ID: 976571541

View in Genome Browser
Species Human (GRCh38)
Location 4:86617566-86617588
Sequence TGCTGGAAGGGGAAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1937
Summary {0: 1, 1: 0, 2: 13, 3: 202, 4: 1721}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976571541_976571552 19 Left 976571541 4:86617566-86617588 CCCTCCCCCTTCCCCTTCCAGCA 0: 1
1: 0
2: 13
3: 202
4: 1721
Right 976571552 4:86617608-86617630 TTAATGATCGCCATTCTAACTGG 0: 5197
1: 15176
2: 5986
3: 5036
4: 6665
976571541_976571554 29 Left 976571541 4:86617566-86617588 CCCTCCCCCTTCCCCTTCCAGCA 0: 1
1: 0
2: 13
3: 202
4: 1721
Right 976571554 4:86617618-86617640 CCATTCTAACTGGTGTGAGATGG 0: 13371
1: 7321
2: 6736
3: 5195
4: 3433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976571541 Original CRISPR TGCTGGAAGGGGAAGGGGGA GGG (reversed) Intronic
900140534 1:1137786-1137808 GGCTGGGAGGGAGAGGGGGAGGG - Intergenic
900162145 1:1228821-1228843 TGCTGGGAGGGGCAGGGGCAGGG + Exonic
900190864 1:1351689-1351711 TGCGGGAAGGTGGAGGGGGCTGG - Intergenic
900210421 1:1452998-1453020 TGCTGGGCGGGGTGGGGGGACGG - Intronic
900216370 1:1483992-1484014 TGCTGGGCGGGGTGGGGGGACGG + Intronic
900359162 1:2279568-2279590 AGCTGCAGGGGGAGGGGGGAGGG + Intronic
900422116 1:2560164-2560186 TGGAGGCAGGGGAAGGGGCAAGG + Intronic
900458520 1:2789123-2789145 TGCTGGAAGGAGTAGTGGCAGGG + Intronic
900808990 1:4786941-4786963 TTGTGGAAGGGGCAGGGGTAGGG - Exonic
900916560 1:5643743-5643765 AGCTGGAAGAGGAAGGGCGGAGG + Intergenic
900996017 1:6124126-6124148 AGGTGGAAGGGAAAGAGGGAGGG + Intronic
901004372 1:6164793-6164815 TCTTGGAAGGGGAAGGGGGCTGG - Intronic
901061007 1:6471894-6471916 TCCTGGAACGGGGAAGGGGAAGG - Intronic
901183385 1:7356975-7356997 TGATGGGAGGGAAGGGGGGAAGG - Intronic
901441102 1:9278964-9278986 TGCTGGATTGGGATGGGGGCCGG + Intergenic
901821586 1:11833775-11833797 TGTTGGAAGGGGAACTGGTATGG + Intronic
902214443 1:14925230-14925252 GGGGGGAAGGGGCAGGGGGAAGG - Intronic
902368284 1:15991012-15991034 TGCAGGGAGGGGAAGGTGTAAGG + Intergenic
902396207 1:16133605-16133627 TTCTGGAAGGAGAAGGGGTGGGG + Exonic
902402480 1:16165833-16165855 GGCAGGAAGGGGAATGGGAATGG - Intergenic
902578307 1:17392422-17392444 TTCTGGAATGGGAAGGAGGCTGG - Intronic
902601275 1:17541150-17541172 TGGTGGAAGGGGAAGGGACAGGG - Intronic
902615442 1:17621064-17621086 TGGTGGAAGGGAAAGGAGAAGGG + Intronic
902642585 1:17776232-17776254 TGGTGGAAGGGGCAGGGTGAAGG - Intronic
902708445 1:18222438-18222460 TGCAGGCAAGGGAAGGGGGTTGG + Intronic
903018200 1:20375509-20375531 TGCTGGAAGGGGCTGGGAGGTGG - Intergenic
903057306 1:20645152-20645174 TCCTGGAAGGGGAAGAGGAACGG + Intronic
903151889 1:21415551-21415573 TCCTGCAAGGGAATGGGGGAAGG - Intergenic
903270867 1:22187479-22187501 TGGAGGAAGGGGAGGGGAGAGGG - Intergenic
903282381 1:22257392-22257414 AGGAGGAAGGGGCAGGGGGAGGG - Intergenic
903323728 1:22557284-22557306 TGCTGGAAGGGGAGGAGAGAGGG + Intergenic
903368326 1:22818437-22818459 GGCTGGATGGGGAAGAGGGCAGG - Intronic
903429303 1:23280340-23280362 GGGTGGAAGGGAGAGGGGGATGG + Intergenic
903441065 1:23388145-23388167 TGGTGGAAGGGGAAGGAGGGTGG + Intronic
903519250 1:23934975-23934997 TGTGGGGAGGGGGAGGGGGAGGG - Intergenic
903796058 1:25929771-25929793 TGATGGAAAGGGGAGGGAGAAGG - Intergenic
903998680 1:27324754-27324776 TGGTGTAAGGCAAAGGGGGAGGG + Intronic
904087191 1:27917133-27917155 AGGAGGAAGGGGAAGGAGGAAGG - Intergenic
904100352 1:28021266-28021288 TGCTGGGAAGGCAAGGGGGTTGG - Intronic
904131802 1:28281050-28281072 TGTGGGCAGGGGAAGGAGGAAGG - Exonic
904273451 1:29365237-29365259 TGGAGGAAGGGAAAGAGGGAAGG - Intergenic
