ID: 976540443

View in Genome Browser
Species Human (GRCh38)
Location 4:86268289-86268311
Sequence CAGTAAAGATGGTGAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 0, 2: 7, 3: 52, 4: 495}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976540443_976540447 29 Left 976540443 4:86268289-86268311 CCATCTTCTCACCATCTTTACTG 0: 1
1: 0
2: 7
3: 52
4: 495
Right 976540447 4:86268341-86268363 TTCACCTGAATTCTTGCAAGAGG 0: 1
1: 0
2: 1
3: 24
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976540443 Original CRISPR CAGTAAAGATGGTGAGAAGA TGG (reversed) Intronic
901316315 1:8311948-8311970 CACTATGGATGGTGTGAAGAGGG + Intergenic
901615259 1:10534427-10534449 TAGGAAAGGTGGGGAGAAGAAGG - Intronic
902024789 1:13374815-13374837 CAGTAGAGATGGCGACATGAAGG - Intergenic
902190585 1:14760185-14760207 CAGTAATGGGGGTGGGAAGAGGG - Intronic
902196782 1:14804005-14804027 CAGGCAAGAGGCTGAGAAGAGGG - Intronic
903064562 1:20691925-20691947 TAGCAAAGATGGAGAGAAGTGGG - Intronic
904235393 1:29113230-29113252 CAGTAAAGCTGCAGAGAAGAGGG + Intronic
904503281 1:30930069-30930091 GAGTAATGGTGGTCAGAAGAGGG + Intergenic
904908016 1:33912544-33912566 GAGGAAAGAAGGAGAGAAGAAGG + Intronic
905836018 1:41121971-41121993 CAGTAGAGATGGTGAAATGTGGG - Intronic
905864669 1:41370284-41370306 CAGAGAAGAGGGAGAGAAGAGGG + Intronic
905921015 1:41718697-41718719 CAGGAGAGATGGAGAGAGGAGGG - Intronic
906202473 1:43968898-43968920 AAGTAAACATGGGGAGTAGAGGG + Intergenic
906846031 1:49193346-49193368 CAGCAAAAGTGGTGATAAGATGG - Intronic
907181599 1:52575397-52575419 CAGTGAAGATTGTGTGAAGTGGG - Intergenic
907839509 1:58142760-58142782 CAGGAAAGATGGAGAGAGGTAGG - Intronic
910089479 1:83445405-83445427 CAGTAAAAATGGAGAGGAGGAGG + Intergenic
911763796 1:101648419-101648441 TAGTAAGGATGGGGAGAAAAGGG - Intergenic
911859996 1:102934388-102934410 CAGAAAACCTGGTGAGAAGTAGG + Intronic
911898452 1:103469541-103469563 CATTAATGATAGTGATAAGATGG + Intergenic
912047039 1:105471767-105471789 AAGGAAAGAAGGTGGGAAGAAGG - Intergenic
912258352 1:108084014-108084036 CAGTAAATATGGTGGGGTGAGGG - Intergenic
912310372 1:108614712-108614734 AGGTAGAGATGATGAGAAGAGGG - Intronic
913094991 1:115507776-115507798 CACTGCAGGTGGTGAGAAGATGG + Intergenic
914319043 1:146541726-146541748 CAGTGAAGGTGATGAGAAGTAGG + Intergenic
914784740 1:150818049-150818071 CAGTAAAGAGGGGGTGGAGAGGG + Intronic
915503831 1:156339419-156339441 AATTAAACATGGTGAGAACACGG + Intronic
915783370 1:158579200-158579222 CAGTCAGGATGATGAGCAGAAGG + Exonic
915893769 1:159795127-159795149 CAGAAAAGATGGAGAGAGTAAGG + Intergenic
916001527 1:160621121-160621143 CAGTAAGGATGGTGGGAAAGTGG + Intronic
916526192 1:165611671-165611693 CAGTTATGAGGGTCAGAAGAAGG - Intergenic
918255773 1:182745849-182745871 AAGTAAAGATGGTCAGGATAGGG - Intergenic
918677254 1:187302798-187302820 AAGTAGAGAGGGGGAGAAGATGG - Intergenic
919365922 1:196660750-196660772 GAGTAAATATTGTGAGAAGTTGG + Intronic
919721240 1:200838822-200838844 CAGTTATGATGGAGAGAAGTTGG + Intronic
921705424 1:218317216-218317238 AAGTAAGGATAGTGAGTAGAAGG + Intronic
921819648 1:219602467-219602489 CTGTTAAGGTGGTTAGAAGATGG - Intergenic
922468169 1:225859145-225859167 CAGGATAGCTGGTGAGAAGAGGG - Intronic
924139402 1:241006375-241006397 CAGTAAAGCTCCTGAGGAGATGG - Intronic
1063897985 10:10702216-10702238 CACTAAAAATGGGGAGAAGGGGG + Intergenic
1064274749 10:13895229-13895251 CAGGATAGAGGGTGAGAGGAGGG - Intronic
1064810247 10:19188855-19188877 CAGTAGAGATGGTCAGAAGTGGG + Intronic
1066635706 10:37496878-37496900 CAGGAAAGAGAGTGAGAAGGGGG - Intergenic
1067208008 10:44236056-44236078 CAGGAAACATGATGAGAAGGAGG - Intergenic
1068515118 10:58016495-58016517 CAGAAAAGAAGGAGAAAAGAAGG - Intergenic
1068584486 10:58781580-58781602 CTATAAAGAGGGTTAGAAGATGG - Intronic
1068606466 10:59010363-59010385 GAGTAAATATGCTGAGTAGAAGG - Intergenic
1068957583 10:62832954-62832976 CAGAAAAGATGAAGAGGAGATGG + Intronic
1069318947 10:67143590-67143612 CAGTGAAGATGCTGTGAACATGG - Intronic
1069461181 10:68596290-68596312 CTGTATAGATGGTTAGAAGTGGG + Intronic
1069472048 10:68702255-68702277 CAGAAAAGATGATAAAAAGATGG - Intergenic
1069805636 10:71122384-71122406 CAGTTAAGGTGGTGTTAAGATGG - Intergenic
1069998557 10:72358889-72358911 CAGTAACGATGTGGAGAAGCGGG + Intergenic
1071176564 10:82932985-82933007 GAATAAAGAGGGAGAGAAGAAGG - Intronic
1072897707 10:99381083-99381105 AAGTAGAGAAGTTGAGAAGAAGG + Intronic
1073306159 10:102504619-102504641 CTGTAAACGTGGTGAAAAGAGGG + Intronic
1073328844 10:102657900-102657922 CTGGGAAGATGGTGAGGAGAAGG - Exonic
1073793752 10:106965361-106965383 CAATAAAGATGGAGAAAACAAGG + Intronic
1074243069 10:111658346-111658368 CAGGCAAGAGTGTGAGAAGAGGG - Intergenic
1074485059 10:113868258-113868280 CAGGAAAGAGGGAGAGAAGAGGG - Intronic
1076436398 10:130447081-130447103 AAGCAAAGATGGAAAGAAGAGGG - Intergenic
1076559184 10:131350015-131350037 CAGTGAAGGTGGTTAGAAGGAGG - Intergenic
