ID: 976541859

View in Genome Browser
Species Human (GRCh38)
Location 4:86286726-86286748
Sequence CCTCAAGTACTTCAGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976541853_976541859 23 Left 976541853 4:86286680-86286702 CCTGCCTTTAATCACAAGACTGT 0: 1
1: 0
2: 0
3: 20
4: 460
Right 976541859 4:86286726-86286748 CCTCAAGTACTTCAGGAATGAGG 0: 1
1: 0
2: 0
3: 9
4: 151
976541854_976541859 19 Left 976541854 4:86286684-86286706 CCTTTAATCACAAGACTGTGCAA 0: 1
1: 0
2: 1
3: 16
4: 287
Right 976541859 4:86286726-86286748 CCTCAAGTACTTCAGGAATGAGG 0: 1
1: 0
2: 0
3: 9
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976541859 Original CRISPR CCTCAAGTACTTCAGGAATG AGG Intronic
900500048 1:2999900-2999922 CCTCCAGTACTTGGGGAAAGTGG + Intergenic
910291902 1:85607482-85607504 CTGAAAGTATTTCAGGAATGTGG + Intergenic
911484936 1:98493560-98493582 CCTCAAGGAGTTCTGGGATGAGG + Intergenic
911780928 1:101877316-101877338 CAAGAAGTCCTTCAGGAATGAGG - Intronic
912538832 1:110396812-110396834 CCTCAAGCACTGCCAGAATGGGG + Intergenic
912871100 1:113307462-113307484 TCTCAAGTACCTCAGGGATCAGG - Intergenic
914884745 1:151575634-151575656 CTTCTAGAACTTCAGGAATTTGG + Intronic
915441307 1:155947150-155947172 CCTCAACTTCTTCAGAGATGTGG + Exonic
916510273 1:165467126-165467148 TCTCAACTACTCCAGGAAGGAGG - Intergenic
919850577 1:201669414-201669436 GCTCAAGTATTTGAGGAAAGTGG + Intronic
921521662 1:216163435-216163457 CCTCAAGTAATTCAGATATATGG - Intronic
924168018 1:241305668-241305690 CCTCAAGTTCATCAGGAAAAGGG - Intronic
1067004853 10:42651005-42651027 CCTCAAGGAATTCAGGAAACAGG + Intergenic
1077694859 11:4384846-4384868 TCTCAAGTATTTCAGGATTAAGG + Intergenic
1078764353 11:14279985-14280007 CCATCAGTAATTCAGGAATGAGG - Intronic
1079349380 11:19679869-19679891 CCTTAAATACCTGAGGAATGAGG + Intronic
1082160448 11:48883440-48883462 CCTCATGTTGTTCAGGAAGGAGG + Intergenic
1082161918 11:48896966-48896988 CCTCATGTTGTTCAGGAAGGAGG - Intergenic
1082236060 11:49821248-49821270 CCTCATGTTGTTCAGGAAGGAGG + Intergenic
1082239517 11:49855794-49855816 CCTCATGTTGTTCAGGAAGGAGG + Intergenic
1082242635 11:49888557-49888579 CCTCATGTTGTTCAGGAAGGAGG - Intergenic
1083152095 11:60798283-60798305 ACTCAAGTTCTCCATGAATGTGG - Intronic
1083170002 11:60918091-60918113 CCTCAATTACTTCAGTAAAATGG + Intronic
1089194921 11:116688611-116688633 CCCCCAGCACCTCAGGAATGTGG + Intergenic
1089927457 11:122273446-122273468 CCTCAAGGATTTCAGGCAAGAGG - Intergenic
1090275322 11:125414603-125414625 CCTCAGCTGCTTCAGGAAAGAGG + Intronic
1090779539 11:129995072-129995094 TCTCAAGTACTTTAGTACTGTGG - Intronic
1092694523 12:11154833-11154855 CCTCTGGTGCTTCAGGAAAGAGG + Intronic
1095961334 12:47836015-47836037 ACTCAGGTACCACAGGAATGCGG - Intergenic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1105636325 13:22219098-22219120 GCTCAAATGCTTCAGGAAGGTGG + Intergenic
1106347366 13:28892140-28892162 CCTCAAGGAGTCCAGGAATATGG - Intronic
1107348253 13:39486484-39486506 CCTCAAATATTTCAGGTTTGTGG - Intronic
