ID: 976542398

View in Genome Browser
Species Human (GRCh38)
Location 4:86293826-86293848
Sequence ATGGATTAGCACCATCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2431
Summary {0: 2, 1: 103, 2: 371, 3: 800, 4: 1155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976542398_976542403 17 Left 976542398 4:86293826-86293848 CCAAGAGGATGGTGCTAATCCAT 0: 2
1: 103
2: 371
3: 800
4: 1155
Right 976542403 4:86293866-86293888 CTATCTAAACACCTCCCACCAGG 0: 1
1: 1
2: 61
3: 879
4: 4496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976542398 Original CRISPR ATGGATTAGCACCATCCTCT TGG (reversed) Intronic
Too many off-targets to display for this crispr