1078045043 11:7905959-7905981 CAATAGAGATAGTGAGAAGGTGG + Intergenic
1078160176 11:8833102-8833124 CAGCAAAGCTGGTGAGCAGATGG + Intronic
1078368432 11:10725411-10725433 CAGTAACGCTGATGAGAACAGGG + Intergenic
1079591161 11:22184685-22184707 CAGTAGAGATTTGGAGAAGATGG - Intergenic
1082902766 11:58273735-58273757 GAGGAAGCATGGTGAGAAGAAGG - Intergenic
1084947528 11:72646588-72646610 CAGTGAAGATTATGAGCAGAGGG - Intronic
1085639460 11:78183583-78183605 GAAAAAAGAGGGTGAGAAGAAGG + Intronic
1086287308 11:85264423-85264445 CTGTTTTGATGGTGAGAAGAAGG - Intronic
1086345619 11:85893006-85893028 CAGAAAAGGTGGTCAGGAGAGGG - Intronic
1087141903 11:94772363-94772385 GAGTGAGGATGGGGAGAAGAGGG - Intronic
1087876747 11:103368235-103368257 TAGTAAAGATATTGAGAAAAGGG - Intronic
1088245843 11:107817336-107817358 CATTAGAGATGGAGATAAGAGGG + Intronic
1088760523 11:112924787-112924809 CAAAAGAGATAGTGAGAAGAGGG + Intergenic
1088966138 11:114723327-114723349 AAGTAAAGAAGGAGAGAAGAAGG + Intergenic
1089490771 11:118882480-118882502 CAGTAAGCAAGGTGTGAAGAGGG + Intergenic
1089780061 11:120867440-120867462 GGGTAAAGAAGGGGAGAAGAGGG - Intronic
1090125901 11:124083832-124083854 TAGCAAAGATGTGGAGAAGAGGG + Intergenic
1091005204 11:131947067-131947089 CAGAAAAGCTGGTGAGTAGTGGG + Intronic
1091086826 11:132728968-132728990 CAATAATGATGATGAGGAGATGG + Intronic
1091344021 11:134840615-134840637 CAGTAACGATGTGGAGAAAAGGG + Intergenic
1092021945 12:5210142-5210164 CAGTAAAAATAGAGAAAAGATGG - Intergenic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1093213467 12:16334939-16334961 CAATATAGGTGATGAGAAGATGG + Intergenic
1093308377 12:17546790-17546812 AAGAAAAGATAGAGAGAAGAGGG - Intergenic
1093713004 12:22349292-22349314 CAGTAGAGATGAAGAAAAGAGGG + Intronic
1093822205 12:23635205-23635227 TAGTAAAGATGGTGAGTAATGGG + Intronic
1094087190 12:26607165-26607187 CAGTACAGATGGTGAGCAGAAGG - Intronic
1094140244 12:27173311-27173333 CAGCAAAGATGTGGAGAAAAGGG - Intergenic
1094688230 12:32742063-32742085 AAATAAAGATGATGAAAAGAAGG + Intronic
1095487696 12:42701884-42701906 AAGTAAAGATGGGGGAAAGAGGG + Intergenic
1096280958 12:50253137-50253159 CAGTAAATATAGAAAGAAGAGGG + Intronic
1097623168 12:61966139-61966161 CAGTGAAGATGAGGAGAAGTTGG - Intronic
1098013360 12:66078180-66078202 TACTAAAGTTGCTGAGAAGATGG - Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1100045800 12:90379037-90379059 AATTAAAGATGGTAAGAAGAGGG + Intergenic
1100834184 12:98550536-98550558 CAGTAAAAGTGGTGGGAAAAAGG - Intergenic
1101238483 12:102813931-102813953 TTGTGAAGATTGTGAGAAGATGG + Intergenic
1101799398 12:108007510-108007532 CAGGAAAGAGAGTGAGAAGAGGG + Intergenic
1102310418 12:111840647-111840669 CGGTAAAGGTGTAGAGAAGATGG - Intergenic
1102773745 12:115501143-115501165 TAGTAAGGATGGTGGGAAGCAGG + Intergenic
1103049109 12:117763852-117763874 CAGCAAAGATGGAGAGAAGTCGG + Intronic
1103600803 12:122053414-122053436 CAGGCAAGATGGGAAGAAGAAGG - Intronic
1103897661 12:124284454-124284476 AGATAAAGAAGGTGAGAAGAAGG - Intronic
1103909700 12:124345438-124345460 CAGAAAGGATGGTGAGGAAATGG + Intronic
1104107597 12:125678908-125678930 CAGTAATGATGATGTGATGATGG + Intergenic
1104489443 12:129181325-129181347 AAGTAGAGATGGAGAGAAGGAGG - Intronic
1104583198 12:130026105-130026127 GAGTAAACAGGGTGAGGAGAGGG - Intergenic
1104666828 12:130653555-130653577 CAGTGGAGTTGGTGAGAAGAGGG - Intronic
1106460044 13:29960605-29960627 CACTAAAGATGGGGAGAGAATGG - Intergenic
1106471705 13:30061743-30061765 AAGAAAAAATGGAGAGAAGAGGG - Intergenic
1106608842 13:31258416-31258438 TATTAAATATGGAGAGAAGATGG - Intronic
1107658761 13:42617667-42617689 CAGGAAGAAAGGTGAGAAGATGG - Intergenic
1107776498 13:43849457-43849479 CATGAAAGTTGGAGAGAAGAAGG + Intronic
1108543382 13:51465883-51465905 CAGTAAAGGTGGTGAGAAATGGG + Intergenic
1109019420 13:57067977-57067999 CAGAAAAGAAAGTGAGAAGTGGG + Intergenic
1109019899 13:57076490-57076512 TAGGAACCATGGTGAGAAGAGGG + Intergenic
1109041034 13:57337430-57337452 AAGTAGACATGGTAAGAAGAAGG - Intergenic
1109325624 13:60864205-60864227 GAGAACAGATGGTGAGAGGAGGG - Intergenic
1109857550 13:68152331-68152353 CTGAGAAGATGGTGAGATGATGG - Intergenic
1109983511 13:69943820-69943842 CAGTAAAGTTGTCAAGAAGACGG + Intronic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1111371143 13:87319358-87319380 CAGGAAAGATAATGTGAAGATGG + Intergenic
1111598189 13:90437350-90437372 GTATAAAGATAGTGAGAAGAAGG - Intergenic
1111764366 13:92509241-92509263 CAGAAAAGATAGGGAGAGGAGGG - Intronic
1111929584 13:94499858-94499880 CAATAAAGCTGAGGAGAAGAGGG - Intergenic
1113209469 13:107958537-107958559 CAGTAAAGAAGGGCAGAGGAGGG - Intergenic
1113357833 13:109600335-109600357 CTATAAAGATGATGGGAAGACGG + Intergenic
1113392163 13:109908308-109908330 CAGAAAAGAGAGAGAGAAGAGGG + Intergenic
1114363517 14:22002460-22002482 CAGAAAATATGGTGGGAAAAAGG + Intergenic
1114476606 14:22999449-22999471 CAGTAAAGATGGTGAGGAGGAGG - Intronic
