ID: 976554946

View in Genome Browser
Species Human (GRCh38)
Location 4:86439450-86439472
Sequence TGGTACATCCATAAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976554946_976554953 30 Left 976554946 4:86439450-86439472 CCTTCCACTTTATGGATGTACCA 0: 1
1: 0
2: 3
3: 6
4: 127
Right 976554953 4:86439503-86439525 CATTTGGGTTGTTTCCAATTTGG 0: 14
1: 144
2: 528
3: 998
4: 1470
976554946_976554952 15 Left 976554946 4:86439450-86439472 CCTTCCACTTTATGGATGTACCA 0: 1
1: 0
2: 3
3: 6
4: 127
Right 976554952 4:86439488-86439510 TTCATCAGATGAGAACATTTGGG 0: 1
1: 0
2: 4
3: 52
4: 471
976554946_976554951 14 Left 976554946 4:86439450-86439472 CCTTCCACTTTATGGATGTACCA 0: 1
1: 0
2: 3
3: 6
4: 127
Right 976554951 4:86439487-86439509 ATTCATCAGATGAGAACATTTGG 0: 1
1: 0
2: 1
3: 30
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976554946 Original CRISPR TGGTACATCCATAAAGTGGA AGG (reversed) Intronic
900819992 1:4879304-4879326 TTGCACATCCATTAATTGGAGGG - Intergenic
909095696 1:71285391-71285413 TGGTGGAGCCATAAGGTGGAAGG - Intergenic
917208506 1:172604877-172604899 AGGTACATAAATAAAATGGATGG - Intronic
917633687 1:176915419-176915441 TTGTACATCTGTAATGTGGAAGG - Intronic
918960052 1:191262986-191263008 TGATACATCAATACCGTGGAAGG - Intergenic
924126459 1:240858111-240858133 TGGTATATTCATACAATGGAAGG - Intronic
1063264781 10:4435695-4435717 TTGTACACCCATTGAGTGGATGG - Intergenic
1064470240 10:15628288-15628310 AGGTGAATCCATAAAGTGAAAGG - Intronic
1064668400 10:17682154-17682176 TAGTACTTGCATAAGGTGGAAGG - Intronic
1065576467 10:27125260-27125282 TGATACAACCATAAATTAGAAGG + Intronic
1067739741 10:48886249-48886271 TGGTACATCTATAATGGGCAAGG - Intronic
1069920069 10:71811113-71811135 TGTTCCATCCTTACAGTGGATGG - Intronic
1070043585 10:72807200-72807222 TGGTACATCTGTAGAGTGAAGGG + Intronic
1071084165 10:81848835-81848857 TGATAAATCCATTAAGGGGAAGG + Intergenic
1074720836 10:116263797-116263819 AGTTACATCCATGATGTGGAAGG + Intronic
1080408093 11:31997842-31997864 CAGTACATTCATTAAGTGGATGG - Intronic
1081849902 11:46268084-46268106 TGGTACATTCATACAATGGGTGG + Intergenic
1085631769 11:78124041-78124063 GAGTACATCCATAAAGATGACGG + Exonic
1091073816 11:132595179-132595201 TGGTACATCAGGAAAGGGGAGGG + Intronic
1094747905 12:33367682-33367704 TGGCACATACATTAAGTGGTAGG + Intergenic
1100459749 12:94787695-94787717 TGGTATGTACATACAGTGGAAGG + Intergenic
1103093939 12:118118017-118118039 TGATCCATCCATCAAGTGCAGGG - Intronic
1103431023 12:120886566-120886588 TGGTACATCTCTAATGAGGAGGG + Intronic
1109040158 13:57323876-57323898 TGGAAAGTCCAGAAAGTGGAAGG - Intergenic
1110746817 13:79063647-79063669 TTGTTCATCCTTAAAGTGTAGGG - Intergenic
1111603851 13:90510878-90510900 TGGTATGTCCATACAATGGAAGG + Intergenic
1113016372 13:105832807-105832829 TGAGACAGGCATAAAGTGGAAGG + Intergenic
1115027853 14:28764791-28764813 AGATACATACATACAGTGGAAGG + Intergenic
1116791554 14:49345279-49345301 AAGTACTTCCATAATGTGGAAGG + Intergenic
1117453190 14:55872314-55872336 TGGTACATCCACACCGTGGAAGG - Intergenic
1118194631 14:63613134-63613156 TGGTATAGCCATAAAATGAAAGG + Intronic
1118452382 14:65915692-65915714 TGCTACATGCATAACATGGATGG + Intergenic
1118513228 14:66499277-66499299 AGGTCCATGCACAAAGTGGAAGG + Intergenic
1124270982 15:28280475-28280497 TTCTTCATCCATAAAATGGATGG - Intronic
1124506880 15:30284925-30284947 TGGCACCTCCAGACAGTGGATGG - Intergenic
1124694328 15:31851213-31851235 AGGTAGATTCATGAAGTGGAAGG + Intronic
1124736677 15:32253736-32253758 TGGCACCTCCAGACAGTGGATGG + Intergenic