904273465 1:29365308-29365330 TGGAGGAAGGGAAAGAGGGAAGG - Intergenic
904352438 1:29917412-29917434 AGGGGGAAGGGGAAGGGGAAGGG - Intergenic
904386496 1:30145950-30145972 TGCTGCCAGGGGAGGGAGGATGG + Intergenic
904430758 1:30462588-30462610 TGCGGGAGGGGGAAGGGGGTAGG + Intergenic
904599112 1:31664153-31664175 GGAAGGAAGGGGAAGGGGAAGGG + Intronic
904699498 1:32350047-32350069 TTCTTGAGGGGGCAGGGGGACGG - Intergenic
905116431 1:35645278-35645300 AACAGGTAGGGGAAGGGGGAAGG + Intergenic
905256448 1:36688506-36688528 TGTGGGAAGGGGAAGGAGTATGG + Intergenic
905256462 1:36688542-36688564 TGTGGGAAGGGGAAGGGAAATGG + Intergenic
905256483 1:36688596-36688618 TGTGGGAAGGGGAAGGGAAATGG + Intergenic
905256504 1:36688650-36688672 TGTGGGAAGGGGAAGGGAAATGG + Intergenic
905256525 1:36688704-36688726 CGTGGGAAGGGGAAGGGGTATGG + Intergenic
905256596 1:36688902-36688924 TGTGGGAAGGGGAAGGGGTGTGG + Intergenic
905256603 1:36688920-36688942 TGTGGGAAAGGGAAGGGGTATGG + Intergenic
905256648 1:36689038-36689060 CGTGGGAAGGGGAAGGGGTATGG + Intergenic
905430961 1:37923064-37923086 TGCTCAAAGAGGAAGGGGGCAGG + Intronic
905869403 1:41394549-41394571 TGGGGGGATGGGAAGGGGGATGG + Intergenic
905941658 1:41867923-41867945 TTTTGGAAGGGGAGGGGGGAGGG - Intronic
905965557 1:42092484-42092506 TGGTGGAAGGTGAAGGGGAGTGG + Intergenic
906129129 1:43445597-43445619 GGCAGGAAAGAGAAGGGGGAAGG - Intronic
906607880 1:47184096-47184118 TGCAGGAAGGGGCAGGGAGAAGG - Intronic
906684542 1:47755116-47755138 TGCTGGGAGGGGAAGGGAGGGGG + Intergenic
906827184 1:48993850-48993872 TGATGCCAGGAGAAGGGGGAGGG + Intronic
906952290 1:50344726-50344748 TGCTGGATGGAGAAGGGGGAGGG + Intergenic
907142877 1:52204783-52204805 TTCTGGCAGGGAAAGGGGAAAGG - Intronic
907350686 1:53828069-53828091 TGCTGCAATGGGAATGGTGATGG - Exonic
907494721 1:54836247-54836269 GGCGGGAGGGCGAAGGGGGAGGG - Intronic
907548651 1:55285436-55285458 TACTGGAAGGGGAAGGCAGAAGG + Intergenic
907909115 1:58811660-58811682 TGCTGGAACTGAAGGGGGGAAGG + Intergenic
907975371 1:59426378-59426400 TGAAGGGAGGGGAAGGAGGAAGG + Intronic
907992225 1:59594183-59594205 TGCTGGAAGAGGGGAGGGGATGG - Intronic
908252473 1:62275888-62275910 GGAAGGAAGGGGAAGGGGAAGGG + Intronic
908289640 1:62651300-62651322 TGGGGGGAGGGGGAGGGGGAGGG + Intronic
909058208 1:70847248-70847270 TGCTGGGAGGAGAAGGAGGCAGG - Intergenic
909676738 1:78246909-78246931 GGCTGGGAAGGGTAGGGGGAAGG - Intergenic
910123744 1:83818281-83818303 TGGTGGACGGGGAAGGGGAAGGG - Intergenic
910270639 1:85390467-85390489 TCCAGGAAAGGGAAGGGGGAAGG + Intronic
910332513 1:86090565-86090587 TGGTGGAAGTAGAAGGGGGTGGG - Intronic
910437807 1:87222878-87222900 TGCTGGGAGGGATAGGGGAAAGG - Intergenic
910840680 1:91558426-91558448 TTGGGGAGGGGGAAGGGGGATGG - Intergenic
910856155 1:91697948-91697970 AGGGGAAAGGGGAAGGGGGAAGG + Intronic
911158750 1:94661502-94661524 GGCTGGAGGGGAAAGAGGGAGGG + Intergenic
911215393 1:95187688-95187710 GTATGGAAGGGGCAGGGGGAGGG - Intronic
911308528 1:96262251-96262273 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
911405397 1:97431849-97431871 TAGTGGGAGGGGAAGGGGAAGGG - Intronic
911697931 1:100914325-100914347 TGAGGGGAGGGAAAGGGGGACGG - Intronic
912183303 1:107244658-107244680 AGCTGGCAGGAGAAGGAGGAAGG - Intronic
912241811 1:107918479-107918501 TGAAGGTAGGGGAATGGGGAGGG + Intronic
912297509 1:108484609-108484631 TTTTGGAAGTGGAAGGGGGCCGG - Intergenic
912383493 1:109260097-109260119 TGCTGCTAGGGGTGGGGGGAAGG + Intronic
912560847 1:110550539-110550561 GGCTGGAAGAGGAAAGGGAATGG - Intergenic