1114788464 14:25628294-25628316 CAGAAAAGATGGTATGCAGAAGG + Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115001112 14:28420731-28420753 CAAAAGAGATGGTGAGAAGTGGG - Intergenic
1115024419 14:28724751-28724773 AAATAAAGATTGTGAGAATAAGG + Intergenic
1115709248 14:36032248-36032270 CAGTCAACATGTGGAGAAGATGG + Intergenic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116303780 14:43221692-43221714 CAGTAGGGATGGTGGGAGGAGGG - Intergenic
1116447547 14:45028250-45028272 CAATAAAGATTGTGAAAAGAAGG + Exonic
1116918837 14:50550887-50550909 CAGAAAAAATGGTGCTAAGAGGG + Intronic
1117619364 14:57568746-57568768 CAGTAAAGAAGGTCAGTTGAGGG + Intronic
1118288849 14:64503099-64503121 CAGAGAAGACGGTGATAAGATGG + Intronic
1119305231 14:73602489-73602511 CAAAAAAGATAGTGAGAAGCGGG - Intergenic
1119671698 14:76524895-76524917 CAGTAAAGATGGGGACATCAGGG + Intergenic
1119951228 14:78747797-78747819 CAGAAAAGATCTTGAGCAGAAGG - Intronic
1120262590 14:82205653-82205675 CGGTGAAGATGGGGAGAAAAGGG - Intergenic
1121702883 14:95969305-95969327 GACTAAAGATGGGGAGATGAAGG - Intergenic
1121963342 14:98281664-98281686 CAGTGAAAATGCTGAGAAGATGG + Intergenic
1122034665 14:98938525-98938547 CAGCAAAGAGGGGAAGAAGAAGG + Intergenic
1123468625 15:20534065-20534087 CAGTTTAAATGGTGGGAAGAAGG - Intronic
1123649489 15:22466997-22467019 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1123728943 15:23129276-23129298 CAGTTTAAATGGTGGGAAGAAGG - Intronic
1123747107 15:23326741-23326763 CAGTTTAAATGGTGGGAAGAAGG - Intergenic
1123992976 15:25696994-25697016 CAGGAAATATGGGAAGAAGAAGG + Intronic
1124279376 15:28350057-28350079 CAGTTTAAATGGTGGGAAGAAGG - Intergenic
1124303322 15:28561551-28561573 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1124532221 15:30517991-30518013 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1125279078 15:38025440-38025462 CTTGAAAGATGGAGAGAAGAAGG - Intergenic
1127507791 15:59611669-59611691 CACTAAAGAAGATGAGGAGAGGG - Intronic
1127927033 15:63556942-63556964 CAGTAACGCTGATGGGAAGAAGG - Intronic
1128691056 15:69725305-69725327 TTGAAAAGATAGTGAGAAGATGG + Intergenic
1129030001 15:72611167-72611189 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1129038220 15:72663915-72663937 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1129211670 15:74073316-74073338 CAGTTTAAATGGTGGGAAGAAGG - Intronic
1129368963 15:75076022-75076044 CAGAAAAAATGGAGGGAAGAAGG + Intronic
1129398733 15:75267768-75267790 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1129402341 15:75292044-75292066 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1129728792 15:77917591-77917613 CAGTTTAAATGGTGGGAAGAAGG - Intergenic
1129839726 15:78736280-78736302 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1130050620 15:80480743-80480765 CAGGAAGGATGGGGAGAGGAAGG - Intronic
1131282622 15:91033506-91033528 CAGTTTAAATGGTGAGAAAAGGG - Intergenic
1131324081 15:91425743-91425765 CACTAAAGAGAGAGAGAAGAGGG + Intergenic
1131438506 15:92441324-92441346 CAGTAAAAGTGGTGAGGAGGAGG + Intronic
1131995016 15:98125191-98125213 ATGGAAAGATGCTGAGAAGATGG + Intergenic
1132175272 15:99709161-99709183 CAGTAGAGATGGTGAGACCTGGG + Intronic
1132202226 15:99962888-99962910 CAGTGAAGATAGGGAGAAGTGGG + Intergenic
1133308228 16:4825020-4825042 TAGCAGGGATGGTGAGAAGAAGG - Intronic
1135511454 16:23088101-23088123 CAGTGAAGATGGAGAGCACAGGG + Intronic
1137461725 16:48670709-48670731 CAATAAAGATGGGAGGAAGAGGG + Intergenic
1137522269 16:49204458-49204480 CAGGAGAGATGGTGTGAAGAGGG + Intergenic
1137669677 16:50271932-50271954 AAGGGAGGATGGTGAGAAGAGGG - Intronic
1138123325 16:54418376-54418398 CAGTACAGATGGTGAGACGAGGG - Intergenic
1138208394 16:55142323-55142345 CAGTAAAGGTTGTGAAATGAAGG + Intergenic
1139620116 16:68132870-68132892 AAGTAAGGATGGGGAGAAGTTGG + Intronic
1140014478 16:71168358-71168380 CAGTGAAGGTGATGAGAAGTAGG - Intronic
1140548321 16:75834595-75834617 CAGTAAAGATGCTGCTCAGAGGG - Intergenic
1140575291 16:76160596-76160618 AGTTAAAGATGGTGAGATGAGGG - Intergenic
1141338638 16:83181637-83181659 CTGAAAAGAGGGGGAGAAGAGGG + Intronic
1141369128 16:83471146-83471168 CATTAAAGATCTTGAGATGAGGG - Intronic
1141859937 16:86709670-86709692 CAGTGAAGCTGGAGAGAAGCAGG + Intergenic
1141874548 16:86813957-86813979 CAGAAATGAAGCTGAGAAGAGGG + Intergenic
1141892461 16:86935496-86935518 CAATAAAGTTGGTGAGAAGGTGG - Intergenic
1142012421 16:87722639-87722661 CAGGGAGGATGGTGAGCAGAAGG + Intronic
1143940534 17:10536565-10536587 CAAGAAAGGTGGTAAGAAGAAGG - Exonic
1144209015 17:12999383-12999405 CAGTGAAGATGGTAAGAGGCAGG + Intronic
1145838088 17:27969993-27970015 CAGTGAAGCTGGAGAAAAGAGGG - Intergenic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146706148 17:35002094-35002116 CAGCAAAGATGGTAAGGATAGGG + Exonic
1147968078 17:44204801-44204823 CACTAAAGATTCTGAGAAGTTGG - Intergenic
1148171073 17:45520327-45520349 AAGTAAAGATTGTGAGAAAGTGG + Intergenic