1107478139 13:40760889-40760911 CTCCAAGAACTTCAGGAATTTGG - Intronic
1109330432 13:60922447-60922469 CCTCAAGTTCTTTAGTCATGGGG + Intergenic
1112507622 13:99984691-99984713 CCTCAAATTTCTCAGGAATGTGG - Intronic
1114215884 14:20657607-20657629 CCTCAAGCATTCCAGGGATGTGG - Intergenic
1114751919 14:25214242-25214264 CCTTAAGCACTGCAGGAATCTGG - Intergenic
1115231778 14:31168212-31168234 CCTCAAATACTTCTGGAAAAGGG + Intronic
1117072082 14:52066819-52066841 CCTTACTTTCTTCAGGAATGAGG + Intronic
1117781481 14:59237360-59237382 ACTTAAGTACTGCAGGATTGTGG + Intronic
1119592755 14:75905501-75905523 CCTGGAGTACTCCATGAATGTGG + Intronic
1119782345 14:77284971-77284993 CCTCAACTCCATCTGGAATGTGG - Exonic
1120742183 14:88120331-88120353 CATCAATTACCCCAGGAATGAGG - Intergenic
1126241962 15:46455253-46455275 CCTCCAGTTCTTCAGCACTGGGG - Intergenic
1126741674 15:51783158-51783180 CCTAAAGCCCTTCAGGAATTAGG + Intronic
1126977909 15:54206406-54206428 CCTGAACTACTTCAAGAAGGTGG - Intronic
1127241837 15:57124576-57124598 GCACAAGGACTTCTGGAATGTGG - Intronic
1130131748 15:81149389-81149411 CATCAAGTACTGCAGGATTTAGG + Intergenic
1131289877 15:91098546-91098568 ATTCAGGTATTTCAGGAATGAGG + Intergenic
1134639931 16:15822179-15822201 CCTCAAGAACTTCCAGAATTGGG + Intronic
1137491723 16:48938587-48938609 CCTCAAATAGTTCAAGAATATGG + Intergenic
1138075642 16:54039743-54039765 CTTCAAGAACTTCAGGGATCAGG + Intronic
1140726452 16:77817509-77817531 CCCTAACTACTTCAGGAATTGGG + Intronic
1143060493 17:4196543-4196565 CCTCAACTATTTCTGGAAAGGGG + Intronic
1150536921 17:66052601-66052623 ACTGAAGTAATTCAGGAAGGAGG - Intronic
1153005663 18:497053-497075 CTTCAAGTACTGCAGCAACGGGG + Intronic
1153961977 18:10147734-10147756 CGACCAGGACTTCAGGAATGAGG - Intergenic
1154340065 18:13495530-13495552 CATCTTATACTTCAGGAATGGGG - Intronic
1156601668 18:38614630-38614652 CCTCAAGGACTTTAGTAATGTGG - Intergenic
1158294703 18:55983100-55983122 GCACAAGGAATTCAGGAATGTGG - Intergenic
1162782024 19:13011485-13011507 CATCATGGACTTCAGGAGTGAGG + Intronic
1164683796 19:30153378-30153400 CCTCAGGGACTTCAGGGCTGGGG - Intergenic
1165258015 19:34591745-34591767 CCTCAGGTTCTTCAGGACTCAGG + Intergenic
1165987755 19:39785621-39785643 CCTCATGTTCCTCAGGAATTCGG - Intronic
1166583025 19:43919582-43919604 GCTGGAGAACTTCAGGAATGTGG - Exonic
1167049093 19:47067793-47067815 CCTCAAGGTCTTCAGGATGGAGG + Exonic
926494137 2:13563001-13563023 CCTTCAGAAATTCAGGAATGAGG + Intergenic
927351689 2:22124243-22124265 TCTCATCTACTTAAGGAATGTGG + Intergenic
928915207 2:36463262-36463284 CCACAAGTACTTCAATAATGAGG - Intronic
929968349 2:46552294-46552316 CCACACGTACTTGAGCAATGGGG - Intronic
932453894 2:71834091-71834113 ACTCAAAGACCTCAGGAATGAGG + Intergenic
932812372 2:74835405-74835427 TCTCAAGTAATCCAGGAACGCGG - Intronic
937458143 2:122061879-122061901 CCTTAAGTCTTTCAGAAATGGGG + Intergenic
943054312 2:182956873-182956895 CAGAAAGTACTTCAGGAATTGGG - Intronic
