ID: 976551190

View in Genome Browser
Species Human (GRCh38)
Location 4:86397217-86397239
Sequence TAAGAAGCACCCTGTGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976551188_976551190 1 Left 976551188 4:86397193-86397215 CCTCAGTGAGAAGAAATTATAAA 0: 1
1: 2
2: 6
3: 83
4: 662
Right 976551190 4:86397217-86397239 TAAGAAGCACCCTGTGTGGTTGG 0: 1
1: 0
2: 0
3: 13
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976551190 Original CRISPR TAAGAAGCACCCTGTGTGGT TGG Intronic
900632917 1:3646956-3646978 TAAAAGACACCCTGTGTGATCGG - Intronic
900778871 1:4604317-4604339 TTGGAAGCACCATGTGAGGTGGG + Intergenic
902165563 1:14568625-14568647 TAAGAATCCCCATGTGTTGTGGG - Intergenic
902228817 1:15014345-15014367 TTAGAAGCACCCTGCAAGGTGGG - Intronic
902741465 1:18441454-18441476 TGACAAGCACCCTGTGAGGCAGG + Intergenic
903201803 1:21746530-21746552 TAAGACTCAACCTGTTTGGTAGG + Intronic
904890208 1:33773957-33773979 ACAGAAGCCCCCAGTGTGGTAGG - Intronic
905770330 1:40633820-40633842 TTACAACCACTCTGTGTGGTAGG + Intronic
907618439 1:55949671-55949693 TATTAATAACCCTGTGTGGTAGG - Intergenic
908339518 1:63162196-63162218 TACCAAGCACCCTGTATGGAAGG + Intergenic
909417868 1:75427902-75427924 TAAGAAGCACCATGTGCTATAGG - Intronic
909833387 1:80222632-80222654 TAACAATAATCCTGTGTGGTAGG - Intergenic
910227243 1:84948189-84948211 TAAGCAGCAGGCTGTGTGGCAGG - Intronic
910920707 1:92343313-92343335 TCACAAGAACCCTGTGAGGTGGG + Intronic
912988289 1:114457028-114457050 TAAGAAGCCCAGTGTTTGGTTGG + Intronic
913263522 1:117022809-117022831 TAAGGAGCTCCCAGTCTGGTGGG + Intronic
918161067 1:181900228-181900250 CAACATGCACCCAGTGTGGTTGG - Intergenic
919011307 1:191968711-191968733 TAATAATAACCCTGTGAGGTAGG - Intergenic
922502532 1:226107994-226108016 AAAGCAGCACCCTGCGGGGTGGG - Intergenic
922555930 1:226531931-226531953 TCACAAGCACCCTATGAGGTAGG - Intergenic
923517190 1:234707646-234707668 CAAGAGCCACCCTGTGGGGTTGG - Intergenic
923761013 1:236844112-236844134 GAAGGAGCAGCCTGTATGGTAGG + Intronic
924432731 1:244010345-244010367 TCCGGAGCACCCCGTGTGGTTGG + Intergenic
1064036393 10:11916798-11916820 TAAGAAACACATTGGGTGGTAGG + Intergenic
1065940765 10:30562316-30562338 GAAGAGGAACCCTGTATGGTAGG - Intergenic
1067087640 10:43251268-43251290 TGAAAAGCACCCTGTGGGTTCGG + Intronic
1067299449 10:44995462-44995484 TAAGTACCAGCCTGTTTGGTTGG + Exonic
1068601201 10:58958491-58958513 TAAGAACAACCCTGAATGGTTGG - Intergenic
1069209424 10:65737435-65737457 TAAGAATCACCCTGGCTGCTAGG - Intergenic
1069564854 10:69457046-69457068 AATGATTCACCCTGTGTGGTGGG - Intronic
1070505379 10:77108181-77108203 ACAGAAGCACCCGGTGGGGTTGG + Intronic