1148278606 17:46329478-46329500 AAGTAAAGATTGTGAGAAAGGGG - Intronic
1148300816 17:46547340-46547362 AAGTAAAGATTGTGAGAAAGGGG - Intronic
1148364949 17:47048225-47048247 AAGTAAAGATTGTGAGAAAGTGG - Intergenic
1149003987 17:51785526-51785548 CAGTGAAGATGTAGAGAAAAGGG + Intronic
1149328301 17:55555735-55555757 CTCTGAAGATGGTGGGAAGATGG - Intergenic
1149776938 17:59365670-59365692 CAGCAAAGCTGCTGAGAGGAGGG + Intronic
1150042109 17:61874215-61874237 CAGGAAAGATGCAGAGGAGATGG - Intronic
1150401687 17:64861923-64861945 AAGTAAAGATTGTGAGAAAGGGG + Intronic
1151128650 17:71872694-71872716 CAGTCAAGATGCAGGGAAGAAGG + Intergenic
1151768051 17:76142139-76142161 CAGGAAAGCTGGTGACAGGAGGG - Intergenic
1153170411 18:2310089-2310111 AATTAAAGTTGGTAAGAAGAAGG + Intergenic
1153612637 18:6901987-6902009 GAGTAAAGATGATGTGAAGATGG - Intronic
1155080977 18:22409338-22409360 CAGCAAAGATGGAGAGAAAGTGG - Intergenic
1155351117 18:24907241-24907263 CAGTACAGGTGGAGAGAAGTAGG - Intergenic
1155833216 18:30544160-30544182 CAATGAAGATTTTGAGAAGAAGG - Intergenic
1156826938 18:41441865-41441887 CAGAAAGAAAGGTGAGAAGAAGG - Intergenic
1157009773 18:43633193-43633215 CAGTAAAAATGGAGAGAAAAGGG - Intergenic
1157514682 18:48302371-48302393 CAGTAAAAAGGGAGAGAAGGTGG - Intronic
1157739708 18:50081460-50081482 CTGTAAAGGTGGTGGGAAAAGGG + Intronic
1158329542 18:56346361-56346383 AAGAAAAGAGGGTGAGAGGAAGG + Intergenic
1158377662 18:56889172-56889194 CAGTCATGATGGGGAGGAGATGG + Intronic
1159863098 18:73672307-73672329 CACAATAGATGGGGAGAAGATGG + Intergenic
1159973752 18:74685350-74685372 CAGGATAGATGGTGAGCAGCTGG - Intronic
1161676624 19:5654094-5654116 CAGAAAAGATGATGCTAAGAAGG + Exonic
1162618947 19:11825014-11825036 CAGTCAAGATGTTTAGAATAGGG - Intronic
1163097838 19:15073229-15073251 CAAAAAAGATAGTGAGAAGCGGG - Intergenic
1164676104 19:30102845-30102867 CTGTGAGGATGGTGAGAAGCTGG - Intergenic
1165104389 19:33460489-33460511 CTCTGAAGATGGTGGGAAGATGG - Intronic
1165230492 19:34383541-34383563 CAGTCAGGATGCTGAGAAGCAGG - Intronic
1165355692 19:35302539-35302561 CCTTGAAGATGGTGAGAATAGGG - Exonic
1167250840 19:48397703-48397725 CAGCAGAGACGGGGAGAAGACGG - Intronic
1167744867 19:51344858-51344880 CAGTGAGGTGGGTGAGAAGAAGG - Intergenic
1167787840 19:51650363-51650385 CAGTGGAAGTGGTGAGAAGAGGG + Intergenic
925077063 2:1025622-1025644 CTGTGAAGATGATGTGAAGATGG - Intronic
925663579 2:6228668-6228690 CAGTGAAGATGGTCAGAAATAGG - Intergenic
926583645 2:14661229-14661251 TACTAAAGAGGGTGAGAAGCTGG - Intergenic
926659523 2:15448318-15448340 CAGTAATGGTGGTGATAATAGGG - Intronic
927562248 2:24082373-24082395 GAGTAAAGATGGTGTGGACAAGG - Intronic
928150293 2:28821531-28821553 CAGTAAAGTTGTTGTGCAGAAGG + Intronic
930530608 2:52583651-52583673 AAGAAAAGATGGTGGGATGAGGG - Intergenic
931217825 2:60262944-60262966 CAGGAAATATGCTGGGAAGAAGG + Intergenic
931343531 2:61425736-61425758 CAGTAGAGGTGGTGGGAAGGGGG + Intronic
931810646 2:65851422-65851444 TAGTGAAGATGGAGAGAAGTGGG + Intergenic
931852629 2:66267528-66267550 CAGTGAAGATGTGGAGAAAAGGG - Intergenic
931890528 2:66666474-66666496 TAGTGAAGATAGTGAGATGATGG + Intergenic
933226402 2:79754329-79754351 CACCAAAGAGGGTGAGAAGCAGG - Intronic
933540626 2:83637241-83637263 CATAACAGATGGTGAGGAGATGG - Intergenic
933564690 2:83935453-83935475 CATTAAAGGTGGAGAGAAGAAGG - Intergenic
933676613 2:85063204-85063226 CAGTGAAGATGGTGGGAAGGGGG - Intergenic
934757820 2:96836678-96836700 CTGTTAAGAGGGTGAAAAGATGG - Intronic
934902058 2:98167276-98167298 ATGAAAAGAAGGTGAGAAGAAGG + Intronic
935390851 2:102551225-102551247 CAGAGAAGGTGGTGAGATGAAGG + Intergenic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936908422 2:117564837-117564859 GAGTATGGAGGGTGAGAAGAGGG - Intergenic
937043735 2:118839766-118839788 AAGGAAAAATGGAGAGAAGATGG + Intergenic
937521255 2:122714925-122714947 CAGTGAAGGTGGTGTTAAGAGGG + Intergenic
938101426 2:128500341-128500363 CAGGGAAGAGGGTGGGAAGAGGG + Intergenic
938759551 2:134411719-134411741 GAGGAAAGCTGGTGAGAAGGAGG + Intronic
939174018 2:138729120-138729142 CACTAAAGCTGTTGAGGAGAAGG - Intronic
939189102 2:138895488-138895510 CATTCCAGCTGGTGAGAAGATGG + Intergenic
939706428 2:145458920-145458942 CAGTGGAGCTGGTGAGAACAAGG + Intergenic
939786237 2:146516692-146516714 CAGTAGAGATGGAGATAAGCGGG + Intergenic
940026012 2:149209167-149209189 TTGTAAAGGTGGTGAGAAGGCGG + Intronic
940440843 2:153714409-153714431 CAGTAAAATAGGTGAGAAAAAGG - Intergenic
940704659 2:157088673-157088695 CATTAAAGTTGGTATGAAGATGG + Intergenic
940842076 2:158595301-158595323 CAATAAGCATGGTGAGAAGTAGG - Intronic
941920325 2:170844022-170844044 CTGGAAAGGTGGTAAGAAGAAGG - Intronic
942331501 2:174829457-174829479 CTGTAAACATGATGAGAAGCAGG - Intronic
943540082 2:189202759-189202781 CAGTAAGGATGAGGATAAGAGGG + Intergenic
943735259 2:191347063-191347085 CAGTAAGGTATGTGAGAAGACGG - Intronic
