ID: 976568821

View in Genome Browser
Species Human (GRCh38)
Location 4:86584844-86584866
Sequence CACCAATAGCAGCTTGAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976568821_976568823 30 Left 976568821 4:86584844-86584866 CCCAATTCAAGCTGCTATTGGTG 0: 1
1: 0
2: 1
3: 9
4: 98
Right 976568823 4:86584897-86584919 CTTTTATCCAATAAAAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976568821 Original CRISPR CACCAATAGCAGCTTGAATT GGG (reversed) Intronic
903359844 1:22770049-22770071 CATAAATAGCTGCTTGGATTGGG + Intronic
903456740 1:23492646-23492668 GGCCAATAGCAGTTTAAATTGGG - Intergenic
907677986 1:56536432-56536454 CACAATCAACAGCTTGAATTTGG - Intronic
908246534 1:62231701-62231723 CACCAATACCACCATGCATTGGG + Intergenic
908886895 1:68799562-68799584 CAGCACTGGCAGGTTGAATTAGG + Intergenic
910032587 1:82747654-82747676 CACCAATAGCACTTGGAATGTGG + Intergenic
911827199 1:102501914-102501936 CACCAATAGCCATTTGAACTTGG + Intergenic
912028240 1:105205661-105205683 CACCAATGGCAGCCTGGATGTGG + Intergenic
920218877 1:204381057-204381079 AACCAATAGCTGCTTTTATTTGG - Intergenic
921959561 1:221020477-221020499 CAACAAAAGTGGCTTGAATTGGG + Intergenic
922429227 1:225531140-225531162 CAAAAATGGCAGCTTAAATTGGG - Intronic
922497841 1:226074302-226074324 AGCAAATAGCAGCTTGGATTAGG - Intergenic
1066358559 10:34708762-34708784 CACCACTCACACCTTGAATTTGG - Intronic
1077005436 11:353229-353251 CACCAATAGCAGCTCGGGCTGGG - Intergenic
1080340542 11:31258685-31258707 CACAAATAGCTGCTTCAATTTGG + Intronic
1081533277 11:43979098-43979120 AACCAGAAGCAGCTTGACTTTGG - Intergenic
1082655319 11:55848316-55848338 CAACAATAGCATCATGAATAAGG + Intergenic
1082935753 11:58654876-58654898 AACCTATAGCAGCTCGAATAGGG + Intronic
1086433609 11:86759646-86759668 CACCTATAGCATCATGACTTAGG + Intergenic
1086921123 11:92588232-92588254 CAGCAATAGAAGCTAGCATTAGG - Intronic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1088513994 11:110608786-110608808 TACCATTAGCTGCTTGAATGAGG + Intronic
1098878269 12:75889833-75889855 CTCAAATAGCAACTAGAATTTGG - Intergenic
1099533885 12:83822294-83822316 AAGCAATAGCAGCTGGATTTGGG + Intergenic
1099801463 12:87462148-87462170 CACCAATACCAGCTCAAATCAGG - Intergenic
1101254153 12:102960995-102961017 CACCACTAGGAGCTTGTATGTGG - Intergenic
1101366814 12:104079632-104079654 GACCTATGGCAGCTTGACTTAGG + Exonic
1103826348 12:123742201-123742223 CACAAAAAGCAGCTGGAACTGGG - Intronic
1104491842 12:129201080-129201102 CACCAAGAGCAGCTGTAATCAGG + Intronic
1110036780 13:70697464-70697486 CACCAATAGCCACCTCAATTAGG + Intergenic
1112943537 13:104895771-104895793 CAGCAACAGGAACTTGAATTAGG + Intergenic
1113581095 13:111429588-111429610 CACAAGCAGCAACTTGAATTAGG + Intergenic
