ID: 976550012

View in Genome Browser
Species Human (GRCh38)
Location 4:86382817-86382839
Sequence CTGTTTTAGTTCAACGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 71}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976550010_976550012 15 Left 976550010 4:86382779-86382801 CCTCTGTTTTTCTGTTTCTCAGT 0: 1
1: 0
2: 11
3: 117
4: 1044
Right 976550012 4:86382817-86382839 CTGTTTTAGTTCAACGTGACAGG 0: 1
1: 1
2: 0
3: 8
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976550012 Original CRISPR CTGTTTTAGTTCAACGTGAC AGG Intronic
902204753 1:14860005-14860027 CTGCTCTTGTTCAAAGTGACTGG - Intronic
907632245 1:56094416-56094438 CTGTTTTATTTCAACATAAATGG + Intergenic
911229871 1:95349605-95349627 CTATTTTATTTCAAGTTGACAGG - Intergenic
920114374 1:203609652-203609674 CTGATTCAGTTCAAGGTGGCTGG + Intergenic
920619590 1:207531652-207531674 ATGTTTTAATTCACTGTGACAGG + Intronic
920621372 1:207550207-207550229 ATGTTTTAATTCACTGTGACAGG + Intronic
922896098 1:229101684-229101706 CTTTATTAGCTCCACGTGACTGG + Intergenic
1063632192 10:7744856-7744878 CTGTTTTACTTCATCGTGTTTGG + Exonic
1064274465 10:13893263-13893285 CTGTGTTATTTCAAGCTGACTGG + Intronic
1068582976 10:58763733-58763755 CTCTTTAATTTCAACGTGCCAGG - Intronic
1069906537 10:71735630-71735652 CTTTTTTAGGTTAATGTGACAGG - Intronic
1072075346 10:91966654-91966676 CAGTTTTAGTTCCACGTGTCTGG + Exonic
1085931747 11:81091701-81091723 CTGCTTCAGTTCAGTGTGACAGG - Intergenic
1086047305 11:82548057-82548079 CTCTTTTGGTTGAAAGTGACAGG - Intergenic
1099716399 12:86298714-86298736 CTGTTTTATTTCAACACAACAGG - Intronic
1099729446 12:86480941-86480963 TAGTTTTACTTCAAAGTGACTGG - Intronic
1101206616 12:102494710-102494732 CATTTTTAGTTCAAAGTGTCTGG + Intergenic
1104073020 12:125363051-125363073 TTGTTTGTGTTCAACGTGGCAGG - Intronic
1104162667 12:126194758-126194780 CTTTTATCGTTCAACGTGAAAGG - Intergenic
1104856173 12:131903480-131903502 CTGGTGTAGTTCAACTTCACAGG + Intronic
1106105291 13:26727820-26727842 CTGTGTTAGTTCAAGGTGAAGGG + Intergenic
1106381819 13:29246559-29246581 CTGTTTGAGTTCAACTTGGTAGG - Intronic
1106493521 13:30251685-30251707 CTGTTTTATTTCAGTGTGTCTGG - Intronic
1107246264 13:38299816-38299838 TTTTCTTAGTTCAACATGACTGG - Intergenic
1108023175 13:46150313-46150335 CTGTTTTCTTTCACCTTGACAGG + Intronic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1110759373 13:79214101-79214123 CTGTTTTACTTCTACCAGACTGG - Intergenic
1113541707 13:111114911-111114933 CGGTTTTATTTCAAGGTGGCGGG - Intronic
1115345819 14:32342416-32342438 CTGTTTTGTTTCTAAGTGACTGG + Intronic
1118416431 14:65541752-65541774 ATTTTTTATGTCAACGTGACTGG - Intronic
1120379778 14:83761964-83761986 CTGTTTTATTTCAACATGATTGG - Intergenic
1125913697 15:43465437-43465459 CTCTTTTAGTTCAACTTGCTGGG - Intronic
1127203031 15:56678310-56678332 CTGTTTTAGTTAAAAATCACAGG - Intronic
1127965197 15:63918011-63918033 CAGTGTTTGTTCAACGGGACTGG + Intronic
1135962825 16:27012034-27012056 CTGTTTTGGTTGCAAGTGACAGG - Intergenic
1139735881 16:68987781-68987803 CTGTGTTTGTTCAAAGTGAATGG + Intronic
1141867328 16:86759770-86759792 CTGTTTTAGTGCAAAAGGACGGG + Intergenic