944320318 2:198332952-198332974 CAGTAAAGTTGCTAACAAGAGGG + Intronic
944879169 2:203993943-203993965 AAGCAAAGATGTTGAGAAGGAGG + Intergenic
946146402 2:217734457-217734479 CAGAACAGATGCTCAGAAGAAGG - Intronic
946480593 2:220052136-220052158 CATTACAAATGGTGAGAGGAAGG - Intergenic
946512219 2:220370379-220370401 CAGTGCAGGTGGTGAGAAGTGGG - Intergenic
946867924 2:224059186-224059208 CAGTATAGATGCTGAGAAGTGGG + Intergenic
947318813 2:228894806-228894828 GAGGCAACATGGTGAGAAGAAGG - Intronic
948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG + Intergenic
1169038453 20:2472518-2472540 CTTTAGAGATGGTGTGAAGATGG - Intronic
1170231774 20:14055702-14055724 CAGCAATGTTGGGGAGAAGAGGG - Intronic
1170252919 20:14305461-14305483 CAGTATATATAGAGAGAAGAGGG + Intronic
1170447465 20:16443336-16443358 CAGTAAACTTGGTGAAAAGGAGG + Intronic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1172074292 20:32282210-32282232 CAGTGGAGATGGTAAGAGGACGG + Intronic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1175133771 20:56808231-56808253 CAGGAAAGATGGTTCTAAGATGG + Intergenic
1175765242 20:61587729-61587751 CAGAAAAGGTGCTGAGAACACGG - Intronic
1176226229 20:64001282-64001304 CAGGAAAGCTGCTGAGAGGAGGG - Intronic
1177371419 21:20208883-20208905 CAGTCAAGAAGATGAGAATATGG - Intergenic
1179424322 21:41261746-41261768 CAATAAGGATGCTGAGAAAATGG - Intronic
1180235602 21:46457910-46457932 CATTAAAGCTGGTGAGAAGATGG - Intergenic
1181486502 22:23234887-23234909 CAGGAAAGTTGGGGAGTAGAGGG + Intronic
1181532664 22:23525778-23525800 GAGTGAAGATGATGAGAAGACGG - Intergenic
1182027987 22:27135380-27135402 TAGAAAAGAGAGTGAGAAGAAGG + Intergenic
1182097554 22:27636353-27636375 AAGCAAAGATGTGGAGAAGAAGG + Intergenic
1182571590 22:31243293-31243315 CACGAAAGATGGTTAGTAGATGG + Intronic
1182699235 22:32220587-32220609 AAGTAAAGTTGGAGAGAAGGTGG + Intronic
1182899788 22:33888351-33888373 CATTGAAGATGGTGACAAAATGG - Intronic
1183294781 22:37023047-37023069 CAGGAAAGATAGAGAGGAGAGGG + Exonic
1183875734 22:40779132-40779154 CAAGAAAGATGGAGAGAAAAAGG + Intronic
1183876707 22:40789062-40789084 AAGTAGAGATGGTCAGAAGATGG - Intronic
1184175534 22:42786812-42786834 CAGTTCAAATGGTGGGAAGAAGG + Intergenic
1184292317 22:43503981-43504003 AAATAGAGGTGGTGAGAAGAGGG + Intronic
1184292323 22:43504046-43504068 TAGTGATGATGGTGAGAGGATGG + Intronic
1185206432 22:49541630-49541652 CAGAAAAGATGGTGGGAAGGGGG - Intronic
949745821 3:7291071-7291093 CAGTGAGGATGCTGGGAAGAGGG - Intronic
949821242 3:8117684-8117706 CAGTAAAGATGTAGAAAAAATGG - Intergenic
949956185 3:9270766-9270788 CAGTAAAAATGGAAAAAAGAAGG - Intronic
950623310 3:14225310-14225332 CAAAAGAGATAGTGAGAAGAGGG - Intergenic
951163267 3:19452570-19452592 TAGTAATGATGGTGAGAGGCAGG + Intronic
951338234 3:21451552-21451574 CAGTAATGATGTTTAGAATAAGG - Intronic
951388671 3:22074938-22074960 CAGAAATGATGGTGAGAAAAGGG + Intronic
952051317 3:29387893-29387915 CAGTAAATTAGGAGAGAAGAAGG - Intronic
952351842 3:32546793-32546815 CAGGAGAGATGGTGAGAAAATGG + Intronic
952622025 3:35356468-35356490 CAGGAAAGATGCTGAGCAAAGGG + Intergenic
952846433 3:37691410-37691432 CAGTGAAGACAGTGGGAAGATGG + Intronic
954361825 3:50126237-50126259 CAGAAGGGATGGTGGGAAGAGGG + Intergenic
956471625 3:69573150-69573172 CAGTGAAGATAGAGAGAAGAGGG + Intergenic
958884125 3:99707247-99707269 CAGCAATGGTGGTGAGAAGTGGG - Intronic
959435440 3:106309547-106309569 GAGTGAAGGTGGTGAGAAAATGG - Intergenic
961944516 3:130672237-130672259 CAGTAAAGTTTGTGGAAAGATGG - Intronic
962084807 3:132179520-132179542 CAGAAAAGGTGGGGAGAAGGGGG + Intronic
962132754 3:132699223-132699245 CAGTGAGGATGGGGAGAAGTGGG - Intronic
962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG + Intergenic
962673153 3:137729858-137729880 AAGTGAAGATGGTAAGAAAAGGG - Intergenic
962707224 3:138055908-138055930 CAGCAAAGATGGGGAGAAATAGG + Intergenic
963024434 3:140904759-140904781 CAGTGGAGATGGTGAGAACTGGG + Intergenic
963376634 3:144474896-144474918 GAGTCAAGATGGTGAGCAGTGGG - Intergenic
963580066 3:147114877-147114899 CAGCAAATATGGTGAATAGATGG - Intergenic
963757888 3:149255220-149255242 CATTCCAGATGGAGAGAAGAGGG + Intergenic
965180906 3:165402164-165402186 AAGTAAAGATTATGAGAAGGAGG - Intergenic
965472777 3:169115925-169115947 CTCTAAAGATGGTGAGAAAATGG + Exonic
965516343 3:169625348-169625370 CAGGAATGAGAGTGAGAAGAGGG - Intronic
965603724 3:170479635-170479657 CAGTAAGGATGGTGGCATGATGG + Intronic
966168994 3:177056138-177056160 CAGTAAATATGGCAATAAGATGG - Intronic
966261011 3:177979418-177979440 AAGGAAAGATGGAGGGAAGAAGG + Intergenic
966450946 3:180060833-180060855 CAGGAAACATTGGGAGAAGAAGG + Intergenic
966659698 3:182400597-182400619 GAGAAAAGAGGGGGAGAAGAAGG + Intergenic
966890111 3:184401096-184401118 CTGTAGACATTGTGAGAAGAAGG + Intronic
967734047 3:192933544-192933566 CAGTAACCATGATGAAAAGATGG + Intergenic
968073543 3:195802974-195802996 GTGTACAGACGGTGAGAAGAGGG - Intronic
