenic
939115849 2:138059538-138059560 CTGAAGATTGTTTCTTCTCTGGG + Intergenic
939615017 2:144352856-144352878 CTGGAAAGTGTTTTTTCTCTTGG + Intergenic
940455371 2:153891521-153891543 CTGGAAATTGTTTCCTTTGCAGG + Intronic
944225186 2:197342440-197342462 CTGGAAATTGTTTCCTTTTGTGG + Intergenic
944563557 2:200964907-200964929 CTGGAAAATTTTACCCCTCTTGG - Intergenic
944590912 2:201217263-201217285 CTGAAAAAAGTTTCTTCTCTGGG + Intronic
944863709 2:203840174-203840196 CTTGAAAATGTTACCTTACTTGG - Intergenic
944978032 2:205079919-205079941 CTGGAAAATGGTTGATTTCTGGG - Intronic
945100664 2:206259697-206259719 CAGGAAAATCTTTACTTTCTGGG + Intergenic
945657025 2:212636798-212636820 GTGGAAGATGATACCTCTCTTGG + Intergenic
946380596 2:219346166-219346188 CTAGAAATTCTCTCCTCTCTTGG - Intergenic
946828141 2:223700187-223700209 ATGTAAAATGTTTCATCTCAGGG + Intergenic
947861210 2:233359512-233359534 CAGGGAAATGATTCCTATCTGGG - Intronic
948030759 2:234815528-234815550 CGGGAAAATGTCTCTTCCCTGGG - Intergenic
1170121880 20:12921140-12921162 CTAGAACTTGTTTCTTCTCTCGG - Intergenic
1170672881 20:18451364-18451386 CTTGAAATTCTTTCATCTCTTGG + Intronic
1170929354 20:20754918-20754940 GGGGACAATGTTTCCTCCCTGGG - Intergenic
1174048181 20:47748505-47748527 CTGGGAAATGTTTCCTAGCTGGG - Intronic
1175134059 20:56809812-56809834 CTGGAACATGCTTCCATTCTTGG - Intergenic
1176981290 21:15384074-15384096 CTGAAAAACATTTCCTCTCTGGG + Intergenic
1176999110 21:15590058-15590080 CAAGAAAATGAATCCTCTCTTGG + Intergenic
1179290211 21:40011917-40011939 CTGGCAAATGTTTCCTGTAATGG + Exonic
1179818298 21:43922093-43922115 ATGGAAAAGGTTTCCTTTTTTGG + Intronic
1182760902 22:32721562-32721584 CTGGAACAAGTTAACTCTCTGGG - Intronic
1184529348 22:45044599-45044621 GTGGAAAACGTTTCCTGGCTTGG + Intergenic
1184788647 22:46685364-46685386 CTGGTAAATGTTTCCCGGCTGGG - Exonic
950346764 3:12302556-12302578 CTGGAAATTATTTTCTCTTTTGG - Intronic
950495917 3:13334574-13334596 CTAGAAACTGTTTCTTTTCTTGG + Intronic
951041767 3:17995792-17995814 CTAGAAAATGTGTCTTCTCTAGG + Intronic
953553773 3:43925612-43925634 TTGGAAAATGGTTCCCCTCATGG + Intergenic
953665260 3:44921421-44921443 CAGAAAAATGTTTCCTCTTGTGG - Intronic
954500114 3:51005560-51005582 CAGCAAAATGATTCCTTTCTTGG + Intronic
955595890 3:60590012-60590034 CTTGTAGATGTGTCCTCTCTTGG - Intronic
955756193 3:62227519-62227541 CTGGAAACCGTTTCCTCTCTTGG - Intronic
955840525 3:63108058-63108080 CTGAATAACGTTTCCTCACTAGG + Intergenic
955986301 3:64577111-64577133 CGGTAAAATATTTCCACTCTTGG - Intronic
956617244 3:71184612-71184634 TTGGAAAAGGGTTCCTCTTTTGG - Intronic
957172341 3:76754221-76754243 AAAGAAAATGTTTTCTCTCTAGG + Intronic
957849679 3:85791130-85791152 GTGCAAAATGTTTCCACTTTTGG - Intronic
958434497 3:94080605-94080627 CTGTCAGATTTTTCCTCTCTGGG - Intronic
962227200 3:133623430-133623452 CAGGAAGATGTTTACACTCTTGG + Exonic
962265325 3:133940399-133940421 CTAGAAAATCTCTCCTTTCTAGG - Intronic
962893445 3:139692954-139692976 CTGGTAAGCCTTTCCTCTCTGGG + Intergenic
963217335 3:142763098-142763120 CTGGAAAATGTTTCATGTGCTGG + Intronic
964669057 3:159205272-159205294 CTGTCCTATGTTTCCTCTCTTGG - Intronic