1125699426 15:41668448-41668470 TGGTAAATTCATAAAGTGTTAGG + Intronic
1127391139 15:58506029-58506051 AGGAACTTCCATAGAGTGGATGG + Intronic
1129461449 15:75701994-75702016 TGGTCCATCCATAAGGCGGCTGG + Intronic
1129723384 15:77889813-77889835 TGGTCCATCCATAAGGCGGCTGG - Intergenic
1135077580 16:19407408-19407430 TGGTGCATCCCAAAAGAGGAAGG + Intergenic
1136179351 16:28540174-28540196 TGGGAGATCCACAAAGTGGGTGG + Intergenic
1137908290 16:52349155-52349177 TGGTAAATACTTAAAGTAGAAGG - Intergenic
1139037658 16:62967236-62967258 TGGTAAATACAAAAAGTGGCTGG - Intergenic
1139456835 16:67086456-67086478 TGGGATTGCCATAAAGTGGAGGG - Intronic
1146628916 17:34456020-34456042 AGGTACCTCCATGCAGTGGATGG - Intergenic
1147344966 17:39784706-39784728 TTGTAAATCCTTAAAGTGTAGGG + Intronic
1148479218 17:47949297-47949319 TTGAACATCAATAAAGTGCACGG - Intergenic
1151865902 17:76802577-76802599 TGGTTTATCCGTACAGTGGAGGG + Intergenic
1155740634 18:29284004-29284026 TGGTACCTACAAAAAGTGAATGG - Intergenic
1157875411 18:51268833-51268855 TGGAACATCCATGCAATGGAAGG + Intergenic
1158649941 18:59275419-59275441 TGATACAGCTATTAAGTGGAAGG + Intronic
1158731511 18:60029409-60029431 TGGTATATTCATAAAATGGATGG - Intergenic
1159433884 18:68390710-68390732 TGTTACATCCTTATAGAGGAAGG + Intergenic
1159580503 18:70230110-70230132 TGGTTGATCCATCAAGTGCAGGG + Intergenic
929034859 2:37680932-37680954 TGGTACCTCCATACGATGGATGG - Intronic
932282070 2:70502110-70502132 AGGAACATCGATAAATTGGAGGG - Intronic
935055845 2:99566023-99566045 TGGTACATCCCCAACTTGGATGG + Intronic
936097242 2:109539884-109539906 TGGTTCATCCATACAATGAAAGG - Intergenic
936480744 2:112883034-112883056 GAGGACATCCATGAAGTGGAGGG + Intergenic
938138523 2:128777987-128778009 TGGTACATCCGCAATGTGCACGG - Intergenic
940862592 2:158786310-158786332 TGATCCATCCATAACATGGAAGG + Intergenic
941689784 2:168488179-168488201 TGGTAAGTTCATAAAGTGAAGGG + Intronic
942339832 2:174932295-174932317 TGGTATATCTACAAAATGGAGGG - Intronic
943424455 2:187713317-187713339 TAATCCATCCTTAAAGTGGATGG - Intergenic
944890075 2:204108491-204108513 CTGTCCATTCATAAAGTGGAGGG + Intergenic
947291417 2:228579033-228579055 TGGTACCTCCAAAAAGTTGGGGG - Intergenic
1172506779 20:35468532-35468554 AGGTACATACATAAAATGCAGGG + Intronic
1178083750 21:29092591-29092613 TGAGACTTCCAGAAAGTGGACGG - Intronic
1181837103 22:25619836-25619858 TGGAACATCTATGAAGTGGTTGG + Intronic
950414979 3:12863985-12864007 TGGCACTTCCAGAGAGTGGATGG - Intronic
956230788 3:67014155-67014177 TGGCACAGCCAGAAAGAGGATGG - Intergenic
960203212 3:114863195-114863217 ACATATATCCATAAAGTGGAGGG + Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965710944 3:171555652-171555674 TCGTACATCCAGAAAGAAGAAGG - Intergenic
969323668 4:6428117-6428139 TAGGACATGCATAAAGAGGAAGG - Intronic
971492227 4:27225269-27225291 TTGTACTTCCATAAAATGGAAGG + Intergenic
972134629 4:35876796-35876818 TTGTACATCCAAAATGTGGGAGG + Intergenic
973029575 4:45319956-45319978 TGGTCCATTCATATAATGGAAGG - Intergenic
973594784 4:52476653-52476675 TGGTATAGCCATACAATGGAAGG + Intergenic
976554946 4:86439450-86439472 TGGTACATCCATAAAGTGGAAGG - Intronic
978066398 4:104408464-104408486 TGGTATATCTAGAAAATGGATGG - Intergenic
979421508 4:120510131-120510153 AGATAAATCCATAAAGAGGAGGG + Intergenic
979590300 4:122471315-122471337 AGGTACTTCCATAAAGCTGAGGG - Intergenic
986673115 5:10160566-10160588 TGGTGAGTCCATAAAGTGAAAGG - Intergenic
989989119 5:50740158-50740180 TGCTAAATCCATAGAGTAGAAGG - Intronic