944884665 2:204050006-204050028 CCACATGGACTGCAGGAATGGGG - Intergenic
944980247 2:205109408-205109430 CCTTAAATACTGCAGGATTGAGG - Intronic
947506489 2:230712146-230712168 CCTCCTGTACGTCAGGGATGGGG - Intergenic
1169576283 20:6965496-6965518 CCTCATGGACTTAAGAAATGAGG + Intergenic
1170253957 20:14318904-14318926 CGTCAATTACTTCAAGACTGTGG - Intronic
1170909627 20:20552677-20552699 CCACAAGTACTGCAGGATCGTGG - Intronic
1171233493 20:23506443-23506465 CCTCATAAGCTTCAGGAATGGGG - Intergenic
1173703206 20:45091469-45091491 CCTCAGGAAATACAGGAATGAGG - Intergenic
1176205840 20:63887693-63887715 CCTCAATTAATCCAGGAATATGG - Intronic
1181434545 22:22902728-22902750 CCTCCAGCACATCAGGAATGTGG + Intergenic
1184422963 22:44392428-44392450 CCTCAAGGACTTCAGGACCTTGG + Intergenic
1184999293 22:48234132-48234154 ACACAAGTCCTGCAGGAATGCGG + Intergenic
951619357 3:24584084-24584106 CCTGAAGTACTTAAGCAAAGAGG + Intergenic
951789011 3:26459232-26459254 CATCAAGGACTTCAGCAAGGTGG - Intergenic
953502959 3:43455500-43455522 CCTTAAGTCCTTGAGGAATGGGG + Intronic
954361884 3:50126491-50126513 CCCCATGCACTCCAGGAATGTGG - Intergenic
955500958 3:59582339-59582361 CCTCATTTATTTCAGGAATTTGG + Intergenic
957453089 3:80404910-80404932 TCTCAATTTCTTCAGGAATTAGG + Intergenic
957859674 3:85929995-85930017 CCACAAGTACTACAGTAATGAGG - Intronic
958143982 3:89600492-89600514 CCTCCAGTGCTTGGGGAATGTGG - Intergenic
958804477 3:98793095-98793117 ACTTAAGTATTTCAAGAATGAGG + Intronic
961434274 3:126905881-126905903 CTTCAAGAACTGCAGGAATCAGG + Intronic
965421396 3:168463554-168463576 CATCAGGAACATCAGGAATGAGG + Intergenic
965828455 3:172754038-172754060 CCTCAAGTATCTCTGGAATCTGG - Intronic
966522855 3:180892274-180892296 TCTCAACTTCTTCGGGAATGAGG + Intronic
968146915 3:196307107-196307129 CCACAAGTACTTAATGAATATGG + Intronic
969226710 4:5803334-5803356 CCTCAAGTTCTTCAGGAGAAGGG - Intronic
969534906 4:7750166-7750188 ACGCAAGCACTTCAGTAATGGGG + Intergenic
973540610 4:51931627-51931649 CCTAATGTAACTCAGGAATGGGG + Intergenic
975808309 4:78136871-78136893 CCAAAAGTACTTCTGGCATGAGG - Intronic
976541859 4:86286726-86286748 CCTCAAGTACTTCAGGAATGAGG + Intronic
978854594 4:113380131-113380153 CGTCAAATACTTGTGGAATGAGG + Intronic
980213732 4:129823490-129823512 CCTGAACTACTTCAGAAATTTGG - Intergenic
980815747 4:137943389-137943411 TCTCACTTACTTCAAGAATGAGG - Intergenic
982341080 4:154299684-154299706 CCACAAATACTACAGAAATGTGG - Intronic
986238713 5:5937547-5937569 CCTCAAGCACTCCAGGCAGGAGG - Intergenic
992866791 5:80964814-80964836 ATTCATTTACTTCAGGAATGGGG + Intronic
993816813 5:92558728-92558750 CCTCCTGCACTGCAGGAATGAGG - Intergenic
993820092 5:92603549-92603571 TCTCAACTATTTCAGGATTGTGG - Intergenic
994548002 5:101192719-101192741 CCTCATGAGATTCAGGAATGAGG + Intergenic
996056149 5:118984855-118984877 CCTAAAATATTTCTGGAATGAGG + Intronic
999917270 5:156276477-156276499 CCTTCAGTGCTTCAGGAATAAGG + Intronic
1000637712 5:163662777-163662799 CCTCAAGTAGTTCTGGCAGGAGG + Intergenic