969150106 4:5162054-5162076 CAGTAAGCAAGATGAGAAGAGGG + Intronic
970205026 4:13647016-13647038 GAGAAAAGATGGGGAGGAGAAGG - Intergenic
970207734 4:13672382-13672404 CAGTAAAGATGAAAAAAAGAAGG + Intergenic
970898167 4:21127294-21127316 CAGTAAGTATGGTGAGAGAAGGG - Intronic
971467273 4:26977023-26977045 CAGTATAGTTAGTGAGCAGATGG + Intronic
971487889 4:27179573-27179595 CATTAAAGATGTTGATAATATGG + Intergenic
973716563 4:53682708-53682730 TGGTAAAAATGGTGAGAAGTGGG - Intronic
973920390 4:55678434-55678456 CAGCAAAGGTGGTGCTAAGAGGG + Intergenic
974172282 4:58281732-58281754 TAGTGAAGATGTTGAGAAGAAGG + Intergenic
974539381 4:63214139-63214161 CAGTGAGGATGCTGAGAAAAAGG - Intergenic
975273946 4:72473259-72473281 CTCTAAAGGTGGAGAGAAGAAGG + Intronic
975583559 4:75928610-75928632 GAGTGGAGATGCTGAGAAGATGG + Intronic
975823332 4:78293761-78293783 CAGAAAAAATGGAGAGAAGAGGG + Intronic
976055061 4:81054800-81054822 AAATAAATATAGTGAGAAGAAGG - Exonic
976540443 4:86268289-86268311 CAGTAAAGATGGTGAGAAGATGG - Intronic
976737565 4:88326101-88326123 GAGTAAAGACGGTTAGAATAAGG - Intergenic
976831057 4:89314424-89314446 CAGTAAGGCTGGGGAAAAGAGGG + Intergenic
976954046 4:90872266-90872288 CAGGATAGAAGGTGGGAAGAAGG - Intronic
977027816 4:91842587-91842609 CAGGACAGAGGGTGGGAAGAGGG + Intergenic
977079415 4:92505037-92505059 AACTTAAGATGGTGCGAAGATGG + Intronic
977784086 4:101012739-101012761 CAGGTAAGGTGGAGAGAAGATGG + Intergenic
977806412 4:101304011-101304033 CAACAAATATGGTGAAAAGAAGG - Intronic
978130878 4:105195899-105195921 GAGTCAAGATCTTGAGAAGATGG - Intronic
978261100 4:106760421-106760443 CAGTAAGGATGGAAAGAAGATGG + Intergenic
978392238 4:108239197-108239219 TAGAAAAAAAGGTGAGAAGAAGG - Intergenic
978957652 4:114634059-114634081 CTGCAGAGATGGTGAGAAGTGGG + Intronic
979509425 4:121535374-121535396 GAGTAAAGAAAGTGAGAAGTGGG + Intergenic
979856522 4:125639522-125639544 CAGTAAGGAAGGGGAGAAGGGGG - Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980256483 4:130386566-130386588 TTGTAAAACTGGTGAGAAGAGGG + Intergenic
981314798 4:143331583-143331605 TAGAAAAGCTGTTGAGAAGAAGG + Intergenic
981320559 4:143387003-143387025 CAGTAAAGAGAATGATAAGAAGG + Intronic
982403516 4:154995403-154995425 CAGTGAAAAGGGTGAGCAGAGGG - Intergenic
984187504 4:176564121-176564143 GAGACAAGATGGTGTGAAGATGG - Intergenic
984579024 4:181488305-181488327 CAGTACAATTGGTGAGAAGTCGG + Intergenic
984949239 4:184994467-184994489 CAGCATAGATGGGGAGAGGATGG + Intergenic
985486516 5:154693-154715 CAGTAATGAAAGCGAGAAGACGG - Intronic
985900295 5:2783439-2783461 CAGAAGAGAAGGGGAGAAGACGG - Intergenic
986204726 5:5612683-5612705 CAGTAATGACGGTGGTAAGACGG - Intergenic
986346339 5:6838818-6838840 CAGTGGAGATGCTGAGAAGCAGG + Intergenic
986644867 5:9907120-9907142 CAGCAAGGAAGGAGAGAAGAGGG - Intergenic
986840088 5:11686936-11686958 CAGTTAAGAAGGTAAGAAAATGG + Intronic
987240026 5:15986775-15986797 CAGTAAAGATGGGGGGAAGACGG - Intergenic
987515745 5:18905829-18905851 CAGTAAAGACTGAGAGATGAGGG + Intergenic
987695731 5:21328957-21328979 CAGTAAAGATGGAGAGAAATAGG + Intergenic
988753386 5:34216050-34216072 CAGTTATGAGAGTGAGAAGATGG - Intergenic
988816844 5:34842573-34842595 CAAAAGAGATGGTGAGAAGGGGG + Intronic
988856486 5:35232527-35232549 CAGTAAAGAAGCTGTGAAGCTGG - Intergenic
990875172 5:60476382-60476404 CAGTGGAGATTGTGAGAGGATGG - Intronic
991146249 5:63308605-63308627 CATTCAAGATGGGGAGAAAATGG - Intergenic
991275260 5:64839823-64839845 CAGAAAAGATGGGGAAAAGTTGG + Intronic
991741168 5:69676896-69676918 CAGTTATGAGAGTGAGAAGATGG - Intergenic
991744670 5:69723135-69723157 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991753033 5:69832098-69832120 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991756450 5:69877546-69877568 CAGTTATGAGAGTGAGAAGATGG + Intergenic
991792742 5:70256633-70256655 CAGTTATGAGAGTGAGAAGATGG - Intergenic
991796241 5:70302859-70302881 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991802651 5:70388825-70388847 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991820628 5:70552969-70552991 CAGTTATGAGAGTGAGAAGATGG - Intergenic
991824052 5:70598449-70598471 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991832353 5:70707217-70707239 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991835852 5:70753459-70753481 CAGTTATGAGAGTGAGAAGATGG + Intergenic
991885192 5:71256941-71256963 CAGTTATGAGAGTGAGAAGATGG - Intergenic
991888619 5:71302418-71302440 CAGTAAAGATGGAGAGAAATAGG - Intergenic
992846150 5:80750372-80750394 AAGTAAAGATGTGGAGAAAAGGG - Intronic
992994372 5:82318053-82318075 CAGAAAAGCTGGCGAGAAGGAGG - Exonic
993173081 5:84445780-84445802 CAGTAAAGATGGTAAGAAATAGG - Intergenic
993673186 5:90786631-90786653 AAATAAAGATGGCGAGAAGTGGG + Intronic
994681626 5:102894880-102894902 CAGTAGAGAAGGAGAAAAGAGGG - Intronic
995156188 5:108915983-108916005 GAGTAAAGCAGGAGAGAAGAGGG - Intronic