912667392 1:111594507-111594529 GGAAGGAAGGGGAAGGGGAAAGG + Intronic
912799559 1:112712515-112712537 GGGTGGAGGGGGTAGGGGGAGGG - Intronic
913342717 1:117775327-117775349 TGCCAGTGGGGGAAGGGGGAGGG + Intergenic
913534394 1:119757437-119757459 AGCTGGAAGAGGAAGCGTGAAGG + Exonic
914326135 1:146618674-146618696 TTGTGGAAGGGGAAAGGGCATGG + Intergenic
914425014 1:147567772-147567794 TCCTAGCAGGGGGAGGGGGAAGG - Intronic
914826262 1:151139797-151139819 TGGAGGAAGGGGGAAGGGGAGGG - Intronic
914931202 1:151935331-151935353 AGCTGGGAGGGGAAGGAGGCAGG + Intergenic
914942474 1:152035363-152035385 TTCTGGAAGGAAAAGGGGCAGGG - Intronic
914991554 1:152503318-152503340 AGATGGAAGGGAAAAGGGGAAGG - Intergenic
914992493 1:152510977-152510999 TTCTGGAAGGGGAGGGTGGAAGG + Exonic
915026865 1:152839047-152839069 TGGTGGGGGGGGAGGGGGGAGGG - Intergenic
915161291 1:153922609-153922631 TGGGGGAAGGGAAAGGTGGAGGG - Intronic
915431772 1:155872252-155872274 TGCAGGGAGGAAAAGGGGGATGG + Intronic
915461951 1:156075689-156075711 GGCTGGTAGGGGCAGGGGCAGGG + Exonic
915493858 1:156267245-156267267 GGCAGTAAGGAGAAGGGGGAAGG + Intronic
915596416 1:156898907-156898929 TGAAGGAAGGGGATGGGGAAAGG + Intronic
915831998 1:159140035-159140057 TGGGGGAAGGGGAAGGGGAAGGG - Intronic
915862406 1:159458813-159458835 TGGGGGAGGGGGAGGGGGGAGGG + Intergenic
915929863 1:160053692-160053714 GGATGGGAGGGAAAGGGGGAAGG - Intronic
916168356 1:161982677-161982699 TCCTGGAAGGGAAGGTGGGAGGG + Intergenic
916224756 1:162478490-162478512 TGAAGGAAAGGGAAGGGGAAGGG + Intergenic
916476121 1:165170624-165170646 AGATGGAAAGGGAAGGGGAAAGG - Intergenic
916677493 1:167076072-167076094 TGCTGGAAAGGGAAGAGAGCAGG + Intronic
916891174 1:169113896-169113918 TCCTGAAAGGTGATGGGGGAAGG - Intronic
917191234 1:172421789-172421811 TGCTGCCAGGGGATGGGGGAGGG - Intronic
917193535 1:172443802-172443824 GGCTGGGAGGGGACGGGGTAGGG + Exonic
917218697 1:172704556-172704578 TGGTGTTGGGGGAAGGGGGAGGG + Intergenic
917376275 1:174351068-174351090 TGGGGGGAGGGGGAGGGGGAGGG + Intronic
917470193 1:175319919-175319941 TTCTGGAAGGTGAAGGGGTCAGG - Exonic
917508538 1:175650710-175650732 GGCGGGGAGGGGTAGGGGGAGGG - Intronic
917754803 1:178088431-178088453 AGGTGGCAGGGGAAGGAGGACGG + Intergenic
917816226 1:178712812-178712834 TGATGGAAGGGGGAAAGGGAGGG + Intergenic
918236627 1:182586627-182586649 TCCAGGAAGAGGAAGGGGGCTGG - Exonic
918282416 1:183020403-183020425 GGATGGAGGGGGGAGGGGGAGGG - Intergenic
918328996 1:183438192-183438214 GGAAGGAAGGGGAAGGGGAAAGG + Intergenic
918808972 1:189091505-189091527 TGGTGTTAGGGGATGGGGGAGGG - Intergenic
918817513 1:189208593-189208615 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
919034503 1:192289280-192289302 GGCTGGGAAGGGAAGGGGGAGGG + Intergenic
919301939 1:195781404-195781426 GAATGGAAAGGGAAGGGGGAGGG + Intergenic
919709297 1:200710369-200710391 GCCTGTGAGGGGAAGGGGGAGGG + Intergenic
919756588 1:201069826-201069848 TGCAGGAAGGGGCAGGTGGTGGG - Intronic
919979845 1:202636006-202636028 GGCTGCAAGTGGTAGGGGGAAGG + Intronic
920101900 1:203522054-203522076 TGGTGGCAGGGAAGGGGGGATGG - Intergenic
920242127 1:204560690-204560712 TGCTGGAGTGGGAAGGGGCCTGG + Intergenic
920273648 1:204787289-204787311 TGGTGGAAGGGGAAGGGGAAGGG - Intergenic
920433574 1:205934286-205934308 TGCTGGAAGGGGAGGTGGACGGG + Intronic
920748006 1:208647195-208647217 AGGGGGAAGGGGAAGGGAGAGGG - Intergenic
921023692 1:211259209-211259231 TGGGGGGAGGGGAAGGGGGGAGG - Intronic
921377145 1:214486105-214486127 TGCAGGCAGGGGTAGAGGGAGGG + Intronic
921468864 1:215524696-215524718 TACTAGAAGGGGAGGGAGGAGGG - Intergenic
