ID: 976538519

View in Genome Browser
Species Human (GRCh38)
Location 4:86245689-86245711
Sequence TTGTGGGTCTACCACTCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976538514_976538519 25 Left 976538514 4:86245641-86245663 CCAATTCTTAATAAGGAGAACAT 0: 1
1: 0
2: 0
3: 17
4: 205
Right 976538519 4:86245689-86245711 TTGTGGGTCTACCACTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976538519 Original CRISPR TTGTGGGTCTACCACTCAAG AGG Intronic
No off target data available for this crispr