1071900124 10:90111870-90111892 CATGAATCACCCTGTGTGGGTGG + Intergenic
1072790753 10:98316018-98316040 TGAGAAGCACACAGTGTGCTTGG - Intergenic
1073829639 10:107367594-107367616 AAAGAAGCACACTGTGTGATTGG - Intergenic
1074671055 10:115791439-115791461 TAAGAAGCTCCCTGGGTGTTCGG + Intronic
1074879116 10:117638616-117638638 TAAGATGAACCCTGTGGTGTTGG - Intergenic
1075173433 10:120137179-120137201 AAAAAAGCACTCAGTGTGGTTGG - Intergenic
1075600452 10:123763972-123763994 TAAAAAGCCCCCAGTGTGGGAGG - Intronic
1078199991 11:9172475-9172497 TAATAATCCCCATGTGTGGTGGG + Intronic
1078418396 11:11184941-11184963 TTAGAATGACCCTGTGTGGCAGG - Intergenic
1079388166 11:19998989-19999011 TAATAAGCACCCTCTCTGGACGG - Intronic
1079502070 11:21112091-21112113 CAGGAAGCAACCTCTGTGGTTGG + Intronic
1082933319 11:58631448-58631470 TCACAAGAACCCTGTGAGGTAGG + Intergenic
1083758023 11:64801835-64801857 GAAGAAGCAGCCTGAGTGGGGGG - Intronic
1083775672 11:64893387-64893409 TAAGAGGCTTCCTGAGTGGTAGG - Intergenic
1086281873 11:85199613-85199635 TAAGAATCACCTTGAGTGGTTGG - Intronic
1086295321 11:85360635-85360657 GAAGGAGCCTCCTGTGTGGTGGG - Intronic
1086446488 11:86876455-86876477 TCAGAATAACCCTGTGAGGTAGG - Intronic
1089906572 11:122046310-122046332 AAAGGAGCTCCCAGTGTGGTGGG + Intergenic
1094733582 12:33206916-33206938 TAAGAAGCATACTGTGGGCTGGG + Intergenic
1096427558 12:51516991-51517013 TTAGACGCATCCTGTGGGGTTGG + Intergenic
1097692527 12:62746777-62746799 CCAGTAGCACCCTGTGTGTTGGG - Intronic
1097937884 12:65274113-65274135 TGCTAAGCACCATGTGTGGTAGG + Intergenic
1098497694 12:71155550-71155572 TAAGGTCCACACTGTGTGGTTGG - Intronic
1100731483 12:97475406-97475428 GAAGCAGCAACCTCTGTGGTAGG + Intergenic
1101074183 12:101111243-101111265 TAAGGAGCTCCCAGTCTGGTGGG + Intronic
1101129248 12:101671919-101671941 TCAGAAACACCCTGTGAGGCAGG + Intronic
1104698125 12:130879937-130879959 TAAGAAGCCCACTGCGTGGGTGG - Intergenic
1106279662 13:28254317-28254339 TCACAACCACCCTGTGAGGTAGG - Intronic
1112455570 13:99559163-99559185 TAAGAAGCACCCACTGTCTTTGG - Intronic
1113606691 13:111612959-111612981 TCACAAGCACCCTGGGAGGTAGG - Intronic
1116797753 14:49410171-49410193 AAAGGAAAACCCTGTGTGGTAGG - Intergenic
1117432528 14:55682617-55682639 TCACAACCACCCTGTGTGTTAGG + Intronic
1118612286 14:67551094-67551116 TAAGACTCACACTGTGTTGTGGG - Intronic
1119939350 14:78624372-78624394 TAATAAGCACCCAGTGTGTCAGG - Intronic
1120751914 14:88205467-88205489 GAAGGAGCACACTGTGTAGTAGG - Intronic
1121431204 14:93889660-93889682 TCACAACCACCCTGTGAGGTAGG - Intergenic
1121595497 14:95158589-95158611 TTAGGTGCACCCTGTGAGGTAGG + Intergenic
1122783940 14:104155390-104155412 TAGGAAGCTCCCCGTGGGGTGGG + Intronic