1149266098 17:54929514-54929536 ATGTTTAAGTACAACGTAACAGG + Intronic
1155730107 18:29146241-29146263 CTGTCATAGTTTAATGTGACAGG + Intergenic
1155936142 18:31756469-31756491 CAGTGTTAGTTCAACATGATTGG + Intergenic
1165893628 19:39129062-39129084 CTGTTTTTGTTCAACATTATAGG + Intronic
926727347 2:16008866-16008888 GTGTATTTGTTCAACGTTACAGG + Intergenic
929073024 2:38053019-38053041 CTGTTATAGTTCAAGGTAGCAGG + Intronic
932497180 2:72151684-72151706 CTGTTTTAGGTCAGGGTTACAGG - Intergenic
933161003 2:79025365-79025387 TTGTTTTTGATCAACGTGCCAGG - Intergenic
934939185 2:98487991-98488013 CTGTTTTAGTTGGATATGACAGG + Intronic
936690899 2:114887252-114887274 ATGATTTAGTTCAAAGTGACTGG + Intronic
943404543 2:187463373-187463395 CTGTTTTATTTCAAACTGATTGG + Intergenic
1171278029 20:23875184-23875206 CTATTTTAGTTCAAAGAGAAGGG - Intergenic
1175624348 20:60477993-60478015 ATGTTTTATTTCATTGTGACAGG - Intergenic
953458096 3:43060072-43060094 CTGTTTTATTTCAAAGCGGCTGG - Intronic
955962589 3:64356030-64356052 GTGTGTTATTTCAACGTGCCAGG + Intronic
956581028 3:70813552-70813574 CTGATTAAGTTTACCGTGACTGG - Intergenic
959709475 3:109370693-109370715 CTTTTTGAGCTCAACATGACTGG + Intergenic
960739570 3:120818255-120818277 TTGTTTTAGTGCAAAGTGAAGGG - Intergenic
970197742 4:13569273-13569295 CTGTTTTGTGTCAACGTGGCTGG + Exonic
974629078 4:64459418-64459440 CTTGTTCAGTTCAAGGTGACAGG - Intergenic
975396058 4:73874589-73874611 CTGTTTTACTTCAACGTGACTGG + Intergenic
976550012 4:86382817-86382839 CTGTTTTAGTTCAACGTGACAGG + Intronic
977004986 4:91555936-91555958 CCGTTTCATTTCAATGTGACAGG - Intronic
978264163 4:106802646-106802668 CTGTTATAGTTCAATGTTATAGG + Intergenic
983835470 4:172378117-172378139 CTCTTTTGGTTAAAGGTGACTGG - Intronic
991603514 5:68377367-68377389 TTGTTTTAGTTTTACCTGACTGG + Intergenic
996958137 5:129210048-129210070 CTGCTTTAGCTCAAAGTGACAGG - Intergenic
1012797751 6:103784864-103784886 TTGTTTCAGTTCAAAGTAACGGG - Intergenic
1018780599 6:167060705-167060727 CTATTTTATTCCAAAGTGACTGG - Intergenic
1020491235 7:8786691-8786713 CTGTTTTAGTTCAAAGGGAATGG - Intergenic
1024193751 7:47038678-47038700 CTGTTTTTGTTCAGGGTGTCTGG + Intergenic
1024453034 7:49570686-49570708 CTGTTTTAGTTCATCCTTATTGG - Intergenic
1027735582 7:81928811-81928833 CTTTTTAAATTCAAAGTGACAGG + Intergenic
1027900404 7:84106689-84106711 CTGTTTTCCTTCAAAGTGATGGG + Intronic
1031196516 7:118621228-118621250 CTGTTGTAGATCAACCTGTCTGG + Intergenic
1047290474 8:123525140-123525162 ATGTTTTAGTTTAAGTTGACTGG - Intronic
1047534567 8:125707828-125707850 CTTTTTTAGCTCAAAGTTACAGG - Intergenic
1048906923 8:139097382-139097404 CTGTTATAGTTCAAAATGACTGG + Intergenic
1058202373 9:102060208-102060230 CTGTTTTAGTTGGAACTGACAGG - Intergenic
1060916363 9:127393701-127393723 CTGTTTCAGTTCACCGTGATTGG + Intergenic
1186803724 X:13118556-13118578 CTGTTTTATCTAAACGTGAAAGG + Intergenic
1192829530 X:74736745-74736767 ATGTTTCAGTACAAAGTGACTGG + Exonic
1197244052 X:124149991-124150013 GTGGTTTAGTTCAAGTTGACAGG + Intronic
1202021276 Y:20467308-20467330 CTGTTTTTGTTCAAAGTTCCAGG + Intergenic