ID: 976539518

View in Genome Browser
Species Human (GRCh38)
Location 4:86257282-86257304
Sequence GTACCAGCTTAGGTTAGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976539512_976539518 20 Left 976539512 4:86257239-86257261 CCAAACAGAATAGTTGAAAGAAG 0: 1
1: 0
2: 1
3: 38
4: 386
Right 976539518 4:86257282-86257304 GTACCAGCTTAGGTTAGGTTGGG 0: 1
1: 0
2: 0
3: 4
4: 80
976539514_976539518 -10 Left 976539514 4:86257269-86257291 CCATTTAATTAAGGTACCAGCTT 0: 1
1: 0
2: 0
3: 7
4: 132
Right 976539518 4:86257282-86257304 GTACCAGCTTAGGTTAGGTTGGG 0: 1
1: 0
2: 0
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976539518 Original CRISPR GTACCAGCTTAGGTTAGGTT GGG Intronic
903098040 1:20999183-20999205 CTACAAGCTTGGGTTATGTTAGG + Intronic
905145787 1:35885961-35885983 ATTCAAGGTTAGGTTAGGTTAGG - Intronic
906958125 1:50393802-50393824 ATAACAGCTTAGTTTTGGTTTGG - Intergenic
910373301 1:86541555-86541577 GTGCCAACTTACGTGAGGTTGGG - Intergenic
911906636 1:103577402-103577424 GTAACAGGATAGGTTGGGTTTGG + Intronic
911913240 1:103662569-103662591 GTAACAGGATAGGTTGGGTTTGG + Intronic
911915214 1:103689378-103689400 GTAACAGGATAGGTTGGGTTTGG - Intronic
911920653 1:103756707-103756729 GTAACAGGATAGGTTGGGTTTGG + Intronic
911986727 1:104636041-104636063 GTAACAGCTTTGTTTAGTTTTGG + Intergenic
919694921 1:200564507-200564529 GTATCAGATAAGATTAGGTTTGG - Intronic
1064066272 10:12184601-12184623 TTATCAGCTTAAATTAGGTTTGG + Intronic
1069416475 10:68205167-68205189 GCACCAGCATATGTGAGGTTAGG - Intronic
1073033826 10:100549194-100549216 GTAAAAGCTTAGGATAGGTCAGG - Exonic
1077919992 11:6634441-6634463 GTACAGGCTGAGGTTGGGTTTGG - Intronic
1082633773 11:55571847-55571869 GTACAAGCCTTGGTTAGCTTTGG - Intergenic
1085665846 11:78415598-78415620 GTAACAGCTTTTCTTAGGTTAGG - Intronic
1088822770 11:113470636-113470658 GTATCAGCTTAGTGTAGTTTGGG - Intronic
1093615893 12:21224049-21224071 GAAGCAGCTTAGGCTAAGTTAGG - Intronic
1116968761 14:51042788-51042810 GTACCAGAGTAGGTTAGTCTTGG - Intronic
1118394828 14:65327209-65327231 GCCCAAGGTTAGGTTAGGTTAGG - Intergenic
1120339868 14:83205414-83205436 GTAGCACCTTTGGTTTGGTTAGG - Intergenic
1121760950 14:96444534-96444556 GTAACAGCTTAGTTTCAGTTTGG - Intronic
1127747228 15:61990996-61991018 TTACCTGCTTAGGTAAAGTTAGG + Exonic
1130449725 15:84038945-84038967 GGACCAGGTTAGGTCAGGGTTGG + Exonic
1133617529 16:7492173-7492195 ATGCCTGCTTAGGTTATGTTGGG - Intronic
1146642953 17:34555020-34555042 GGACCAGCCTTGGCTAGGTTGGG - Intergenic
1148211023 17:45808619-45808641 GTACTAGGTTTGGTTTGGTTTGG + Intronic
1156497761 18:37537229-37537251 GAACCAGCCTATGTTTGGTTTGG - Intronic
1159074641 18:63666506-63666528 GGACCAGGTTAGATTTGGTTTGG - Intronic
1162964152 19:14148187-14148209 GCACCAGGTCTGGTTAGGTTGGG + Exonic
928679597 2:33687145-33687167 GTCTTAGGTTAGGTTAGGTTAGG + Intergenic
928716708 2:34069929-34069951 GTATCAATTTAGGTTTGGTTAGG + Intergenic
933888853 2:86746367-86746389 GATTCAGCTTTGGTTAGGTTTGG + Intronic
943025772 2:182625550-182625572 GTACCAATTTATGCTAGGTTAGG + Intergenic
944151430 2:196562751-196562773 GTACCAGCTTTGGCCAGGGTTGG + Intronic
945636222 2:212354810-212354832 TTACCAACTTAAGTTGGGTTTGG + Intronic
946060677 2:216938536-216938558 GTATCAGCTTGGGTAAGTTTTGG - Intergenic
1172350796 20:34238962-34238984 GTACAAGTTTTGGTTAGGTAAGG + Intronic
