ID: 976564341

View in Genome Browser
Species Human (GRCh38)
Location 4:86536575-86536597
Sequence GATTATGTATCTACAACTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976564341_976564342 6 Left 976564341 4:86536575-86536597 CCTTTAGTTGTAGATACATAATC 0: 1
1: 0
2: 0
3: 6
4: 141
Right 976564342 4:86536604-86536626 AATTTGCTTCCTTTTTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976564341 Original CRISPR GATTATGTATCTACAACTAA AGG (reversed) Intronic
903925623 1:26828606-26828628 GATCATGTATCTGCAACTTTGGG + Intronic
906263485 1:44410452-44410474 GATTATGTATCTCACATTAACGG - Intronic
908593933 1:65665121-65665143 CATTATGTATTTACAATTGATGG + Intergenic
908941612 1:69441699-69441721 GATGATGAATCTACAATGAATGG - Intergenic
909410515 1:75345065-75345087 GATTATGAAAATACAACTAAAGG + Intronic
910533902 1:88274196-88274218 CATTATATATCTACAAATAGAGG - Intergenic
912867326 1:113269493-113269515 GATTCTCTATTTACAAATAATGG + Intergenic
913200109 1:116489020-116489042 GTTTATGCTTATACAACTAAAGG + Intergenic
913654524 1:120948385-120948407 GTTTATGCATATACAATTAAAGG + Intergenic
914520214 1:148408523-148408545 GTTTATGCATATACAATTAAAGG + Intergenic
914644719 1:149642547-149642569 GTTTATGCATATACAATTAAAGG + Intergenic
915710381 1:157892436-157892458 GATTATTTATATACACCTGAAGG + Intronic
921227482 1:213034754-213034776 GATTATGTAACTACTAATTAGGG - Intergenic
923963436 1:239108492-239108514 TATTATGTATCTTCCACTACAGG - Intergenic
1063689967 10:8277731-8277753 TATTATGTATCAAGAAGTAAAGG - Intergenic
1063954223 10:11251184-11251206 GTTTCTATATCTACAACCAAAGG - Intronic
1064129550 10:12696603-12696625 GAATATGAATATACAACTGAAGG - Intronic
1064223055 10:13458186-13458208 CATTATTTATATACAATTAAAGG - Intronic
1064871451 10:19942060-19942082 TATTATTTATCTTGAACTAAGGG + Intronic
1068237463 10:54257110-54257132 GTGTATGTATCTATAACTGATGG + Intronic
1068477269 10:57544212-57544234 GATTATATATCTAAACTTAAAGG + Intergenic
1069963082 10:72089954-72089976 TATTTTCTATCTAAAACTAATGG + Intergenic
1070366808 10:75744652-75744674 GATTCTGTTTCTGCCACTAATGG - Intronic
1071120525 10:82271552-82271574 CATTATGTGTGTATAACTAACGG - Intronic
1071253014 10:83840148-83840170 GATTAGGTATCTACTGCCAAAGG - Intergenic
1071886417 10:89955623-89955645 GATGATATATCCACAATTAATGG - Intergenic
1073349134 10:102806912-102806934 AATTGTGTATATACAAATAAGGG + Intronic
1073554135 10:104432069-104432091 GGGTATGTATCTACAAGTAGAGG + Intronic
1077803753 11:5569156-5569178 AATCATGTCTATACAACTAAAGG + Intronic
1078154350 11:8785966-8785988 TATTCTGTATTTCCAACTAAAGG - Intronic
1078853142 11:15182129-15182151 TATTATGTATCCAGAATTAAGGG - Intronic
1079829946 11:25251497-25251519 GAATATTTATCTACATCTAGTGG - Intergenic
1080545541 11:33314289-33314311 GATAATGTATCTACCTCAAAGGG + Intronic
1081116068 11:39203228-39203250 GATAATGTATATATAAATAATGG - Intergenic
1084594499 11:70108933-70108955 GATTTTGTATCTACGGCTTAAGG - Intronic
1086287593 11:85266954-85266976 AATTATGTAACTACTACCAAAGG - Intronic
1086999504 11:93400363-93400385 GCTGATGTATCTACAAGTCAAGG - Intronic
1091028036 11:132159398-132159420 GTTTATATATTTACAAATAAGGG + Intronic
1093310652 12:17578293-17578315 GCTTATGTATTTAAAACTATGGG + Intergenic
1093472673 12:19521312-19521334 TATTAGGTACCTACAACAAATGG + Exonic
1098688773 12:73460205-73460227 GTTTATGTATCTGCAACCAATGG + Intergenic
1099237773 12:80102561-80102583 GAGATTGTATCTACAACTAGAGG - Intergenic
1099306808 12:80967243-80967265 GATTTTGCATTTACAACTAATGG - Intronic
1099598885 12:84705633-84705655 GATTTTGTATCTACATTTTAAGG + Intergenic
1099807792 12:87542444-87542466 GATTATAAATCTATAACTCATGG + Intergenic