995350695 5:111172144-111172166 CAGAAAAGAGGGTTAGGAGAAGG - Intergenic
995369194 5:111399651-111399673 CAGTAAAGATGTTTAGTACATGG - Intronic
995730026 5:115229081-115229103 TAGTATAGATGGTGATGAGAAGG + Intronic
996197008 5:120621092-120621114 TAGTGAAGATAGTGAAAAGAAGG - Intronic
996234835 5:121113596-121113618 CAATAAATCTGGAGAGAAGAAGG - Intergenic
996459931 5:123730467-123730489 TGGTAAAGATGGGGAGAAAAGGG + Intergenic
997202254 5:132018052-132018074 CAGTACAGAGGGAGAGAAGAGGG + Intergenic
997286280 5:132681050-132681072 AAGTGAAGGTGTTGAGAAGATGG + Intronic
997806532 5:136923619-136923641 AAATAAAGATGGAGAGAAAAGGG - Intergenic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
999636599 5:153629393-153629415 CATTGAAGAAAGTGAGAAGAAGG + Intronic
1001465906 5:171965973-171965995 CAGGAGAGAGGGTGAGAAGGGGG - Intronic
1001567131 5:172707007-172707029 CAGGATGGATGGTGAGAAGAGGG + Intergenic
1002339885 5:178508859-178508881 CTGTTATGATGGGGAGAAGAAGG - Intronic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1003007541 6:2395802-2395824 AAAGAAAGATGGTGAGAAGTTGG + Intergenic
1005171768 6:22994009-22994031 CAGGAAAGGTGCTAAGAAGAAGG - Intergenic
1005375568 6:25179043-25179065 CAGAAAAGATGATGTGAAGTTGG - Intergenic
1005551554 6:26922871-26922893 CAGTTATGAGAGTGAGAAGATGG - Intergenic
1005555054 6:26969109-26969131 CAGTAAAGATGGAGAGAAATAGG - Intergenic
1005704253 6:28435847-28435869 CAGGAGAGCAGGTGAGAAGATGG - Exonic
1007670976 6:43553442-43553464 CACGAATGAAGGTGAGAAGACGG + Exonic
1008342758 6:50387682-50387704 CTGTAGACATGGTGAGAGGAGGG - Intergenic
1008968914 6:57343977-57343999 TATTAAAGATGGTCAGACGAAGG + Intronic
1009248265 6:61267349-61267371 TAATAACAATGGTGAGAAGATGG + Intergenic
1009565994 6:65312124-65312146 CTGTTAAGGTGGTTAGAAGATGG + Intronic
1009777416 6:68222555-68222577 AAGTAAAGAAGGGAAGAAGAAGG + Intergenic
1010116174 6:72315273-72315295 TAGTGAAGATGGTGAGAAGAGGG + Intronic
1010364836 6:75038637-75038659 CAGTAAAGATGGTCAGAAAAAGG + Intergenic
1010454798 6:76042704-76042726 CATGAAGGATGGTGAGAGGAAGG + Intronic
1012241253 6:96875505-96875527 CAGTAGAAATGGAGAAAAGATGG - Intergenic
1012359404 6:98358662-98358684 CAGCAAGGATGGTGGGAAGGAGG + Intergenic
1012371426 6:98511962-98511984 TAGAAAAGATGGTGAGAAATGGG + Intergenic
1012397281 6:98813349-98813371 CAGTAAATATTTTGAGAACATGG + Intergenic
1014792951 6:125695309-125695331 CGGTGAAGATGTGGAGAAGAGGG - Intergenic
1015495984 6:133883872-133883894 CAGAGGAAATGGTGAGAAGAGGG + Intergenic
1015733766 6:136375871-136375893 CAACAAAGAAGGGGAGAAGATGG + Intronic
1015762948 6:136684662-136684684 CAGCAGAGAGGGTGAGAAGCTGG - Intronic
1016099636 6:140082744-140082766 CAATGGAAATGGTGAGAAGAAGG + Intergenic
1016455978 6:144231208-144231230 AAGAGAGGATGGTGAGAAGAGGG + Intergenic
1020442012 7:8227352-8227374 CAGAGAAGATGGAGAGAGGAAGG + Intronic
1020574965 7:9914301-9914323 CAGTAAAAATGGTTAAAATAGGG - Intergenic
1020614063 7:10436922-10436944 GAGTATAGATGGAGTGAAGATGG - Intergenic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1022844122 7:34192718-34192740 CAGTAATGTTGGTTAGAGGAAGG - Intergenic
1023014532 7:35954101-35954123 CAGAATAGATGATGGGAAGAGGG + Intergenic
1023460022 7:40386336-40386358 CCGTCAAGATGGTGGGATGAGGG - Intronic
1024710631 7:52011124-52011146 CATTAATTATGGTAAGAAGAAGG - Intergenic
1025168722 7:56736560-56736582 CAGCAAAGGTGGCAAGAAGAAGG - Intergenic
1025217682 7:57072397-57072419 TAGAATAGATGATGAGAAGAGGG - Intergenic
1025653669 7:63498065-63498087 TAGAATAGATGATGAGAAGAGGG + Intergenic
1025703667 7:63843322-63843344 CAGCAAAGGTGGCAAGAAGAAGG + Intergenic
1026022326 7:66718850-66718872 CAGTGAAATTGATGAGAAGAGGG - Intronic
1026372504 7:69715629-69715651 CAGTCAAAATGGAGAGATGAAGG + Intronic
1026886750 7:73954168-73954190 CAGTGAAATTGATGAGAAGAGGG - Intergenic
1027126763 7:75562080-75562102 CAGTCAAAATGGTGTGAACAAGG - Exonic
1027386366 7:77663075-77663097 GAGGAAAGAAGGAGAGAAGAAGG + Intergenic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1027739959 7:81989044-81989066 AAGTAAAGATGGGAAGATGAGGG + Intronic
1027820871 7:83042886-83042908 CAGCAAAGATGATGACAACAGGG + Intronic
1027917446 7:84343666-84343688 CAGTATGGATGGGGAGAGGAGGG + Intronic
1028131956 7:87186011-87186033 GAGTAAATATGGTAAGAAAAGGG - Intronic
1029358741 7:100072603-100072625 CAGGACAGTTGGTGAGAAAAGGG + Intronic
1029633856 7:101770793-101770815 AAGGAAAGAAGGAGAGAAGAAGG - Intergenic
1029633858 7:101770812-101770834 AAGGAAAGAAGGAGAGAAGAAGG - Intergenic
1030006814 7:105128205-105128227 AAGGAAGGATGGTGACAAGATGG + Intronic
1030265118 7:107612823-107612845 CATGAAAGATGGGGAGAAGAGGG + Intronic
1031620914 7:123932551-123932573 AAGTAAAGAAGGTGAGATTAGGG - Intronic
1031832860 7:126648861-126648883 CAGTAAATATGGTGGGAATATGG - Intronic
1031978086 7:128106473-128106495 CAGGATGGATGGTGTGAAGATGG - Intergenic
1032364125 7:131283396-131283418 CAGTAAAGAGAGAGAGAGGAAGG - Intronic