1114934733 14:27519442-27519464 CAGCAATAGCATTGTGAATTTGG - Intergenic
1115659526 14:35478607-35478629 CACCAATAGAAGCTTAGATGGGG + Intergenic
1117550463 14:56831148-56831170 CAGCAATAGCAGGTTGATTGTGG - Intergenic
1120160342 14:81138852-81138874 CACCATTAATAGCTTGAATAAGG - Intronic
1125200440 15:37097504-37097526 CACTAACAGCAGCTTGAGCTGGG - Intronic
1126283355 15:46982996-46983018 CAGCAATATCAGCTTTTATTTGG - Intergenic
1131121439 15:89825411-89825433 CATCCACAGCAGCTTGAAATTGG - Intergenic
1138131915 16:54487180-54487202 CAGCAATAGCACATTGAGTTGGG - Intergenic
1138612882 16:58141419-58141441 CACCAATAGCAGCACATATTCGG - Intergenic
1142239515 16:88938849-88938871 CACCGTTAGCAGGTTGACTTTGG - Intronic
1143052684 17:4139293-4139315 CACCAATGGCAGCGTAAGTTGGG + Intronic
1144017629 17:11211491-11211513 AACCAATAGCAGCATGAAGCAGG - Intergenic
1151855994 17:76722426-76722448 CACCAAGCGCAGCCTAAATTGGG - Intronic
1153193664 18:2570200-2570222 AACCAAAAGAACCTTGAATTTGG + Intronic
1159547608 18:69859223-69859245 CTCCATTAGAAGCTTGACTTGGG - Exonic
1159688995 18:71461337-71461359 CACCCCTAGCAGGGTGAATTGGG + Intergenic
1168064127 19:53909643-53909665 CCCCCATAGCCGCTCGAATTCGG - Intronic
925696537 2:6585956-6585978 CCCCACTAGCACCTTGAGTTTGG + Intergenic
932095266 2:68841908-68841930 CACCAATAGCAGTGAGACTTTGG - Intergenic
932358385 2:71085622-71085644 CACCAATAGCAGCTTCAATATGG + Intergenic
932739544 2:74281240-74281262 GACCAGAAGCAGCTTGGATTTGG + Intronic
933512336 2:83256819-83256841 CACCAGTAGCAGACTGAACTGGG - Intergenic
933513383 2:83269798-83269820 CATTAAGTGCAGCTTGAATTTGG - Intergenic
942942099 2:181630665-181630687 CCCCAATGGCACCTTGATTTTGG + Intronic
946444490 2:219726716-219726738 CAGCAATTCCATCTTGAATTGGG - Intergenic
948755126 2:240155067-240155089 CACCACCGGCTGCTTGAATTTGG - Intergenic
1173002673 20:39115932-39115954 CACGACTAGCAGTGTGAATTTGG - Intergenic
1181050569 22:20236503-20236525 CACCAACAGCAGATTGCATGTGG - Intergenic
1182782229 22:32877365-32877387 CACCAATAGCTGCGTGACCTTGG - Intronic
949132674 3:523992-524014 CAGTAATAGAAGCTTAAATTAGG + Intergenic
955091596 3:55757014-55757036 CACCAAAAGCATATTGAATTTGG - Intronic
955903826 3:63785857-63785879 CACCAAAAGCATCTTAATTTGGG + Intergenic
958501368 3:94913760-94913782 TACCAATGGCAGCTTGAAATTGG + Intergenic
963277596 3:143348294-143348316 CATCAATAGCTGCTTAACTTCGG - Intronic
964691177 3:159451875-159451897 CACAAAGAGCAGCTGGGATTAGG + Intronic
969072252 4:4548909-4548931 CACCATGAGGAGCTTGACTTAGG + Intergenic
969348418 4:6583533-6583555 CACCACTAACAGCTTTACTTAGG - Intronic
971859192 4:32082745-32082767 CAACAATACTAGCTTGAATAAGG - Intergenic
