ID: 976526398

View in Genome Browser
Species Human (GRCh38)
Location 4:86096043-86096065
Sequence TCATTATCACATATGGCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976526398 Original CRISPR TCATTATCACATATGGCACT AGG Intronic
906967407 1:50472049-50472071 TGATTATCACTCATGCCACTTGG - Intronic
907798405 1:57740255-57740277 AAATAATCTCATATGGCACTAGG + Intronic
912479802 1:109973916-109973938 TCATTTTCAGATATGGAACAAGG + Intergenic
913125517 1:115784093-115784115 TCATTGTCTCATAGGTCACTGGG - Intergenic
921088585 1:211820162-211820184 TCTTTTTCACATATGACACCTGG - Intronic
924866240 1:247984541-247984563 TTATTTTCACATATGTCATTTGG - Intronic
1064273819 10:13888844-13888866 TCATTTTGACATATTGAACTAGG + Intronic
1064571696 10:16700064-16700086 TCATTTTCACTTATGGAAATTGG + Intronic
1068949623 10:62764075-62764097 TCATTATCACCTCTGCCATTGGG - Intergenic
1069100604 10:64315844-64315866 TCACTGTGACATATGGCACATGG - Intergenic
1069100717 10:64317062-64317084 TCATTGTGACATATGGCACATGG - Intergenic
1069665265 10:70151062-70151084 CCAATTTCACATGTGGCACTAGG + Exonic
1072322296 10:94262596-94262618 GCATTGTGACAAATGGCACTGGG + Exonic
1074673065 10:115817435-115817457 TAAGTATAAAATATGGCACTAGG + Intronic
1075593610 10:123710669-123710691 TCATTTTCCCATAAGCCACTGGG - Intronic
1075793205 10:125100338-125100360 TCAATATCACACAAGTCACTTGG + Intronic
1075897132 10:126006442-126006464 TCACTACCACACATGGCACGTGG - Intronic
1077290990 11:1792870-1792892 TCATAATAAAAGATGGCACTTGG - Intergenic
1077487260 11:2844739-2844761 CCATTAGCACATGTGGGACTTGG + Intronic
1081026689 11:38023502-38023524 CCATTAACTGATATGGCACTTGG - Intergenic
1081844214 11:46227367-46227389 TCCTTATCAGATATAGGACTTGG - Intergenic
1082729117 11:56773475-56773497 TCACTATCACATGTAGCACCAGG + Intergenic
1083313031 11:61795404-61795426 TCATTCTCCCGGATGGCACTGGG - Exonic
1088608801 11:111557254-111557276 TCATTATCACTTAGGGTAATAGG + Intronic
1089812923 11:121146378-121146400 AGAGTATCACACATGGCACTTGG + Intronic
1090536777 11:127651192-127651214 TCACTCTCACATCTGGCAGTGGG - Intergenic
1092043738 12:5409505-5409527 TCCTGCTCACATATGGCTCTTGG + Intergenic
1093739396 12:22665237-22665259 TCAGAATCACCTATGGTACTTGG + Intronic
1093829140 12:23734264-23734286 TCTTTATCACACATGGCTCTCGG + Intronic
1095772989 12:45982964-45982986 TATTTCTCACATTTGGCACTTGG - Intronic
1097507182 12:60488731-60488753 TCATTTTCCCATAGGGCAATTGG - Intergenic
1097548432 12:61035160-61035182 TCATTATCACCTATATTACTTGG + Intergenic
1102419230 12:112791005-112791027 TCATTTTCACAGATGGGACTTGG + Intronic
1103075978 12:117982992-117983014 TCATTATCACATACAGCATTTGG + Intergenic
1104533556 12:129595854-129595876 TCTCTAGCTCATATGGCACTGGG - Intronic
1105514860 13:21080067-21080089 GCATTATCACAAATGCCAGTGGG + Intergenic