1033010330 7:137615166-137615188 CACAAAGGATGGTGAGAGGAAGG - Intronic
1033032822 7:137844284-137844306 GAGGAAAGATGGTGAAAAGGAGG - Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033588938 7:142794960-142794982 CAGTAAAGAGTCTGAGAAGGTGG + Intergenic
1036445324 8:8817156-8817178 CAGTTTAGATGGAGAGAGGATGG - Intronic
1038048180 8:23784858-23784880 CAGTCAAGAGGATGAGAAGGAGG + Intergenic
1038324350 8:26561325-26561347 AGGTAAAGATGGAGAGGAGAGGG - Intronic
1038668483 8:29562437-29562459 CAGAAAAGAGGATGAGAAGATGG - Intergenic
1039750622 8:40475002-40475024 CAATAAAGAAGGAGAAAAGATGG + Intergenic
1040721573 8:50330493-50330515 CAGTTTGGAGGGTGAGAAGAAGG - Intronic
1041098726 8:54374924-54374946 CAGAGAAGATGGGGAGAGGAGGG + Intergenic
1043244759 8:77983453-77983475 CATTAAAGATGGTCAGACTATGG - Intergenic
1043677910 8:82982879-82982901 CAGAAAGGATGCTGAGGAGATGG + Intergenic
1044478282 8:92654243-92654265 TAGTAGAGAGGGGGAGAAGAGGG + Intergenic
1045507637 8:102789761-102789783 CAGATAAGAAGCTGAGAAGAGGG - Intergenic
1045724830 8:105159991-105160013 CATTAAAGAGGAGGAGAAGAGGG + Intronic
1045863622 8:106840256-106840278 CAATGAGGATGGAGAGAAGATGG - Intergenic
1046091980 8:109513813-109513835 CAGTGGAGGTGGTGAGAAGTGGG - Intronic
1048048914 8:130798732-130798754 CAGCATTGATGGTGAGAAAAAGG + Intronic
1048380084 8:133857867-133857889 CAGGGAAGATGGTATGAAGAAGG - Intergenic
1048529049 8:135230940-135230962 CAATAAAGAGGGAGATAAGAGGG - Intergenic
1049075779 8:140395084-140395106 TGGTAAAGATGGTCAGAAGCGGG - Intronic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1050422781 9:5484235-5484257 CATTATACATGTTGAGAAGATGG - Intergenic
1050580041 9:7044494-7044516 CAGTGATGATGGAGAGAACAGGG + Intronic
1051363747 9:16305149-16305171 CAGAAAACATGGTCAGAAGTGGG + Intergenic
1051672391 9:19524016-19524038 CAGTAAAGATGATGGGCACATGG + Intronic
1052072247 9:24095528-24095550 CAGTCAAAATGCTGAGAGGAAGG + Intergenic
1053025012 9:34722217-34722239 CAGTAGAGAGGGTGAGAAGTGGG + Intergenic
1053341100 9:37333278-37333300 CATTAAAGATATTTAGAAGATGG - Intronic
1053467130 9:38316727-38316749 CAGTGAAGATGGTAAGCTGATGG + Intergenic
1054957758 9:70932933-70932955 CAGAAGAGATGGTGAGAAGTAGG + Intronic
1056402578 9:86242243-86242265 CAGGAAAGAGGGAGAGAGGAGGG + Intronic
1057041283 9:91849414-91849436 CAGGAAAGTTGAAGAGAAGAGGG - Intronic
1058142627 9:101373830-101373852 CAGTATTGATGGGGAGAAAAGGG - Intronic
1058560962 9:106228840-106228862 CAGAAAGGAGGGTGAGAGGAAGG - Intergenic
1058843747 9:108934964-108934986 CAGTAGGGATGGCGAGAAGAGGG + Intronic
1058844634 9:108944719-108944741 CAGTAATAATGGAGAGAACAGGG + Intronic
1058955307 9:109941368-109941390 CAGAAATGGTGGTGAGGAGATGG + Intronic
1059254381 9:112915828-112915850 CAGGAAAGATTGTGGGCAGAAGG - Intergenic
1059627526 9:116083357-116083379 CATTAAAAATGGTGAAAAGGAGG + Intergenic
1059747432 9:117216855-117216877 CAGTAAAGGTGTTAAGGAGAGGG - Intronic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1060332832 9:122690636-122690658 CAGTAAAAGTGGTGCTAAGAGGG + Intergenic
1060550683 9:124483640-124483662 CAGTGATGATGGAGACAAGATGG - Intronic
1060956829 9:127647589-127647611 CAGAGGAGATGGTGAGAAGTGGG - Intronic
1062012767 9:134275822-134275844 CAGAAAAGATGGGGAGGGGAGGG + Intergenic
1062104683 9:134747312-134747334 CAGGAAGGATGCTGAAAAGAGGG + Intronic
1185576276 X:1175247-1175269 AAGGAAAGCAGGTGAGAAGAAGG - Intergenic
1186385151 X:9103548-9103570 CATAAAAGATGGTGAGACGTTGG + Intronic
1186401948 X:9268372-9268394 CAGTTCAGATGGGGTGAAGATGG - Intergenic
1186839557 X:13471468-13471490 CAGAGCAGATGGTGAGAGGAAGG + Intergenic
1188019993 X:25146554-25146576 GAGCAAAGATGGAGAGAGGATGG - Intergenic
1188058551 X:25571305-25571327 CAGCAAAGATGTGGAGAAAAGGG - Intergenic
1188465058 X:30470367-30470389 CAGTAGAAATGGTGAGTAGTGGG - Intergenic
1188728488 X:33615141-33615163 AAATAAAGATAGTGAGAAGAGGG + Intergenic
1188898338 X:35697591-35697613 AAGTAACGATGTTGGGAAGAGGG - Intergenic
1188938102 X:36202408-36202430 CAGTAGAAAAGGTGAGATGAGGG - Intergenic
1189382223 X:40510077-40510099 CAGTAAAGATGAGGACAGGAAGG + Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1192226887 X:69235043-69235065 CTGTAAGGATTGAGAGAAGAAGG + Intergenic
1193779041 X:85680665-85680687 CAGTAAAGAAGGTCAAAGGAGGG - Intergenic
1194965668 X:100285902-100285924 TGATAAAGATGGTGCGAAGATGG + Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1196886743 X:120252716-120252738 TTGTAAAGATGGAGAGATGAGGG + Intronic
1197180346 X:123528959-123528981 CAGTGAGGATGCTGAGAAAAGGG - Intergenic
1199532132 X:148861755-148861777 GAGTAAAGGTGGAGTGAAGATGG - Intronic
1200945213 Y:8828811-8828833 TGGTAGAGATGGTGAGAAGTGGG + Intergenic
1201299893 Y:12496444-12496466 CTGTAAAGACAGGGAGAAGACGG - Intergenic
1201604117 Y:15766213-15766235 AAGTAAAGATGGGAAGAGGAAGG - Intergenic
1201741247 Y:17326303-17326325 AAGTAAGGAAGGAGAGAAGAGGG + Intergenic
1202592947 Y:26506627-26506649 CAGCTATGATGGTGAAAAGAAGG + Intergenic