973036661 4:45415714-45415736 CACCAGAAGCAGTTTGCATTAGG + Intergenic
974542225 4:63251790-63251812 CAACAGTAGCAGCTGGAAATAGG - Intergenic
976568821 4:86584844-86584866 CACCAATAGCAGCTTGAATTGGG - Intronic
979276575 4:118821257-118821279 CACACATATCAGCTTCAATTTGG + Intronic
981970022 4:150656132-150656154 CAGCAATGGCAGCTACAATTAGG - Intronic
987958025 5:24765209-24765231 CTCTACTAGCAGCTTGATTTTGG + Intergenic
989410045 5:41109535-41109557 AACCACTAGCAGCTTGGAATAGG - Intergenic
989609434 5:43277189-43277211 CACCAAGTGCAGCTTGGATAGGG - Exonic
992767888 5:80019097-80019119 CAACTATAGTAGCATGAATTTGG + Intronic
994123263 5:96141672-96141694 CAACAATAGCAGCTTTGAATAGG - Intergenic
996507290 5:124282169-124282191 CACCAATAGAAGCTTGATCTTGG + Intergenic
999044955 5:148457034-148457056 CACTTAGAGCAGCTTGGATTTGG + Intronic
999654029 5:153795185-153795207 CACCCATGGCAGCTGGACTTGGG + Intronic
1000245823 5:159447623-159447645 CTCCAAAAGGAGCTAGAATTTGG + Intergenic
1004923651 6:20399809-20399831 CATCACTGGCAGCTTGCATTTGG - Intergenic
1010989044 6:82458759-82458781 CAGCAATAGATGCTGGAATTGGG - Intergenic
1015120515 6:129696400-129696422 CACAAATGCCAGTTTGAATTTGG - Intronic
1015412185 6:132906401-132906423 TAACAATACCAGCTTGATTTAGG - Intergenic
1017171368 6:151458656-151458678 CACCAGTGGAAGCTTGAATTTGG + Intronic
1017346788 6:153392049-153392071 CACCAATGGCAGATGGATTTTGG + Intergenic
1018044286 6:159952238-159952260 CCCCAACAGCAGCTAGAAGTGGG + Intergenic
1019642754 7:2113250-2113272 CACCAATAGATGCTTGAACTAGG + Intronic
1019949334 7:4358699-4358721 CACCATAACCAGCTTGAAGTGGG - Intergenic
1019956159 7:4416218-4416240 CACCAAGGGCAGCCTGATTTAGG + Intergenic
1022352506 7:29579194-29579216 CAATAATGGCACCTTGAATTTGG - Intergenic
1026534727 7:71230267-71230289 AACTAATAGCAGATTGAATAGGG + Intronic
1028220076 7:88186790-88186812 CACCTATAGGAACTTGTATTGGG - Intronic
1043889098 8:85636466-85636488 CAACAATGGCAACTTTAATTTGG + Intergenic
1046651956 8:116845267-116845289 AACCCAAAGCAGCTTGAATTTGG - Intronic
1047988115 8:130257925-130257947 CACCCATGGCAGGTTGAATTTGG - Intronic
1057006234 9:91563160-91563182 CATCAACAGCAGATTTAATTTGG - Intronic
1057487540 9:95497764-95497786 AAAGAATAGCAACTTGAATTGGG - Intronic
1057624835 9:96667852-96667874 AACCAAAAGCAGCTTGAGATGGG + Intergenic
1057815771 9:98293036-98293058 CACCAATTGCAGCATCATTTGGG - Intronic
1059641235 9:116218945-116218967 CACCAATGGCAGCATGGAGTGGG + Intronic
1189178833 X:38984057-38984079 CACCAATAGCACTTTTAATTTGG + Intergenic
1193997503 X:88384574-88384596 CAGCAGTAACAGCTGGAATTAGG + Intergenic
1194976768 X:100404034-100404056 CTGCAATTGCTGCTTGAATTGGG - Intronic
1197228726 X:123980134-123980156 CTCCAAAATCAGCTTGCATTTGG - Intronic