1108196279 13:47999099-47999121 TCACTAGCACATAAGTCACTAGG + Intronic
1109339465 13:61036869-61036891 TCAATCTCACATATGTCATTAGG - Intergenic
1109359950 13:61282765-61282787 TCATGATTAAACATGGCACTCGG - Intergenic
1110456241 13:75693474-75693496 TAATTATTTCATGTGGCACTGGG + Intronic
1115596582 14:34915681-34915703 TTATTATCACATTTGGCAAAGGG - Intergenic
1120147750 14:80997973-80997995 TCATTCTCTCATTTGGGACTTGG + Intronic
1121631709 14:95425964-95425986 TTCTTATCACATTTGGCCCTGGG - Intronic
1123452987 15:20384906-20384928 TCAGTATGATATATGGCAGTTGG - Intergenic
1127336197 15:57987178-57987200 TCATTATCCCATGGGTCACTGGG - Intronic
1127365112 15:58282264-58282286 TCATTAGCACATCTGGCAGTTGG + Intronic
1128796986 15:70473318-70473340 TCTTTCTAACAGATGGCACTTGG - Intergenic
1132193560 15:99891497-99891519 TCATCAGCAGAGATGGCACTCGG - Intergenic
1133469504 16:6060910-6060932 TCTTTCCCACATATGGCACATGG + Intronic
1135044935 16:19147428-19147450 TCATTTCAACATGTGGCACTAGG - Intronic
1135897178 16:26418281-26418303 TCATTATGACATATCCCTCTAGG - Intergenic
1135897188 16:26418344-26418366 TCATTATGACATATCCCTCTAGG - Intergenic
1138852856 16:60651016-60651038 TCATTATTACAAATTCCACTGGG - Intergenic
1141818772 16:86431043-86431065 TCAGTATCACAGAGGGCTCTTGG - Intergenic
1146109757 17:30078050-30078072 TCATTGTAACATATTCCACTGGG + Intronic
1147468076 17:40627480-40627502 TCATTGTCACATATGGAAGTTGG - Exonic
1148656631 17:49288776-49288798 TAATTATAAAATATGGTACTTGG - Intergenic
1149793371 17:59498586-59498608 TCATTATGGCATAAGGCCCTGGG - Intergenic
1149900919 17:60477472-60477494 ACATTATCCCATATGGGATTTGG - Intronic
1150065517 17:62105664-62105686 TCTTTATCATAAAGGGCACTGGG - Intergenic
1150838785 17:68588873-68588895 TCACTTTAACATATGGCACGGGG + Intronic
1164589579 19:29499283-29499305 TCATCATCACATTTGGCAGCAGG + Intergenic
1164885267 19:31773332-31773354 ACAGTATCCCATATGGAACTGGG - Intergenic
928128302 2:28630941-28630963 TAATTATTACACATGGCTCTGGG - Intronic
929219083 2:39444943-39444965 CCATTACCACATATCACACTGGG - Intergenic
932076358 2:68667704-68667726 TTATTATCAAATATGGCTCCTGG - Intergenic
932839930 2:75072584-75072606 TCACAATCAGATATGGCACCTGG + Intronic
933358808 2:81250613-81250635 TCATTACATCGTATGGCACTGGG - Intergenic
938916947 2:135951277-135951299 TCATCTTCCCATATGGCACTTGG - Intronic
939408076 2:141785750-141785772 TGATTATCATATATGGACCTTGG - Intronic
940137308 2:150452511-150452533 TCTTTTCAACATATGGCACTAGG - Intergenic
941326296 2:164119537-164119559 TCAGTATCATATTTGGCAGTTGG + Intergenic
947085323 2:226444847-226444869 TCCTTATCACATTTAGTACTCGG - Intergenic
948033598 2:234839915-234839937 TCATTATCGCACATGGCCCTTGG + Intergenic
1169833172 20:9847803-9847825 TCTTTTTAACAAATGGCACTGGG + Intergenic