966568792 3:181416048-181416070 TTGTAAAATGTTTCGCCTCTAGG + Intergenic
967186975 3:186952389-186952411 CTTGAAATAGTTTCTTCTCTTGG + Intronic
968649052 4:1753235-1753257 CTGGAGAGTGTCTCCTCTCGCGG - Intergenic
970898802 4:21134620-21134642 CTTGAAATTCTTTCTTCTCTTGG + Intronic
971477249 4:27084023-27084045 CTGGGAGCTGTTTGCTCTCTTGG - Intergenic
971504877 4:27355674-27355696 CTGCAAAATGCTTCCTTTGTGGG + Intergenic
972813554 4:42618165-42618187 CTGGAAACTCTTCCCTCCCTAGG + Intronic
974064228 4:57062830-57062852 AGAGAAAATGTTTTCTCTCTGGG + Intronic
975176774 4:71298671-71298693 CTGGAAAATGTTTTATCAGTTGG + Intronic
975406186 4:73993255-73993277 CTGGAAAATATTTGTTCTGTGGG + Intergenic
975563570 4:75730040-75730062 CTGGAATGTGTTTTCTCTCTTGG + Intronic
976103743 4:81594009-81594031 CTGGAAAGTTGTTCCTCTCTTGG - Intronic
976526260 4:86093227-86093249 CTGGAAAATGTTTCCTCTCTGGG + Intronic
976959976 4:90958429-90958451 TTGGGTAAGGTTTCCTCTCTAGG + Intronic
977057272 4:92209077-92209099 CTGGAAAATGTTTACTCTCTAGG - Intergenic
978077106 4:104544870-104544892 CTTCAAAATGTCTCCTTTCTTGG + Intergenic
978324890 4:107541812-107541834 CTGGAAACTCTTTTTTCTCTTGG - Intergenic
978500706 4:109407280-109407302 CTACACAATGCTTCCTCTCTGGG - Intergenic
978534810 4:109749853-109749875 CTGGTAAATGTTTAACCTCTTGG - Intronic
979415769 4:120436534-120436556 TAGCAAAATGTTTCCTCTTTAGG + Intergenic
980159377 4:129140939-129140961 CTGGCAATTGTTTTCTTTCTTGG - Intergenic
980881775 4:138717993-138718015 GTGGAAAAGGCTCCCTCTCTGGG + Intergenic
980889064 4:138794825-138794847 CTGTAATATGTTGCCTCACTTGG - Intergenic
981559329 4:146029900-146029922 TTGGAAACAATTTCCTCTCTTGG - Intergenic
982212888 4:153055197-153055219 CTCGAAGTTGTTTCCTCTCTTGG - Intergenic
985036016 4:185840811-185840833 CTGGAAGATGTTCACTCACTAGG + Intronic
986313268 5:6570678-6570700 GTGGAAAACGTTTCCTGTTTGGG + Intergenic
987185809 5:15417811-15417833 TTTGAAATTCTTTCCTCTCTTGG + Intergenic
988119935 5:26948332-26948354 TAGAAAAATGTTTCATCTCTCGG - Intronic
988691453 5:33576703-33576725 CTGGAAACATTTTCCTCACTTGG + Exonic
989647795 5:43654892-43654914 AAGGAAAATGTTTGCTCTGTAGG + Intronic
989799181 5:45514702-45514724 ATTGAAAAGGTTTCCTCTGTAGG - Intronic
991497845 5:67244982-67245004 ATGGAAGATGTTTGCTTTCTAGG - Intergenic
992780063 5:80119643-80119665 CTGGAAAAGTCCTCCTCTCTGGG - Intronic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
995956415 5:117782298-117782320 CTGCAAAATATTTTCTCACTAGG - Intergenic
996024147 5:118624986-118625008 CAACAAAATGTTTTCTCTCTAGG - Intergenic
996338685 5:122412449-122412471 CTGGAAACGGTCACCTCTCTTGG + Intronic
996579270 5:125012714-125012736 CTGGAAAATATTTCCTTTTCTGG + Intergenic
997011175 5:129879853-129879875 CTGGAATATGGTTCCTGTCTGGG - Intergenic
997299465 5:132792044-132792066 CTTGAAATTATTTCCTCCCTTGG + Intronic
997586481 5:135046743-135046765 CTAGAATATGTCTGCTCTCTGGG + Intronic
998855921 5:146395102-146395124 TTGGAAAATAATTCCTCTCCTGG + Intergenic
999003469 5:147948833-147948855 CTGCAAAAAGTTTCAGCTCTGGG + Intergenic
999231163 5:150062843-150062865 CTGGAAAATTCTTCCTCTGATGG - Intronic