1124396419 15:29305947-29305969 AAAGAAGCAGCCAGTGAGGTAGG + Intronic
1127289044 15:57554200-57554222 TAATCTGCACCCTGTGAGGTAGG + Intergenic
1133838690 16:9389005-9389027 TAAGAAACACCCTGAGTGAGGGG + Intergenic
1133971490 16:10571381-10571403 TAAGGTGCCCCCAGTGTGGTTGG - Intronic
1134104736 16:11477468-11477490 TAAGAAGCACCAGGCTTGGTTGG + Intronic
1136553382 16:30993658-30993680 TCACAACCACCCTGTGAGGTGGG - Intronic
1137977595 16:53044320-53044342 TAAGGAGCCCCCTGTGGGGTGGG + Intergenic
1138086843 16:54141191-54141213 TAAGAAGGAAGATGTGTGGTTGG + Intergenic
1138101220 16:54253671-54253693 TCAGAAGAAGCCTGTGTTGTAGG - Intronic
1138204006 16:55111286-55111308 GAAAAAGCAGCCTGTGTGTTGGG - Intergenic
1138227948 16:55314776-55314798 TCAGAAGAAACCTGTGTGGCAGG + Intergenic
1142467800 17:146096-146118 CAAGAATCACCCTGGCTGGTGGG - Intergenic
1143406989 17:6684218-6684240 TAAGAAGCAAAGTGTTTGGTTGG - Intergenic
1143621454 17:8082890-8082912 TAAGAAGCACCCTATGAGGCAGG + Intronic
1143726015 17:8847125-8847147 TGACAAGCACCCTGTGAGTTTGG + Intronic
1144005559 17:11096118-11096140 TAAGCAGGACACTATGTGGTAGG + Intergenic
1144864752 17:18328211-18328233 CAAGATGCACCCAGTATGGTGGG - Exonic
1145107754 17:20134194-20134216 TAGAAAGAACCCTGAGTGGTTGG - Intronic
1146539354 17:33681022-33681044 TAAGAAACTCCCTATCTGGTTGG - Intronic
1147042439 17:37729083-37729105 TCACATGCACCCTGTGTGGAAGG + Intronic
1153517533 18:5918045-5918067 TATGGAGCACACTGTGTGCTGGG - Intergenic
1155991216 18:32281392-32281414 AATGAAGCACACTGTGTTGTTGG - Intronic
1157551172 18:48582767-48582789 TTAGAACAACCCTGTGGGGTTGG + Intronic
1158441945 18:57483409-57483431 TAAAAAGCATTCTGTGGGGTGGG - Exonic
1158456889 18:57616128-57616150 TAAGAAGCACACTGGTTGGCTGG + Intronic
1158908011 18:62032764-62032786 TTATAAGAACCCTGTGAGGTAGG - Intergenic
1159985530 18:74836485-74836507 TAAGCAGCATGCTGTGTGCTGGG - Intronic
1160468228 18:79101182-79101204 CAGGAAGCTCCCTGTGGGGTTGG - Intronic
1163337425 19:16682399-16682421 TCAGAAGCACCCTGTCCTGTAGG + Exonic
1163523350 19:17805392-17805414 TAAGAAGTCCCCTGTGGGCTGGG - Intronic
1165466003 19:35975166-35975188 GAAGAAGCAGCCTGTGTCGCAGG - Intergenic
1166518238 19:43463056-43463078 TCTGAAGCACCCTGGGCGGTAGG - Intronic
925851207 2:8083914-8083936 GAAGAAACAGCCTGAGTGGTGGG - Intergenic
928088063 2:28358064-28358086 TAAAAAACAACCTGTGAGGTGGG - Intergenic
928995213 2:37282136-37282158 TAAGAACAACCCTTTGAGGTAGG - Intronic
929077600 2:38091320-38091342 TCAAAACCACCCTCTGTGGTTGG - Intronic
934487650 2:94731708-94731730 TCAGAACAACCCTGTGAGGTAGG - Intergenic
936507019 2:113116056-113116078 TCACAAGCACCTTGTGAGGTGGG + Intronic