1173639677 20:44592086-44592108 TGCTTATCACATCTGGCACATGG - Intronic
1173929745 20:46808624-46808646 TAATTATCAGATCTGCCACTAGG - Intergenic
1177498804 21:21923768-21923790 TCTTTATAACATTTAGCACTTGG + Intergenic
1177618323 21:23555104-23555126 TCCTTATCAAATAGGTCACTTGG - Intergenic
1181260346 22:21592755-21592777 TCATTAGCATTTTTGGCACTTGG + Intronic
1182797449 22:33001101-33001123 TCATTAACTCATCTGGCAGTTGG - Intronic
949778661 3:7660945-7660967 TGATTTTTATATATGGCACTAGG - Intronic
951539644 3:23770004-23770026 ACATTATCTCATATGGTTCTGGG + Intergenic
953116806 3:40000761-40000783 TCATTCTGACAGATGGCCCTGGG + Intronic
955620545 3:60858653-60858675 TAACTATCACATATGACACAAGG + Intronic
956886778 3:73568237-73568259 TCATTATCATATCTAGCTCTGGG - Intronic
957277312 3:78107486-78107508 TCCTCATCACATAAGGCACTTGG + Intergenic
958538980 3:95444981-95445003 TAAATATCACCTATGTCACTGGG - Intergenic
958646734 3:96883952-96883974 CCATTTTCACAAATGGTACTGGG - Intronic
959813000 3:110641415-110641437 TCATAATCATAGATGGCACCTGG - Intergenic
963231453 3:142912134-142912156 ACATCCTCACATATTGCACTGGG - Intergenic
965519604 3:169659510-169659532 TCTTTATTGCATTTGGCACTTGG - Intronic
966690141 3:182733084-182733106 TCATTCTCAAATATTTCACTTGG + Intergenic
970868988 4:20792453-20792475 TAATTATCTCATATGCCAATGGG + Intronic
971118984 4:23682365-23682387 TAATTATCACAAAGAGCACTAGG - Intergenic
972428121 4:38954231-38954253 TCATTAGCACAAATGAAACTGGG + Intergenic
974756359 4:66213531-66213553 ACATTATCTCACATGTCACTTGG - Intergenic
975426002 4:74228547-74228569 TTATTATGACAAATGGCACATGG + Intronic
976347090 4:84016602-84016624 TCATTATCAAATATGGTAGCAGG - Intergenic
976526398 4:86096043-86096065 TCATTATCACATATGGCACTAGG + Intronic
976913586 4:90340841-90340863 TCATTTTGACAAATGCCACTGGG - Intronic
981585357 4:146295625-146295647 CCATGATCAGATATGTCACTAGG + Intronic
983542422 4:168926835-168926857 TCATCCTTACATATTGCACTTGG - Intronic
988780266 5:34514601-34514623 TTATTATGACATATGGCAATGGG - Intergenic
990639643 5:57767958-57767980 TCATTATTTTATATGTCACTTGG + Intergenic
990848283 5:60170258-60170280 TCATTATCACCTATATTACTTGG + Intronic
992142228 5:73810270-73810292 TTATTTTCACATATGTCAGTTGG + Intronic
993556441 5:89345432-89345454 TTATTACCAAATAAGGCACTGGG - Intergenic
994116670 5:96068899-96068921 ACATTTTTACATATGGCTCTTGG + Intergenic
994714240 5:103302772-103302794 TCATTATCTTATATGGCAAAAGG + Intergenic
994751469 5:103742637-103742659 TTATTTTGACAAATGGCACTGGG + Intergenic
994935028 5:106243302-106243324 TCATCATCACAAATGGGAGTGGG - Intergenic
995217457 5:109612037-109612059 TCATTATCACAGCTAGCTCTGGG + Intergenic
995664790 5:114529564-114529586 TAATTATTATATATGGCATTAGG - Intergenic
997884498 5:137617912-137617934 TCATAACCAAACATGGCACTAGG + Exonic