1100507036 12:95232235-95232257 GAAAAGGTATCTGCAACTAAAGG - Intronic
1101562305 12:105869243-105869265 GAATATGCATTTACAAATAAAGG - Intergenic
1105392940 13:19998683-19998705 GTTTTTGTTTCTCCAACTAAGGG + Intronic
1109205523 13:59478650-59478672 GAATGTGTATCAACAAATAATGG - Intergenic
1109845891 13:67990439-67990461 GATTATGTATTTTTAAATAAAGG + Intergenic
1111504434 13:89167997-89168019 GATTATGTACCCACAACACATGG - Intergenic
1116823090 14:49644622-49644644 TATAATGTATTTACTACTAATGG - Intronic
1117680358 14:58197540-58197562 AGTTATGTATCTACAAGCAAAGG + Intronic
1119059066 14:71456009-71456031 GATTTTGTTTTTACAGCTAAAGG + Intronic
1131587552 15:93712548-93712570 GTAAATGTATCTACAACAAAGGG - Intergenic
1137344016 16:47637636-47637658 GATTATGTATCTCCAAAGACAGG + Intronic
1139262900 16:65612190-65612212 TATTATGTATCTTCATCTCAAGG + Intergenic
1144225656 17:13142850-13142872 AATTAAATAACTACAACTAATGG + Intergenic
1151053180 17:71003047-71003069 GTTTCTGTATATACAACCAAAGG + Intergenic
1157100696 18:44726243-44726265 TATTATGTATCTAGAACTGTTGG - Intronic
1159699804 18:71611359-71611381 GACTAGGTATCAACAACTACAGG + Intergenic
1159970981 18:74652312-74652334 GATTATATTTCTAGAAATAAAGG + Intronic
1162196900 19:8992009-8992031 GATTCTGTCTCAACAAATAAAGG + Intergenic
926801154 2:16662019-16662041 GAATATGTTTCTAAAACTCAGGG + Intronic
930587311 2:53282855-53282877 GATATTGTATCGACTACTAAAGG - Intergenic
931186272 2:59954400-59954422 AATTATGTGGCTACAACAAATGG + Intergenic
932391792 2:71397840-71397862 GATAATGTAGGTACAAATAATGG + Intronic
932526746 2:72477724-72477746 AATGATGTATCTATCACTAATGG - Intronic
933149534 2:78897208-78897230 GATTTTGTATGTAGAACAAAGGG + Intergenic
933170787 2:79122513-79122535 TATAATATATCAACAACTAATGG + Intronic
933172153 2:79136396-79136418 AATAATATATCAACAACTAATGG - Intergenic
933221754 2:79698281-79698303 GTTCATGTCTCCACAACTAATGG + Intronic
937185925 2:120042539-120042561 GATTCTGTATCTATAAATAGTGG + Intronic
939585839 2:144004494-144004516 GATAAAGCATCTACCACTAAAGG + Intronic
939598857 2:144163546-144163568 CCTTATGTATTTACAAATAAAGG - Intronic
942018787 2:171845638-171845660 GTGTATGTATATAAAACTAAAGG - Intronic
943271652 2:185812504-185812526 TATTATCTATCTTCAACAAAAGG + Intronic
945580558 2:211589958-211589980 CATTATTGATCTACAACTACAGG + Intronic
945712734 2:213319567-213319589 GATTTTGTATATTCATCTAATGG + Intronic
947076352 2:226349905-226349927 GGTGATGCATCTACAACTCAAGG + Intergenic
1172400113 20:34643109-34643131 GAGTATATATCTTAAACTAATGG - Intronic
1172594832 20:36143619-36143641 GATTATCTATCTATCACTCAGGG + Intronic
1174691761 20:52513155-52513177 GATTCTTTTTCTACAACCAATGG - Intergenic
1177724412 21:24948642-24948664 GATTTTGTATCTACTTCCAAGGG - Intergenic
949314834 3:2741232-2741254 AATGATGTAACTACAAGTAAAGG + Intronic
951770836 3:26255845-26255867 GAAAATATATCTACAATTAATGG - Intergenic
951983193 3:28588174-28588196 GAATATGTGCCTACAGCTAAGGG - Intergenic
952949151 3:38504814-38504836 CTTTATGCATCTAAAACTAACGG + Intronic
955587619 3:60498455-60498477 CATATTGTATCTTCAACTAAGGG + Intronic
956936868 3:74112435-74112457 GAATATGTACCAACATCTAAGGG - Intergenic
957660525 3:83145688-83145710 GGTTATGTACCTGCAAGTAAGGG - Intergenic
959093797 3:101932006-101932028 GGGTATGTATTTACAACAAAGGG - Intergenic
963559276 3:146841171-146841193 GATTAAGTATCTATATCTATAGG - Intergenic
967190699 3:186982440-186982462 GAATATGTATCTTCAACTATGGG + Intronic
971562367 4:28096279-28096301 GTTTATGTATCAAAACCTAAAGG + Intergenic
972449810 4:39185241-39185263 GATGATGTAAATATAACTAATGG + Intronic
974217181 4:58864722-58864744 GATCATAAATCTAAAACTAAAGG + Intergenic