1001644749 5:173271655-173271677 CCTCAAGTGCTTCTGGAAGCAGG + Intergenic
1003119372 6:3307259-3307281 CCCCAAGTTCTGCTGGAATGTGG - Intronic
1003483539 6:6555042-6555064 CTTCAAGTACTTCTGGGAGGTGG - Intergenic
1003567113 6:7230916-7230938 CCCCAAGAACTTCAGGAAAGGGG + Exonic
1003977169 6:11355253-11355275 CCTTAAATCCTTCTGGAATGAGG + Intronic
1004606882 6:17203335-17203357 CCTCAATTCCTTGAGCAATGTGG - Intergenic
1005885971 6:30098096-30098118 CCTCAAGGACTGTAAGAATGAGG + Intergenic
1006797881 6:36742608-36742630 CCTCAGGTAATTCAGAAAGGTGG - Intronic
1007054816 6:38872083-38872105 CCAGAAGTACATCATGAATGAGG - Intronic
1007629842 6:43267166-43267188 CGCCAAGTACTTCAGGACAGCGG + Intronic
1009462450 6:63930745-63930767 CCTCCAATACTGCAGGAAAGTGG + Intronic
1011420878 6:87171361-87171383 CCTGAAGGACTTCAGGGTTGTGG + Intronic
1014643509 6:123944463-123944485 CCTGAACTAGTTGAGGAATGTGG - Intronic
1016030709 6:139334471-139334493 CCTCAAGTAGTTCACTAATGAGG + Intergenic
1019862441 7:3672156-3672178 CCTGAAGGACTATAGGAATGAGG + Intronic
1022597722 7:31728576-31728598 CCACAAATACCTGAGGAATGAGG - Intergenic
1026473537 7:70714687-70714709 CCGCAAGGACTTCCAGAATGTGG - Intronic
1027920048 7:84381444-84381466 TCTAAATTACTTCAAGAATGAGG + Intronic
1027938924 7:84647574-84647596 CCTCAAGTCTTTTAGGAAAGAGG - Intergenic
1029541525 7:101185625-101185647 CCACAGGAACTTCAGGAATCAGG + Intergenic
1029735699 7:102464790-102464812 CCCGAAGTCCTTCGGGAATGCGG - Exonic
1032706371 7:134423907-134423929 CCACAAGTACTTCCTCAATGGGG - Intergenic
1032974218 7:137203214-137203236 TCTCAACTACTTCAGGTAAGGGG + Intergenic
1034692900 7:153028188-153028210 CCAAAATTACTGCAGGAATGGGG + Intergenic
1035988901 8:4465816-4465838 CTTGAGATACTTCAGGAATGTGG - Intronic
1036010172 8:4713240-4713262 ACTCAAGTACAGAAGGAATGCGG + Intronic
1040872715 8:52117294-52117316 CCACAAAGACTTGAGGAATGAGG - Intronic
1041267203 8:56076756-56076778 CCTCAAATACTTAAAGGATGAGG - Intergenic
1043558040 8:81457091-81457113 ACTCAAGTCCTTTAGGAAGGTGG + Intergenic
1045774278 8:105783607-105783629 CCTTAAGTACTTCATGTAAGTGG + Intronic
1046635142 8:116666993-116667015 CCTCAAGTCCTTTGTGAATGGGG - Intronic
1049452188 8:142668100-142668122 CCTCAAGTACTGCTGGCCTGCGG - Intronic
1050494613 9:6227925-6227947 CATGAGGTACTTCAGGAAAGGGG - Intronic
1052821954 9:33144604-33144626 CCTCAAAAACTTCAGGAAACAGG + Intronic
1053023655 9:34713389-34713411 ACCCAGCTACTTCAGGAATGTGG + Intergenic
1053109063 9:35441176-35441198 CCTGAAGGAGTTCAGGATTGAGG + Intergenic
1053166120 9:35845358-35845380 CCTCAAATCCTTCTTGAATGAGG + Intronic
1057060337 9:91998539-91998561 CCTGAAGTTCTTCAGAAATCAGG + Intergenic
1059008628 9:110432378-110432400 CCTCAAGAACCTCAGGAATTTGG + Intronic
1059617204 9:115963799-115963821 CCATAACTACTTCAGCAATGTGG + Intergenic
1186452743 X:9687033-9687055 CCTGAATTACTTCAGAAGTGAGG - Intronic
1187883179 X:23864994-23865016 ACCCAAGAACTTCAGGAAGGAGG + Intronic
1193808982 X:86028903-86028925 CATCAAGGATTTCAGGAAAGGGG + Intronic