921501943 1:215915303-215915325 TGTTGGATGGGGAAGAGGTAGGG - Intronic
921524509 1:216200951-216200973 TGGGGGGAGGGGAAGGGGAAGGG - Intronic
921547051 1:216485508-216485530 GGCTGGAAGGGAAATGTGGAAGG + Intergenic
922069070 1:222173549-222173571 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
922268248 1:224008500-224008522 TGGGGGAGGGGGAGGGGGGAGGG + Intergenic
922320607 1:224483093-224483115 CACTGGCAGGGGAATGGGGAGGG + Intronic
922330419 1:224570314-224570336 TGCTAGAGGTGGGAGGGGGAGGG - Intronic
922333887 1:224603073-224603095 GGCTGGAGGGGAAAGAGGGAGGG + Intronic
922360168 1:224813959-224813981 TGTTGGTAGGGGTTGGGGGAGGG - Intergenic
922402787 1:225277118-225277140 AGGGGGACGGGGAAGGGGGAAGG + Intronic
922486900 1:225980439-225980461 TACTAGAAGAGGAAGGAGGAAGG + Intergenic
922549823 1:226485839-226485861 GGCTGGGAAGGGTAGGGGGAAGG - Intergenic
922612180 1:226938945-226938967 GGCTGGAGGGGGAAGATGGAAGG + Intronic
922721468 1:227902148-227902170 TGCTCCTAGGGGAAGAGGGATGG + Intergenic
922780623 1:228249872-228249894 GCCTGGGAGGGGAAGTGGGAGGG - Intronic
922781893 1:228259408-228259430 GCCTGGAAGGGGAAGTGCGAGGG - Intronic
922934279 1:229411487-229411509 GGCTGGAAAGGGGAGGGGGGAGG - Intergenic
923210495 1:231799866-231799888 GGAGGGAAGGGGAAGGGGAAGGG - Intronic
923482467 1:234397493-234397515 GGGGGGAAGGGGGAGGGGGAAGG + Intronic
923482471 1:234397500-234397522 AGGGGGAGGGGGAAGGGGGATGG + Intronic
923854209 1:237828529-237828551 TGTGGGAAGGAGGAGGGGGAAGG + Intronic
923858186 1:237866946-237866968 GGCTGGTAGTGGCAGGGGGAGGG + Intergenic
924247231 1:242096892-242096914 TGTGGGGAGGGGGAGGGGGAAGG - Intronic
924262898 1:242250386-242250408 CCCTGGAAGGTGAAGGGGAATGG + Intronic
924310030 1:242731607-242731629 TGCTGGAATGGGTAGGGAGAGGG - Intergenic
924381906 1:243473353-243473375 AGCAAGAAGGGGTAGGGGGAGGG - Intronic
1062824492 10:557841-557863 GGCAGGAAGGGGGAGGGGGCAGG + Intronic
1063207576 10:3849122-3849144 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1063348057 10:5329623-5329645 TAGAGGAAGGGGAAGGGGGTTGG - Intergenic
1063397181 10:5700088-5700110 GGCTGGAAAGGGTAGGAGGAAGG - Intronic
1063440794 10:6071423-6071445 TGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1063770250 10:9189362-9189384 TGGTGGAAGAGGAACGGGGTTGG - Intergenic
1063790978 10:9447521-9447543 GAGAGGAAGGGGAAGGGGGAAGG - Intergenic
1063813454 10:9742055-9742077 TGGTGGAAGGGGAGGCAGGAAGG - Intergenic
1063968776 10:11367159-11367181 AGTTGGGAGGAGAAGGGGGAGGG - Intergenic
1064261374 10:13788947-13788969 GGCTGGATGGGGAAGGGAAAGGG - Intronic
1064267342 10:13835833-13835855 TGGTGAAAGGGGGAGGGGGATGG - Intronic
1064525233 10:16249268-16249290 TACTAGAAGGGGAGGGAGGATGG + Intergenic
1064595717 10:16942838-16942860 AGGGGGAAGGGGAAGGGGAAGGG + Intronic
1064705608 10:18069703-18069725 AGCTGGAAGGGGAATGGAGTGGG - Intergenic
1064736008 10:18382532-18382554 TGGTGGGTGGGGAAGGGAGAAGG - Intronic
1065001973 10:21345532-21345554 GGCTGGAGGGGGAGGGGGCATGG + Intergenic
1065063109 10:21929140-21929162 TCCTGGAGGTGGTAGGGGGAGGG + Exonic
1065204486 10:23344163-23344185 GGTGGGGAGGGGAAGGGGGAAGG + Intronic
1065377374 10:25057244-25057266 GCCTGGAAAGGGAAGGGGAATGG + Intronic
1065603494 10:27393130-27393152 TCCTGGAAGGGGTAGGGGTGGGG - Intergenic
1065696834 10:28388127-28388149 AGGTGGAAGGGGAAAGGGAAGGG + Intergenic
1065796370 10:29311960-29311982 AAAGGGAAGGGGAAGGGGGAGGG + Intronic
1066334580 10:34463041-34463063 GGGAGGAAAGGGAAGGGGGAGGG + Intronic
1066440219 10:35431370-35431392 GGAGGGGAGGGGAAGGGGGAGGG - Intronic
1066642840 10:37573657-37573679 TGCTGGAAGTGGGAGGTAGATGG - Intergenic