938392044 2:130914479-130914501 TAAGCAGCACCCTGTGTGTCGGG - Intronic
938653963 2:133411891-133411913 TAAGAATCACCATGTCTGCTAGG + Intronic
940197768 2:151114517-151114539 TGAGCAGCACCCTGTTTGGATGG + Intergenic
940481897 2:154243225-154243247 TGACAACCACCCTGTGAGGTAGG + Intronic
941854440 2:170216370-170216392 TAAGAAGAACCCTCCGTGTTAGG + Intronic
943184933 2:184596491-184596513 GAAGAAGCACCATGTGTGAAAGG - Intergenic
946902929 2:224389793-224389815 TAAAAATCACCTTGTGGGGTTGG - Intronic
1169480755 20:5978356-5978378 TAGTAAGCTCCCTGTATGGTGGG + Intronic
1169800005 20:9505235-9505257 TCACAAACACCCTTTGTGGTGGG + Intergenic
1172005658 20:31817600-31817622 TCAGAAGAACCCAGTGCGGTAGG - Intergenic
1172238317 20:33393780-33393802 TCACAACAACCCTGTGTGGTTGG - Intronic
1174237042 20:49102602-49102624 AAAGCAGCTCACTGTGTGGTTGG + Intergenic
1174892618 20:54412919-54412941 TTAGAAGCATCCTGTAGGGTAGG + Intergenic
1174892661 20:54413350-54413372 TTAGAAGCATCCTGTAGGGTAGG - Intergenic
1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG + Intronic
1176922481 21:14704834-14704856 CAGGAAGGATCCTGTGTGGTTGG - Intergenic
1177508393 21:22049422-22049444 TAAAAAGCACACTCTGTAGTTGG + Intergenic
1178631626 21:34266070-34266092 TAAGAAACACCTTGTATAGTTGG + Intergenic
1179081851 21:38178760-38178782 GAAGAAGAACACTGTTTGGTGGG + Intronic
1180045947 21:45305257-45305279 CGAGAAGCACCCTGTGTGGCTGG - Intergenic
1181595000 22:23908391-23908413 TGAGGACCACCCTGTGAGGTAGG + Intergenic
1182362688 22:29756293-29756315 TCAGAACCACCCTGTGGGGGTGG + Intronic
949181455 3:1136188-1136210 TTAGGAGCAGTCTGTGTGGTAGG + Intronic
949509745 3:4757690-4757712 TCAGAAGCACCCCATGGGGTAGG - Intronic
952952190 3:38533869-38533891 TAAGAAGCACTGTGTGTGCCAGG - Intronic
954396747 3:50297099-50297121 GAAGCAGCACCCGTTGTGGTGGG - Exonic
955815874 3:62842237-62842259 TCAGAAGAACCCAGTGAGGTAGG + Intronic
956184808 3:66552232-66552254 TCACAATCACCCTGAGTGGTTGG + Intergenic
956708414 3:72019405-72019427 TAAGTAGCACCCTCTTTAGTTGG + Intergenic
959496350 3:107057136-107057158 TCAAAACCACCCTATGTGGTTGG + Intergenic
959622569 3:108414054-108414076 TAAGAAGCACACTCTGTAGAGGG - Intronic
961970879 3:130965866-130965888 TATGAAGCAGGCTGTGTGCTAGG - Intronic
962117249 3:132524018-132524040 TAAGGAGAAACCTGTGTGTTCGG + Intronic
963808683 3:149752812-149752834 TCAGAAGAACCCTATGAGGTAGG + Intergenic
963829231 3:149989486-149989508 CAAAATGCACCCTGTGTGCTGGG + Intronic
967657468 3:192068830-192068852 TAGGAGGAGCCCTGTGTGGTTGG + Intergenic
968089928 3:195893375-195893397 TAGGAGGCACCCTGGGTGTTTGG - Intronic
969401946 4:6961573-6961595 GAGGGAGCAGCCTGTGTGGTAGG + Intronic
969578327 4:8049150-8049172 CAAGGAGCCCCCTGTCTGGTGGG - Intronic