976564341 4:86536575-86536597 GATTATGTATCTACAACTAAAGG - Intronic
989656474 5:43750529-43750551 AATTATGTTGCTACTACTAATGG + Intergenic
991076033 5:62539295-62539317 GATTACGTATCTACAAACCAAGG - Intronic
994537539 5:101050095-101050117 GTATATGGATCTACTACTAATGG - Intergenic
996242285 5:121218937-121218959 GATTATAAATCTAGAACTATAGG - Intergenic
1000641173 5:163703631-163703653 GATTAGGTATCTACTTCTATAGG + Intergenic
1001880984 5:175243828-175243850 TCTTATGTATCCACAAATAATGG + Intergenic
1003264913 6:4557063-4557085 GATTATTTATATACAAATAGAGG - Intergenic
1004413377 6:15402140-15402162 GTTTATTTATCTACAAATTATGG + Intronic
1009545773 6:65018360-65018382 GGTGATGCATCTACAACTACGGG - Intronic
1011622783 6:89258273-89258295 GTTTTTGTCTCTACAACTGAGGG - Intronic
1012321987 6:97861087-97861109 TATAGTGTATCTAAAACTAAAGG - Intergenic
1012813463 6:103990544-103990566 GAATATGTATCCACTACCAAAGG + Intergenic
1014633049 6:123811066-123811088 GAATATGTGTCTTCACCTAATGG + Intronic
1014997248 6:128164112-128164134 AATTACGTATCTCCAATTAATGG + Intronic
1015669857 6:135676275-135676297 GACAATGTATCTGGAACTAAGGG - Intergenic
1015900702 6:138062723-138062745 AATTATGTAGCTACAAGTCAAGG - Intergenic
1017241107 6:152169980-152170002 GGTTATGAATCTACCACTATAGG + Intronic
1018303207 6:162425634-162425656 AACTATGAATATACAACTAAGGG + Intronic
1021461816 7:20896548-20896570 GTATATGTATCTCCAAATAAGGG - Intergenic
1022019789 7:26387309-26387331 GAATAAATATCTACAAATAAAGG + Intergenic
1026441248 7:70446277-70446299 GATTATGTATTTGCCACTAAGGG + Intronic
1031186984 7:118493970-118493992 AATTATGTTTCTAAAACAAATGG + Intergenic
1032101908 7:128986943-128986965 GATTACATATCTGAAACTAAAGG + Intronic
1034821026 7:154216357-154216379 GATTATGCATCCTCAAGTAAGGG - Intronic
1035137087 7:156714472-156714494 GATTATGTCTTTATTACTAATGG + Intronic
1038928758 8:32170031-32170053 AATTATGTATCTACAAGCCAAGG + Intronic
1041411349 8:57559993-57560015 TATTAAGTATATACAACTTATGG + Intergenic
1044495294 8:92870934-92870956 AATTATGGATATACAACTTAAGG + Intergenic
1046311955 8:112449008-112449030 GATTATATTTCTTCAATTAAAGG + Intronic
1046321283 8:112580236-112580258 GATTACATATTTACAAGTAAGGG + Intronic
1046900395 8:119517508-119517530 TATTATGTATCTATAATTGATGG - Intergenic
1047945500 8:129874207-129874229 AATAATGTATCTACTACTGAGGG + Intronic
1049076087 8:140397129-140397151 CATTATCAATCCACAACTAAAGG + Intronic
1050792161 9:9486478-9486500 GTGTATGTGTCTAAAACTAAGGG - Intronic
1051090068 9:13396255-13396277 AATTATGTATCTAGAACTGAAGG + Intergenic
1052389494 9:27862542-27862564 GAATATGTATCCACAATTTAAGG + Intergenic
1052532174 9:29700309-29700331 GATTGTGGATCTACATCTTAAGG + Intergenic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1055978319 9:81975840-81975862 AATTTATTATCTACAACTAATGG + Intergenic
1058208697 9:102139885-102139907 GATTACATATGTACAACTCAGGG + Intergenic
1058746283 9:107994366-107994388 GATCATGTATCTAGACCTACTGG + Intergenic
1059975034 9:119707071-119707093 GTATATGCATCTACCACTAAAGG - Intergenic
1187833622 X:23408302-23408324 AATTACGTATCAACAGCTAAAGG + Intergenic
1189444886 X:41071581-41071603 AATGATGTATCTACAATTGATGG + Intergenic
1191587277 X:62842220-62842242 AATGATGTAACTACAATTAATGG + Intergenic
1192284932 X:69725515-69725537 GCTTAAGTATGTAAAACTAAAGG - Intronic
1193467205 X:81864911-81864933 GATTATGAAACTACAATTCAAGG + Intergenic
1193507218 X:82359744-82359766 GATTATGAATCTATTACTACAGG - Intergenic
1193509967 X:82387679-82387701 GATCTAGTATCTACAAGTAAAGG - Intergenic
1195563729 X:106317090-106317112 GCTTATGTAAATATAACTAATGG + Intergenic