1066705845 10:38176499-38176521 TGCTGGGAGAGGCAGAGGGATGG + Intergenic
1066721888 10:38348068-38348090 CCCTGGAAGGTGAAGGGGAATGG - Intergenic
1066934935 10:41817586-41817608 TGGGGTTAGGGGAAGGGGGAGGG - Intergenic
1067062463 10:43084847-43084869 TGGAGGAAGGGGAAGGTGCAAGG + Intronic
1067216153 10:44305605-44305627 GGCAGGAAGGGGAAGAGGGAAGG + Intergenic
1067321369 10:45224217-45224239 TGCAGGGAGGGGATGGGGCAGGG + Intergenic
1067364004 10:45608124-45608146 AGGGGGAAGGGGGAGGGGGAAGG + Intergenic
1067448365 10:46366822-46366844 AGCTGGAAGGCCAAGAGGGAGGG + Intergenic
1067473825 10:46553705-46553727 TTGTGGAGGGGGAATGGGGAAGG - Intronic
1067524255 10:47028721-47028743 TGCTGGAAGGGGAGCCCGGAGGG + Intergenic
1067589012 10:47493944-47493966 AGCTGGAAGGCCAAGAGGGAGGG - Intergenic
1067636137 10:48002035-48002057 AGCTGGAAGGCCAAGAGGGAGGG - Intergenic
1067832305 10:49617177-49617199 GGGGGAAAGGGGAAGGGGGAAGG - Intronic
1068015925 10:51516191-51516213 TGCTGGAATGGGGATGGGAAGGG + Intronic
1068075521 10:52248965-52248987 TGGGGAAGGGGGAAGGGGGAAGG - Intronic
1068226053 10:54108267-54108289 TTCTGCCAGGGGATGGGGGAGGG - Intronic
1068269169 10:54697652-54697674 GGAAGGAAGGGGAAGGGGGAAGG + Intronic
1068281648 10:54878818-54878840 TGCTGAGTGGGGTAGGGGGAGGG - Intronic
1068317392 10:55364165-55364187 TGGCAGAAGGGGAAGGGGAAGGG - Intronic
1068397942 10:56488016-56488038 TGCTGGAGGGGGGAGGGGGCTGG + Intergenic
1068402340 10:56546348-56546370 GGCTGGAAGGGAAAGAGGAATGG + Intergenic
1068438367 10:57019568-57019590 TTGTGGAAGGGGCAGTGGGAGGG - Intergenic
1068665276 10:59668367-59668389 GGTTGGAAGGGGAGTGGGGATGG - Intronic
1068891352 10:62151289-62151311 AGGAGGAAGGGGATGGGGGAAGG - Intergenic
1068935855 10:62635123-62635145 TGCTGGAAGGAGAGATGGGAGGG + Intronic
1069037889 10:63664601-63664623 TGTTGGGAGGGGCGGGGGGAGGG + Intergenic
1069568613 10:69480277-69480299 TGGGGGCAGGGGAATGGGGAAGG + Intronic
1069603947 10:69728309-69728331 TGGAGGAAGGGGAAGCAGGAAGG - Intergenic
1069651551 10:70053270-70053292 TACTGAGAGGGGAAGGAGGAGGG + Intronic
1069748582 10:70731688-70731710 TGGAGGAAGGGGAAAGGGAATGG - Intronic
1069974003 10:72198126-72198148 AGAGGGGAGGGGAAGGGGGAGGG + Intronic
1069996529 10:72345202-72345224 TGCTGGGAGGGGAAGTGAGTGGG - Intronic
1070126394 10:73625720-73625742 TGCTGGGAGGTCCAGGGGGAGGG - Intronic
1070132698 10:73666040-73666062 AGCTGGAAGGCCAAGAGGGAGGG - Intergenic
1070442850 10:76463639-76463661 CGGTGGCAGGGGAGGGGGGAAGG + Intronic
1070601598 10:77870020-77870042 TGCTGAAATGGGATGGGGGATGG - Intronic
1070827516 10:79399750-79399772 TGCAGGGCGGGGAAGTGGGAGGG + Intronic
1071164163 10:82785204-82785226 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1071315527 10:84392186-84392208 TACTGGAAGGGGCAGGAGGGAGG + Intronic
1071506381 10:86234187-86234209 TGGAGGAAGGAAAAGGGGGATGG - Intronic
1071549144 10:86552841-86552863 AGGTGGAAGGGTAAGAGGGAAGG - Intergenic
1071608987 10:87018034-87018056 GGCTGGAAGGCCAAGAGGGAGGG + Intergenic
1071729905 10:88237304-88237326 GGAAGGAAGGGGAAGAGGGAAGG - Intergenic
1071899892 10:90108751-90108773 GGGTGGGACGGGAAGGGGGAAGG + Intergenic
1072108022 10:92291830-92291852 TTGGGGAGGGGGAAGGGGGAGGG - Intronic
1072255575 10:93617283-93617305 TACAGGATGGGGATGGGGGAGGG - Intronic
1072321196 10:94251946-94251968 TCCTGGAAGGGAGAGGGGCAGGG - Intronic
1072341108 10:94451008-94451030 GGCTGGAAAGGGTAGGAGGAAGG + Intronic
1072842917 10:98795311-98795333 TGCTGCCAGGGGATGTGGGAGGG - Intronic
1072952794 10:99862596-99862618 GGCTGGGAGGGGTAGGGGAAAGG - Intergenic