1000927229 5:167208838-167208860 ATGGAACATACTTCCTCTCTTGG + Intergenic
1001006364 5:168054172-168054194 TTAGAAAATGTTTCAGCTCTTGG - Intronic
1001410990 5:171511575-171511597 CTGGAAAATTTCTTCTTTCTTGG + Intergenic
1001998386 5:176180515-176180537 TTGGAGGATGTTTCCTCTCAAGG + Intergenic
1002285553 5:178160495-178160517 CAGAAAAATGTTTCCTCTGTTGG + Intergenic
1002607449 5:180391517-180391539 CTGGGAACTGATTCCCCTCTTGG + Intergenic
1002787042 6:409930-409952 CTGGAAAATGCTTCTTGGCTGGG + Exonic
1002894753 6:1370803-1370825 CTGGATAACATTTCCCCTCTTGG - Intergenic
1003003986 6:2363731-2363753 CTGAACAATGTTGCCTATCTTGG - Intergenic
1004773730 6:18818127-18818149 ATGGAAAATGCCTCCTCTCTTGG - Intergenic
1004854140 6:19732422-19732444 CTACATAATGTTACCTCTCTGGG - Intergenic
1006761729 6:36467690-36467712 CTGCAAACTGAATCCTCTCTTGG + Intronic
1007056081 6:38886282-38886304 CTTGGAAATGTTACCTCTCTTGG - Intronic
1008180249 6:48319379-48319401 CTGGAAAATTTTCCTTCTCATGG - Intergenic
1008313425 6:50007375-50007397 CTGAAAAGTTTTGCCTCTCTGGG + Intergenic
1008691902 6:53988426-53988448 GTGGTCAAGGTTTCCTCTCTTGG + Intronic
1009028724 6:58031365-58031387 CTGTCCAATCTTTCCTCTCTAGG + Intergenic
1009204256 6:60782752-60782774 CTGTCCAATCTTTCCTCTCTAGG + Intergenic
1009336681 6:62499107-62499129 ATGGAGAATGTATCATCTCTTGG + Intergenic
1010820538 6:80410528-80410550 CTGAAAAATGTTTTCTAACTTGG + Intergenic
1011163910 6:84424494-84424516 CTGGAAAATTTTTCTTCACTAGG - Intergenic
1011514651 6:88140271-88140293 CAAGAAAAGGTTTCCTTTCTTGG + Exonic
1011823090 6:91275279-91275301 CTGGATTATGGTTCCTCTCCAGG + Intergenic
1013581634 6:111540806-111540828 CTTCAAAATGTTTGCTCTTTAGG + Intergenic
1014799146 6:125758653-125758675 CTGAAACATCTTTACTCTCTTGG - Intronic
1015699582 6:136021347-136021369 CTGCAAAATATTTCCTAGCTGGG + Intronic
1016432089 6:143996481-143996503 TTGGAAAATGTTTTCATTCTGGG - Intronic
1017167365 6:151421981-151422003 CTTCAAATTGTTTCCTCTGTTGG - Intronic
1017752545 6:157501873-157501895 CTGAAATATTTTTCCTCTTTAGG - Intronic
1017815365 6:158012317-158012339 CAGGATAATGTCTCCTCTCAAGG - Intronic
1017975558 6:159353794-159353816 CTGCAAACTATTTCCCCTCTAGG - Intergenic
1018559676 6:165088806-165088828 CTTGAAACTATTTCCTCCCTTGG + Intergenic
1020621308 7:10522898-10522920 ATGGAAGATGTTTCTTCACTTGG + Intergenic
1022325327 7:29325741-29325763 CTGAAAAATGTTTCCTTCCCAGG + Intronic
1022760096 7:33339584-33339606 GTGGGGAATGTTTCCTCTCAGGG + Intronic
1026802890 7:73411025-73411047 CTGGAGAATGTTCCCGCCCTCGG + Intergenic
1027908112 7:84212617-84212639 CTAGAAAGTGTTTCCTCTGTTGG + Intronic
1028409209 7:90509623-90509645 TTGTAAACTGTTTCCTCACTAGG - Intronic
1029192087 7:98779105-98779127 CTGGATCATGTGTCCCCTCTGGG - Intergenic
1032272776 7:130426119-130426141 TTGCAAAATGTTACCTCTATGGG + Intronic
1032577110 7:133066777-133066799 AGAGAAAATGTTTTCTCTCTTGG - Intronic
1034917798 7:155055535-155055557 CTGACAGTTGTTTCCTCTCTGGG - Intergenic
1036455044 8:8899078-8899100 TTGGAAACTTTTTCCTTTCTTGG + Intergenic
1037249683 8:16877698-16877720 CTGTAAAATGCTTCCTATGTTGG - Intergenic
1037699355 8:21260422-21260444 CTGGAAAATCTTTGCACCCTGGG + Intergenic