970884057 4:20966890-20966912 TCAGAAGCACTCTGTGAAGTTGG + Intronic
971223687 4:24732430-24732452 TAAGAAGCACACAGTCTAGTGGG + Intergenic
973206960 4:47571615-47571637 TAAGAAGCTTCCTGTGTTGGGGG + Intronic
976308561 4:83586345-83586367 TCAGAAGGACCCTGTGTGTCTGG - Intronic
976551190 4:86397217-86397239 TAAGAAGCACCCTGTGTGGTTGG + Intronic
978396632 4:108287327-108287349 TAACAAGAATCCTGTGAGGTAGG - Intergenic
979341751 4:119533287-119533309 TAAGAAGTATCCTGTGAGGTAGG - Intronic
980274035 4:130624822-130624844 TAAGAAAATCCATGTGTGGTAGG - Intergenic
989242283 5:39215425-39215447 TGAGAAGCACATTGTGTGGTAGG + Intronic
991249744 5:64546351-64546373 GAAGCAGCACCCTGAGAGGTAGG + Intronic
991366048 5:65869190-65869212 TCAGAATCACCCTCTGAGGTAGG - Intronic
997495435 5:134320276-134320298 TGAGAAGCTCTTTGTGTGGTGGG - Intronic
999247951 5:150165430-150165452 GCAGAAGCACCCTGTGGGATTGG - Intergenic
1000422914 5:161058364-161058386 AAAGAAGCACAATGTCTGGTGGG - Intergenic
1001431646 5:171667232-171667254 TCACAAGCACCCTGTGAAGTAGG - Intergenic
1002585377 5:180243456-180243478 TAACAAGCACCCTGTGGAATAGG - Intronic
1006402244 6:33824707-33824729 TAAGGAGCTCCCAGTGTGTTTGG + Intergenic
1007962110 6:45969403-45969425 GAAGAAGCACCCTTTTTGGAAGG + Intronic
1008430628 6:51412822-51412844 TATGAAGAAGGCTGTGTGGTGGG + Intergenic
1008925362 6:56886383-56886405 GAACAAACACCCTGTGTGTTGGG - Intronic
1009840124 6:69060439-69060461 TATGAAGCTCCCTGTGTGTTTGG - Intronic
1011206720 6:84906933-84906955 TCAAAAGGACTCTGTGTGGTTGG - Intergenic
1011554468 6:88560257-88560279 TCAGAATGACCCTGTGAGGTTGG + Intergenic
1011914707 6:92488948-92488970 TTAAAAGCTCCCTCTGTGGTGGG + Intergenic
1014687403 6:124519295-124519317 TAAGAAGCACACTGGCTGGATGG + Intronic
1017128935 6:151091450-151091472 TCAGAAGCCCCCTGTGTGCTGGG - Intronic
1017280599 6:152620216-152620238 GAAGCTGCAGCCTGTGTGGTAGG - Intronic
1017430358 6:154364737-154364759 AAAGAAGGACCCTGAGAGGTCGG + Intronic
1017479782 6:154840971-154840993 TCAGAAATACCCTATGTGGTAGG + Intronic
1017624898 6:156338392-156338414 TAAGAAGCACCAGATGGGGTAGG - Intergenic
1018800931 6:167221804-167221826 AAAGAAGCACACAGTGGGGTTGG + Intergenic
1019534052 7:1518822-1518844 TCAGAAGCTCCCTGAGTGGCTGG - Intergenic
1019832334 7:3344944-3344966 AAAGCACTACCCTGTGTGGTAGG - Intronic
1025245233 7:57312201-57312223 TCACAACCACCCTGTGAGGTAGG + Intergenic
1025263781 7:57439624-57439646 TAGTCAGCACCCTGTGGGGTGGG + Intergenic
1026342949 7:69449673-69449695 TAAGAACAACACTGTGAGGTAGG - Intergenic
1026418638 7:70209796-70209818 TAAGAAACACCTTGGGTGCTAGG - Intronic
1027135720 7:75622621-75622643 AAAGAAACAGCCTGTGAGGTTGG + Intronic