1073196374 10:101694978-101695000 CGAAGGAAGGGGAAGGGGAAGGG - Exonic
1073260601 10:102187302-102187324 TGCTGAATGGGAAAGTGGGATGG + Intergenic
1073348510 10:102802089-102802111 AGGTGGAAGGAGGAGGGGGAAGG - Intronic
1073592128 10:104767624-104767646 AAGTGGGAGGGGAAGGGGGAAGG - Intronic
1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG + Intergenic
1073930041 10:108565524-108565546 GACGGGAAGGGGAAGGGGAAGGG + Intergenic
1073956191 10:108874281-108874303 TGCTGGAGGGGGAGGGGGAGGGG - Intergenic
1074062628 10:109981300-109981322 ACCTGGAAAGGGAAAGGGGATGG + Intergenic
1074079007 10:110152684-110152706 TTCTGAATGGGGAAGGAGGAAGG + Intergenic
1074146731 10:110723341-110723363 TGAGGGAAGGGGAAAGGGAAGGG - Intronic
1074163755 10:110857020-110857042 GGGGGGAGGGGGAAGGGGGAAGG + Intergenic
1074475454 10:113769828-113769850 TGCTGGAAGGGCCAAGGAGAGGG - Exonic
1074516992 10:114179454-114179476 TGCATGAAGGGGAAGGGAGGGGG + Intronic
1074526518 10:114267797-114267819 TGCAGGAAGGTGAGGGAGGAGGG + Intronic
1074691135 10:116005087-116005109 AGGAGGAAGGGGAAGGGAGAGGG - Intergenic
1074750254 10:116578956-116578978 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1074759965 10:116659989-116660011 TGCAGGATGGGGAGTGGGGACGG + Intergenic
1074803375 10:117025203-117025225 TGCTGCCAGGGGATGGGTGAGGG - Intronic
1074827915 10:117228223-117228245 TGGAGGAAGGGAAAGAGGGAGGG - Intergenic
1074853782 10:117458437-117458459 TGCTGGCAGGGGACGAGGCAGGG - Intergenic
1074994147 10:118741138-118741160 TCCAGGAATGGGAAGGGGTAGGG + Intronic
1075057717 10:119232320-119232342 GGCTGGGAAGGGTAGGGGGAAGG + Intronic
1075136092 10:119787613-119787635 GGAAGGAAAGGGAAGGGGGAGGG + Intronic
1075249351 10:120851549-120851571 TGTGTGAGGGGGAAGGGGGAAGG + Intronic
1075468355 10:122669144-122669166 GGCTGGAAGGGAAAGAGGGAGGG + Intergenic
1075506047 10:123023771-123023793 TGCTGAATGGGAAAGTGGGATGG - Intronic
1075745153 10:124722025-124722047 GGCTGGGAAGGGTAGGGGGAAGG + Intronic
1076189801 10:128475064-128475086 GGCTGGAAGCAGAAGGGGGACGG - Intergenic
1076269021 10:129134231-129134253 TGATAGAAGGGGGAGGGAGAGGG - Intergenic
1076292585 10:129358875-129358897 TTTTGTAAGGTGAAGGGGGAAGG + Intergenic
1076376693 10:129993085-129993107 TGCTGCTAGGGGATGGGAGAGGG - Intergenic
1076471010 10:130718236-130718258 TGGAGGGAGGGGAAGGGAGAAGG + Intergenic
1076576678 10:131474241-131474263 GGCTGGGAGGGGGAGGGGTATGG - Intergenic
1077080043 11:721119-721141 TGCTGGAAGGGGATGGGCGCCGG - Exonic
1077153957 11:1083304-1083326 TGCTGGAGGGGGTGGTGGGAGGG + Intergenic
1077163255 11:1123126-1123148 GGAAGGAAGGGGGAGGGGGAAGG - Intergenic
1077359447 11:2134228-2134250 AGCTGGAAGGGGAAGGTCGCTGG + Intronic
1077616115 11:3675300-3675322 TTCTGGAAGGGGTAGATGGAGGG + Exonic
1077662905 11:4085043-4085065 GGCTGGGAGGGAAAGAGGGAAGG + Intronic
1078085737 11:8232163-8232185 TGCAGGGAGGAGAAGGAGGAGGG - Intronic
1078127321 11:8580481-8580503 GGAGGGAGGGGGAAGGGGGAGGG + Intronic
1078127324 11:8580487-8580509 AGGGGGAAGGGGGAGGGGGATGG + Intronic
1078153464 11:8778421-8778443 AGCTGTCAGGGGCAGGGGGAGGG - Intronic
1078362566 11:10680531-10680553 GGAAGGAAGGGGAAGGGGAAGGG + Intronic
1078400318 11:11020540-11020562 AGAAGGAAGGGGAAGGGAGAAGG - Intergenic
1079391034 11:20022333-20022355 GGCTGGAAGGGGAGGTGGGTGGG - Intronic
1079426818 11:20351405-20351427 TGCAGGACGGGGAATGGGAAGGG + Intergenic
1079571487 11:21949094-21949116 TCCTGGATGGGGAAGTTGGAGGG - Intergenic
1079612489 11:22450686-22450708 TGCTGGGAGAGGAAGGGAGGTGG + Intergenic
1080128452 11:28765851-28765873 TGCTGCTAGGGGATGGGGGAAGG - Intergenic