996049929 5:118920801-118920823 TGCTACATTCATAAAGTAAATGG + Intronic
996286260 5:121796732-121796754 TGGCACATCCAAAATCTGGAGGG + Intergenic
996944459 5:129050005-129050027 TGGTGCCTGCATAAAGTAGAGGG - Intergenic
998177207 5:139909214-139909236 TGGCACAGCCTCAAAGTGGAAGG - Intronic
1002395974 5:178954911-178954933 TGGTACATCCATACAGTGGGAGG - Intronic
1010791246 6:80067730-80067752 TGGTTCATCTATAAATGGGACGG + Intergenic
1014292203 6:119571431-119571453 TCCTACATCCATGAGGTGGAAGG + Intergenic
1015637898 6:135297076-135297098 TGCTACTGCCATAAAGAGGAAGG - Intronic
1015944769 6:138488765-138488787 GTGAACTTCCATAAAGTGGAGGG + Intronic
1017427155 6:154334357-154334379 TTCCCCATCCATAAAGTGGAAGG + Intronic
1021623129 7:22566990-22567012 TGATACAACCATACAGTGTATGG + Intronic
1022138646 7:27473068-27473090 TGGTACGTACATACAATGGAAGG - Intergenic
1022405908 7:30089650-30089672 TGCTACAGCCAGAAAGGGGATGG + Intronic
1026595510 7:71731254-71731276 TGGTAGAGCCATAAGGGGGAAGG + Intergenic
1027630021 7:80592852-80592874 GAGTAAATACATAAAGTGGAAGG + Intronic
1032040707 7:128558204-128558226 TGAAACATCCATAAAGTAGGTGG + Intergenic
1033419201 7:141191225-141191247 TGGTACATGCATGCAATGGAAGG - Intronic
1033999667 7:147397658-147397680 TGGTAAATTAATAAAATGGAAGG + Intronic
1034915076 7:155031963-155031985 TGGTATATCCATACAATGGAAGG + Intergenic
1036994388 8:13638472-13638494 AGGTACAACCATAACGTGGAAGG - Intergenic
1038180620 8:25223837-25223859 TGCTTCATCCATAAAGTACAGGG - Intronic
1040522922 8:48193336-48193358 GGGCACATCCAGAAAGTGGGGGG - Intergenic
1041685414 8:60640302-60640324 TGGTACATCCCTACTATGGAAGG + Intergenic
1042452196 8:68960602-68960624 TAGCACATCCCTAATGTGGAAGG + Intergenic
1042678740 8:71354924-71354946 TGGTACATCTGTCAAATGGAAGG - Intronic
1046546468 8:115657375-115657397 TTGTACTTCCATCAAGTCGAGGG - Intronic
1050033927 9:1415020-1415042 TGATGCATCCATAAAATGGTTGG - Intergenic
1052026156 9:23575670-23575692 TTGTACATCTGTAAAATGGAGGG + Intergenic
1053600923 9:39608766-39608788 AGGCACATCCATAAGGTGCAAGG - Intergenic
1053858575 9:42362576-42362598 AGGCACATCCATAAGGTGCAAGG - Intergenic
1054252611 9:62733672-62733694 AGGCACATCCATAAGGTGCAAGG + Intergenic
1054566727 9:66768170-66768192 AGGCACATCCATAAGGTGCAAGG + Intergenic
1054577240 9:66873074-66873096 TGGTAATTCCATAATGTGTATGG + Intronic
1054843787 9:69771081-69771103 TGGTACTACCCAAAAGTGGATGG - Intergenic
1055287913 9:74749925-74749947 TGGCACTTCCATAGAGTAGATGG + Intronic
1056489675 9:87093117-87093139 TGGTATATCCATATCATGGAAGG + Intergenic
1056898286 9:90572255-90572277 ATGTACATACATAAAGAGGAAGG + Intergenic
1057170066 9:92957054-92957076 TGGTGCAGCCATAATATGGATGG - Intronic
1057358753 9:94354214-94354236 TGGTACATCCATACAGTGAATGG + Intergenic
1057520681 9:95757827-95757849 TTCTTCATCCATAAAATGGAAGG + Intergenic
1057649001 9:96903396-96903418 TGGTACATCCATACAGTGAATGG - Intronic
1060433572 9:123572303-123572325 TGGTATACCCATAAAATAGAAGG - Intronic
1186639182 X:11437038-11437060 TTTTACCTCCATAAAGTAGAAGG + Intronic
1186980611 X:14954182-14954204 TGGCAGAGCCATAAGGTGGAAGG + Intergenic
1187208247 X:17203373-17203395 TGGCAGATCCACAAAATGGAAGG + Intergenic
1189087207 X:38038085-38038107 AGGTACATCCATATTGGGGAGGG + Intronic
1196580714 X:117375942-117375964 TGGTACATCAATTATGTGTAAGG + Intergenic
1197379324 X:125720480-125720502 TGGTACATCCATACAATGAAAGG + Intergenic
1200324102 X:155219671-155219693 TGGGAAATGCATAAAGTGGTGGG + Intronic
1201062059 Y:10055066-10055088 TTGTAAATCAATAAATTGGATGG + Intergenic