1027433639 7:78140853-78140875 TAAGAAACTCACTGTCTGGTTGG + Intronic
1027468694 7:78546839-78546861 TCAGAACAACTCTGTGTGGTAGG - Intronic
1028960149 7:96739639-96739661 TAAGAATCACCTTTTGTTGTTGG + Intergenic
1029703824 7:102265057-102265079 TAAGAAACAGACTGTGTGGCCGG + Intronic
1031374243 7:121004627-121004649 TGAGAAGCACATTTTGTGGTTGG + Intronic
1032654085 7:133908632-133908654 TCACAACCACCCTGCGTGGTAGG - Intronic
1032842037 7:135721943-135721965 TAGGAATCACTATGTGTGGTGGG + Intronic
1035882382 8:3256588-3256610 TAAGAAACAGCCAGTGTTGTTGG - Intronic
1039757836 8:40542129-40542151 AAAGAAGCACTGTATGTGGTAGG + Intronic
1040982000 8:53253424-53253446 TAAGGAGCATCCTGGGTAGTGGG + Intergenic
1042098339 8:65244266-65244288 TATAGGGCACCCTGTGTGGTAGG + Intergenic
1043000500 8:74754137-74754159 TCAGAACCACCCTATGAGGTAGG - Intronic
1045388593 8:101693303-101693325 AAAAAAACGCCCTGTGTGGTGGG - Intronic
1045424051 8:102045388-102045410 TCATAAGCACCCGGTATGGTAGG - Intronic
1046810136 8:118524387-118524409 GAAGGAGCAACCAGTGTGGTAGG - Intronic
1047029247 8:120858787-120858809 TAATAACCACCTTGTTTGGTTGG + Intergenic
1048044357 8:130759271-130759293 TGAGACGCAGCATGTGTGGTGGG + Intergenic
1048107012 8:131421915-131421937 TCACAATCGCCCTGTGTGGTGGG - Intergenic
1049359736 8:142206814-142206836 CCAGAAGCTCCCAGTGTGGTGGG - Intergenic
1051330187 9:16016643-16016665 TAAGAAGCAGCATGTGTTGCTGG + Intronic
1052774243 9:32717936-32717958 TAGGAAGCACCCTGAGAGGAGGG - Intergenic
1053270228 9:36744625-36744647 TAGGAAGCGCCCTGTGTTGCTGG - Intergenic
1053670151 9:40352706-40352728 TCAGAACAACCCTGTGAGGTAGG + Intergenic
1053919940 9:42978963-42978985 TCAGAACAACCCTGTGAGGTAGG + Intergenic
1054381273 9:64492694-64492716 TCAGAACAACCCTGTGAGGTAGG + Intergenic
1054514463 9:66023591-66023613 TCAGAACAACCCTGTGAGGTAGG - Intergenic
1056665468 9:88577846-88577868 TAACAAGAATCCTGGGTGGTTGG + Intronic
1057062396 9:92017237-92017259 TCAGAATCACCCTGTGAGGTAGG + Intergenic
1060103776 9:120861227-120861249 TAGGAGGCAGCCTGTGTGGGAGG - Intronic
1061017844 9:127992798-127992820 TCAGAAGAACCCTGTGAGGCTGG - Intergenic
1062059414 9:134486873-134486895 GAAGAGGCACCCTGCGAGGTAGG - Intergenic
1062214476 9:135381752-135381774 AAAGAAGCACAGTGTGTGGTGGG - Intergenic
1185853764 X:3513215-3513237 TCAGAAGCACCCTGGGCGGATGG + Intergenic
1186004793 X:5057559-5057581 AATGAAGCATCCTGTGTGATTGG + Intergenic
1192195755 X:69026990-69027012 TCAAAACCACCCTGTGAGGTAGG + Intergenic
1192823570 X:74669933-74669955 TAAGGAATACCCTGTGTAGTAGG - Intergenic
1197174992 X:123476183-123476205 TGAGAAGCACACAGTGTAGTGGG + Intronic
1198701766 X:139404781-139404803 TCAGAATAATCCTGTGTGGTAGG + Intergenic