1080239651 11:30112066-30112088 ACCTGGAAGGGGAAGGGAGGAGG - Intergenic
1080258779 11:30323201-30323223 AGGTGGAAGGGGAACGGGGGAGG + Exonic
1080438550 11:32268940-32268962 AATGGGAAGGGGAAGGGGGAGGG + Intergenic
1080812878 11:35723047-35723069 AGTTGGAAGGGGGAGAGGGAGGG - Intronic
1080961338 11:37164025-37164047 TGATGGTAGGGAAAGGGAGAAGG - Intergenic
1081112736 11:39157003-39157025 TGGGGGAAGGGGAAGGGGGGAGG - Intergenic
1081126248 11:39326646-39326668 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
1081520037 11:43872788-43872810 TGCTGGAGGGGAAAGAGAGAGGG + Intergenic
1081531090 11:43959832-43959854 TGCGGGAAGAGGAATGGGGTGGG - Intergenic
1081607571 11:44536972-44536994 TGCTGGGAGGGGAAGTGCAAGGG + Intergenic
1081670617 11:44940224-44940246 GGCTGGAAGAGGAAGGGCGTGGG - Intronic
1081691236 11:45080104-45080126 TGCTGGTGGGGGGAGGGTGAGGG - Intergenic
1082042112 11:47694746-47694768 TGTTGGAAGTGGAAGAGGGGAGG - Intronic
1082207985 11:49462252-49462274 GGGGGGAGGGGGAAGGGGGAGGG - Intergenic
1082244476 11:49905292-49905314 GAATGGAGGGGGAAGGGGGAAGG + Intergenic
1082314515 11:50700445-50700467 TGGTGTGAGGGGAAGGGGGAGGG + Intergenic
1082757650 11:57093587-57093609 TGCTGGAAGAGTGAGGGAGAGGG - Intergenic
1082849582 11:57753312-57753334 GGCTGCAAGAGGCAGGGGGATGG + Intronic
1083152328 11:60799642-60799664 TGGAGGAAGGGCAAGGGTGATGG - Intronic
1083243174 11:61404604-61404626 TGGAGGAAAGGGAAGGGGGTGGG + Exonic
1083262040 11:61528354-61528376 GGAGGGGAGGGGAAGGGGGAGGG + Intronic
1083593808 11:63909755-63909777 TGCTTGGAGGGGAAGGAGGGAGG - Exonic
1083746402 11:64739475-64739497 TTCTGGAAGGCAAATGGGGACGG + Exonic
1083767166 11:64847161-64847183 TCCTGGAAGGGGGAGGGGGCAGG + Intergenic
1083878568 11:65537383-65537405 TGGAGGAGGGGAAAGGGGGACGG - Intronic
1083890110 11:65591779-65591801 TGCTGGAAGGTGGCGGGGGGTGG - Exonic
1083904347 11:65660396-65660418 GGCTGGCAGGGGCAGGGGCACGG - Intronic
1083908757 11:65692688-65692710 TGCGGGGAGGGGCAGGGAGATGG + Intergenic
1083964482 11:66035029-66035051 TGGCACAAGGGGAAGGGGGAAGG + Intergenic
1084165479 11:67373134-67373156 GGCTGGGAGAGGAAGAGGGAGGG - Intronic
1084514573 11:69629520-69629542 TGCTGGAAAGGGAAGGAAGTTGG - Intergenic
1084546086 11:69815834-69815856 GCCTAGGAGGGGAAGGGGGATGG - Intronic
1084561207 11:69906397-69906419 TGGGGGGAGGGGGAGGGGGAGGG - Intergenic
1084698380 11:70769929-70769951 TGCTGGAGGCTGAAGGGGGTGGG + Intronic
1084923926 11:72496275-72496297 GGCTGGGAAGGGAAGGGGGAAGG + Intergenic
1085164739 11:74388144-74388166 TGCTGGAAGGGAAGGAGGAATGG + Intronic
1085172637 11:74462235-74462257 TGCAGGAAGGGGAGGGGCCATGG - Intronic
1085225851 11:74920516-74920538 TCCTGGTAGGGAAAGGAGGAAGG + Intronic
1085242672 11:75071600-75071622 TGCTGGAATGGGCAGGAGGAGGG + Intergenic
1085244523 11:75089222-75089244 TGCTGGGATGGGCAGGAGGAGGG + Exonic
1085249274 11:75131488-75131510 TGCTGGAATGGGCAGGAGGAGGG + Intronic
1085398095 11:76217799-76217821 AGGTGGCCGGGGAAGGGGGAGGG + Intergenic
1085402205 11:76241801-76241823 TGCCCGAAGGGGCAGGGGGTGGG + Intergenic
1085473172 11:76771207-76771229 GGGTGGAAGGGGCAGGAGGAGGG - Intergenic
1085639970 11:78187529-78187551 TTCTGGAAGGGGCTGGGGGATGG - Intronic
1085759973 11:79233433-79233455 TTGTGGAAGAGGCAGGGGGACGG + Intronic
1086135603 11:83441219-83441241 TGGCGGAAGGGGAAGGGGAAGGG + Intergenic
1086165442 11:83772480-83772502 GGAAGGAAGGAGAAGGGGGAGGG + Intronic
1086287455 11:85265852-85265874 AGCTGGAAAGGGAATGGGAATGG - Intronic
1086500613 11:87449283-87449305 TGCATGAAGGGGAGAGGGGAGGG + Intergenic
1086518765 11:87646102-87646124 AGGGGGAAAGGGAAGGGGGAAGG - Intergenic