999793980 5:154970461-154970483 TTATTTTCACATATGGCCCAAGG + Intergenic
1000509351 5:162163103-162163125 TCATTATCTCATCTTGCTCTTGG - Intergenic
1001057072 5:168458465-168458487 TCATCTTCACCTATGTCACTTGG + Intronic
1009403424 6:63283361-63283383 TCCTTATCACAAATGAAACTTGG + Intronic
1014835707 6:126158032-126158054 TAATTATTACATATGGCAGAAGG - Intergenic
1015155260 6:130087511-130087533 TAATTATCACATATGGCTGGTGG + Intronic
1015496966 6:133892057-133892079 TTATAATTACATATTGCACTTGG - Exonic
1015528373 6:134195449-134195471 ACATTCACACATTTGGCACTAGG + Intronic
1017106867 6:150896281-150896303 TCATTAACAAGTATGGCTCTGGG - Intronic
1023245581 7:38199831-38199853 CCAATATCACATGTGGCTCTTGG - Intronic
1024086088 7:45892744-45892766 TCATTATTGCACATGCCACTCGG + Intronic
1026429199 7:70326874-70326896 ACATAATCACAGGTGGCACTTGG + Intronic
1027377742 7:77570506-77570528 TTCTTACCACATATGGCAGTAGG - Intronic
1027988575 7:85328273-85328295 CCAATATGACATATGGCACTTGG + Intergenic
1028523472 7:91757959-91757981 CCAATATAACAAATGGCACTGGG + Intronic
1028799947 7:94951336-94951358 TTATTATTATATATGGCATTTGG + Intronic
1031013665 7:116549443-116549465 TGATTATCACTTAGGTCACTTGG - Intronic
1032590376 7:133186742-133186764 TATTTAACCCATATGGCACTTGG - Intergenic
1038489964 8:27963827-27963849 CCATATTCAGATATGGCACTGGG + Intronic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1041188667 8:55329701-55329723 GCCTTATAACATATGGAACTTGG - Intronic
1042597714 8:70467378-70467400 TCATTCTCTCATATTGCTCTGGG + Intergenic
1043337931 8:79200163-79200185 TAATTCTGACATAAGGCACTTGG - Intergenic
1045806931 8:106173428-106173450 TTATTATTACATAGGTCACTAGG - Intergenic
1046683657 8:117200092-117200114 TCATTACCACATATGCCAGTGGG + Intergenic
1046807254 8:118493259-118493281 AATTTAGCACATATGGCACTTGG - Intronic
1050513178 9:6415182-6415204 TAATTATCACATATGGGATTGGG + Intronic
1056596197 9:88009720-88009742 TAATTTTTGCATATGGCACTGGG - Intergenic
1061830117 9:133286313-133286335 TCGTAATCACATAGGGCACTAGG - Intergenic
1188639275 X:32478793-32478815 CCATTCTCACAAAGGGCACTTGG + Intronic
1188980033 X:36719316-36719338 TATTTATCACATATGGAAATTGG + Intergenic
1192222891 X:69209418-69209440 GCATTATCCCCTATGTCACTTGG - Intergenic
1192625407 X:72722048-72722070 TCATTGTCACAAATGGCAGGGGG - Intergenic
1192972672 X:76250525-76250547 CCATTAACATATATGGCTCTTGG + Intergenic
1193976365 X:88124396-88124418 TAAATTTCACAAATGGCACTTGG + Intergenic
1194250187 X:91564727-91564749 TCATAAGCACAGATGGCACTTGG - Intergenic
1195038770 X:100994405-100994427 TCATTCACTCATATGGCTCTGGG + Intergenic
1199444564 X:147907151-147907173 TCCTAATGACATATGGCATTGGG - Intergenic
1200569149 Y:4805976-4805998 TCATAAGCACAGATGGCACTTGG - Intergenic