1037914712 8:22765973-22765995 CTGTGACATGTTTCCTCGCTTGG - Intronic
1038141468 8:24849916-24849938 CTGGGGACTGTTTTCTCTCTGGG + Intergenic
1038886823 8:31672095-31672117 GTGAGAAATGTTTCCTATCTAGG + Intronic
1038909731 8:31949537-31949559 CTGGAAACAGTATCTTCTCTTGG + Intronic
1039152465 8:34522017-34522039 CTGGAGCATGTTTCCTATCCTGG + Intergenic
1039222107 8:35343570-35343592 CTGGGAAATGTTTCCCCATTTGG + Intronic
1040707201 8:50143435-50143457 CTAGAAAATATTTCCTAACTAGG + Intronic
1042718959 8:71806538-71806560 CAGGAAAATGATTCCTCTTGGGG - Intergenic
1044039342 8:87346973-87346995 CTGGAGATATTTTCCTCTCTTGG - Intronic
1044057533 8:87589782-87589804 ATGGATAATTTTTCCTCTCAGGG - Intronic
1044563176 8:93633725-93633747 CTCTAAAACGTTTCCTCTTTGGG - Intergenic
1045807128 8:106176054-106176076 CTGGAAAACATTTTCTTTCTAGG - Intergenic
1046515217 8:115250712-115250734 CCAAAAAATGTTTCCTCTATTGG - Intergenic
1046964847 8:120152578-120152600 ATGAAAAATGTTCCCTCTCCAGG + Intronic
1048173054 8:132126846-132126868 CTGGAAAATGCATCATCTATTGG + Exonic
1050698999 9:8315693-8315715 CTTGCAAATGTTTGGTCTCTTGG + Exonic
1051247163 9:15123615-15123637 CTGGAAACTATATTCTCTCTAGG + Intergenic
1052975730 9:34408571-34408593 TTGGAAAAGGCTTCCTCCCTTGG + Intronic
1055136437 9:72834558-72834580 CAGGCAAATCTTTACTCTCTGGG - Intronic
1055573876 9:77643829-77643851 ATGGAAAATGACACCTCTCTAGG + Intronic
1055798664 9:80005771-80005793 CTGGAAGATGTTTTCACTGTGGG + Intergenic
1057924622 9:99133612-99133634 TTAGAACATGTTTCCTCTTTGGG + Intronic
1059127496 9:111705799-111705821 CTGTAAAATGTTTTCCCTATGGG - Intronic
1059981603 9:119778467-119778489 CTGAAAAATGTTTCAGATCTTGG - Intergenic
1060779236 9:126399512-126399534 CAGGAAGGTGTTTCCTCTCTTGG - Intronic
1060929567 9:127480213-127480235 CGGGCAAATGTTTCCCCACTGGG + Intronic
1061846429 9:133391058-133391080 CCAGAAAATGTTGCCTCTCATGG + Intronic
1186943919 X:14543400-14543422 CTAGATAATGTTTCCTTTCTTGG + Intronic
1187157969 X:16738743-16738765 CTGGAAACTCTCCCCTCTCTGGG - Intronic
1188406864 X:29821870-29821892 CTGGACAAACTTTCGTCTCTTGG + Intronic
1189166100 X:38862659-38862681 CTGGAAATGTTTTCTTCTCTTGG - Intergenic
1189766907 X:44381314-44381336 CTGGAAAATGCTACCTCTCAGGG + Intergenic
1190502815 X:51096415-51096437 TTGGAAAATGCTTCCTTTATGGG + Intergenic
1192130870 X:68548695-68548717 CTGGGAAATGTGTACTCGCTTGG + Intergenic
1192416142 X:70982432-70982454 TTTGAAAATTTCTCCTCTCTTGG + Intergenic
1193391627 X:80936189-80936211 ATGCAAAATCTTTCCTATCTAGG - Intergenic
1195772612 X:108367779-108367801 CTGATAATTGTTTCCTTTCTTGG - Intronic
1197161640 X:123329862-123329884 TTTGAAAAGGTTGCCTCTCTGGG + Intronic
1197251060 X:124216923-124216945 CTGGGAACTCTTTCCTCTCCTGG + Intronic
1197780246 X:130152064-130152086 TTGGAAAAGCTTTCCCCTCTAGG - Intronic
1199403117 X:147423931-147423953 CTTGAAATAGTTCCCTCTCTTGG - Intergenic
1199975173 X:152890721-152890743 CTGGAAAAACTTGCTTCTCTTGG - Intergenic
1201176128 Y:11309169-11309191 TAGAAAAATGTTTCCTCCCTCGG + Intergenic
1201332801 Y:12845611-12845633 CTAGAAAAAGTTTCCATTCTAGG - Intronic
1201705131 Y:16928437-16928459 CTGACAAATTTCTCCTCTCTGGG + Intergenic