1174993299 20:55537327-55537349 GTACCTGTTTTGGTTAAGTTTGG + Intergenic
1177060240 21:16363816-16363838 GGACCAGCTTACGTTATTTTTGG + Intergenic
1179302841 21:40128047-40128069 TCACCAGCTTAGGTCAGGTCAGG + Intronic
956739013 3:72260391-72260413 GAACCAGCTTCAGTTAGTTTTGG + Intergenic
956746104 3:72312002-72312024 GTACCAGCCCAGGTAATGTTGGG - Intergenic
957746929 3:84356709-84356731 TTACTAGCTTAGGTTTGGTCTGG + Intergenic
962009677 3:131381436-131381458 GAACTAGCTTTGGTTGGGTTCGG - Intergenic
962768536 3:138591067-138591089 GTACCAGCTTTATTTTGGTTAGG - Intronic
967283223 3:187842740-187842762 ATAACAACTTAGCTTAGGTTTGG + Intergenic
970974759 4:22030702-22030724 GTCCCAGTTTAGGTAAGCTTGGG + Intergenic
972497996 4:39651872-39651894 ATAACAACTTAGTTTAGGTTTGG - Intergenic
974706369 4:65521692-65521714 GGACCAGAGTAGTTTAGGTTTGG - Intronic
975888859 4:79000291-79000313 GTACCAACTTACTTTTGGTTTGG + Intergenic
976539518 4:86257282-86257304 GTACCAGCTTAGGTTAGGTTGGG + Intronic
979013730 4:115404266-115404288 ATATTAGCTTAGATTAGGTTTGG + Intergenic
980863658 4:138529306-138529328 GTACCAGCTTAGGGCAAGTGAGG - Intergenic
981913687 4:150010864-150010886 GCACCAGACTAGGTTAGCTTGGG - Intergenic
982814181 4:159865153-159865175 TTACCAGATTTGGTTAGGTTAGG + Intergenic
986600901 5:9471508-9471530 GTACCAGCATAAGTAAGGATAGG + Intronic
986699195 5:10389041-10389063 ATACCAGTTTAGTTTAAGTTTGG + Intronic
989635143 5:43523979-43524001 GTGCCATCTTTGGTAAGGTTTGG + Intergenic
991135508 5:63177273-63177295 GTGCCACCTTAGTTTAGGTCAGG - Intergenic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
994386269 5:99136759-99136781 TTACCAGTTTAGGTTAGTTATGG - Intergenic
995153809 5:108885274-108885296 GAACCAGGTTAGGTTGAGTTTGG - Intronic
996360453 5:122639367-122639389 CAAACAGCTTAGGTTTGGTTTGG + Intergenic
998539524 5:142967381-142967403 GTGCTAGGTTAGGTTAGGGTGGG - Intronic
999706878 5:154281636-154281658 GGAACAGCTTAGCTTAGGTTAGG - Intronic
1000501741 5:162060448-162060470 ATAACAACTTAGTTTAGGTTTGG - Intergenic
1002157309 5:177293243-177293265 GTAAAAGCTTAGGTCAGCTTTGG + Intronic
1005793115 6:29327824-29327846 GTACCAGCTTTGGTGATGTTAGG - Intergenic
1013989424 6:116236473-116236495 GTACCAGCTTGGGGTGGGTGGGG - Intronic
1015538194 6:134287978-134288000 GTCACATCTTAGGTTAGGTAAGG - Intronic
1020570400 7:9852663-9852685 CTACCAGTTTAGGTGAGTTTAGG + Intergenic
1024440472 7:49410348-49410370 GTAACATCTTAGTTTTGGTTTGG + Intergenic
1028747784 7:94347336-94347358 GTACCAGCTGATGTTGGGTTGGG + Intergenic
1030677622 7:112400561-112400583 ATTCCAGCCTAGGGTAGGTTGGG + Intergenic
1036166638 8:6440804-6440826 GTATCAGTTAAGGTTAGTTTCGG + Intronic
1039119114 8:34126079-34126101 CTTCCAACTTAGTTTAGGTTCGG + Intergenic
1048170918 8:132105394-132105416 GTACTAGGTTAGGAGAGGTTAGG + Intronic
1185878354 X:3718158-3718180 GTACCATCATGGGTTAGTTTTGG + Intergenic
1190772802 X:53528970-53528992 GTAATAACTTAGTTTAGGTTTGG + Intergenic
1195840481 X:109171231-109171253 ATAACAACTTAGTTTAGGTTTGG + Intergenic
1199286132 X:146056571-146056593 GTACTAGCTTGGGTAAGGTGTGG + Intergenic
1199934132 X:152554406-152554428 GTTCCAGTTCAAGTTAGGTTTGG - Intergenic
1202336145 Y:23812966-23812988 GTAACAGCTAGGTTTAGGTTTGG + Intergenic
1202534621 Y:25857101-25857123 GTAACAGCTAGGTTTAGGTTTGG - Intergenic