1086518844 11:87646295-87646317 TGTAGGGAAGGGAAGGGGGAAGG - Intergenic
1086629535 11:89000088-89000110 TGGGGTGAGGGGAAGGGGGAGGG + Intronic
1086964491 11:93013738-93013760 GGGTGGAAGGGCAAGGGGGACGG - Intergenic
1087028369 11:93675009-93675031 TACAGGAAAGGGAAGGGGGAAGG + Intronic
1087051982 11:93895654-93895676 AGCAAGAAGGAGAAGGGGGAGGG + Intergenic
1087189840 11:95241960-95241982 AGCTGGGAGGGGTAGGAGGAGGG + Intergenic
1087474839 11:98622152-98622174 GGAAGGAAGGGGAAGGGGAAGGG - Intergenic
1088155751 11:106800738-106800760 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1088367757 11:109056919-109056941 TGCTTGAAGGGGATGGGTGGAGG + Intergenic
1088530515 11:110803489-110803511 TGGTGGGGGGGGAGGGGGGAGGG - Intergenic
1088659280 11:112029438-112029460 AGTTGGAAGGGAAAGGGGAAGGG + Intronic
1088740409 11:112762415-112762437 TGCTGGGAGAGGATGGAGGAAGG + Intergenic
1088886415 11:114010981-114011003 TGCTGGAAGGTCAAGGGGAGTGG - Intergenic
1089520574 11:119059932-119059954 TGGGGAAAGGGGGAGGGGGAGGG + Intergenic
1089551275 11:119280650-119280672 TGCTGGAGGGGGCAGAGGCAGGG - Intronic
1089597579 11:119590852-119590874 TCCTGGAGGTGGAAGGGAGAGGG + Intergenic
1090092488 11:123710826-123710848 AGTTGGAATGGGCAGGGGGAAGG - Intergenic
1090333915 11:125950472-125950494 TGTGGGAAGGGGAAGGGGAAGGG + Intergenic
1090384003 11:126346001-126346023 GGATGGCAGGGGAAGGAGGAGGG - Intergenic
1090391157 11:126388573-126388595 TTCTGGAAGGCCAAGGTGGATGG - Intronic
1090400951 11:126447826-126447848 GGCTTCAAGGGCAAGGGGGAGGG + Intronic
1090505390 11:127306929-127306951 AGGGGGAAGGGGAAGGGGAAAGG - Intergenic
1090703205 11:129314748-129314770 TGGGGGAGGGGGAAGGGGAAGGG - Intergenic
1090833512 11:130437047-130437069 TGGTGGGAGAGGAAGGGGGGAGG + Intergenic
1090885513 11:130872807-130872829 TGCTGGATGTGGAAGGGGATGGG - Intergenic
1090892770 11:130941446-130941468 TGGTGTGAGGGGAGGGGGGAGGG - Intergenic
1091015839 11:132050136-132050158 TGCTGGCAGGGGACTGGGGAAGG + Intronic
1091042308 11:132293193-132293215 TGATGGAAGAGGAAGAGGCAGGG + Intronic
1091136359 11:133194182-133194204 TGGGGGAAGGGGAAAGGGAAGGG - Intronic
1091218743 11:133918659-133918681 TGGGGGACGGGGCAGGGGGAGGG + Intronic
1091265414 11:134267155-134267177 CGCTGGATGTGGAAGGTGGAAGG + Intergenic
1091288414 11:134422447-134422469 TCCTGCCAGGGAAAGGGGGATGG + Intergenic
1091493559 12:952938-952960 GGAGGGGAGGGGAAGGGGGAAGG + Intronic
1091513487 12:1153836-1153858 TGCAGGAAGGGAAAGGGCCAGGG - Intronic
1091694521 12:2618756-2618778 AGAAGGAAGGGGAAGTGGGATGG + Intronic
1091742936 12:2972998-2973020 TGCCAAGAGGGGAAGGGGGAGGG - Intronic
1091798104 12:3308773-3308795 GGCTGGAGGGGGCAGGGAGAGGG + Intergenic
1091798607 12:3310927-3310949 TGCTGGAGGGGTGAGGAGGAGGG + Intergenic
1091853688 12:3721851-3721873 TGTGGGGAGGGGAAGGGAGATGG + Intronic
1092085349 12:5753249-5753271 GGCTGGAGGGGAAAGAGGGAGGG + Intronic
1092179929 12:6439500-6439522 AGCTGGAAGGGGCAAGGAGATGG - Intergenic
1092241935 12:6840799-6840821 AGCTGGCAGGGGTGGGGGGAAGG - Intronic
1092305641 12:7297872-7297894 GGCTGGAGGGGGAAAGGAGAGGG + Intergenic
1092458121 12:8662829-8662851 GGCTGGAATGAGAAGGGAGATGG + Intronic
1092700976 12:11230528-11230550 GGCTGGGAAGGGAAGGGGGAAGG - Intergenic
1092817376 12:12323188-12323210 GGATGGGAGGGGAGGGGGGAGGG + Intergenic
1093420147 12:18965421-18965443 TGCTGTCAGGAGATGGGGGAGGG + Intergenic
1093459228 12:19393277-19393299 AAGGGGAAGGGGAAGGGGGAAGG + Intergenic
1093488152 12:19675276-19675298 GGCTGGGAAGGGAAGGGAGAAGG - Intronic
1093765648 12:22959047-22959069 TGCTGGTAGGGTAATGGGAAAGG - Intergenic
1093948067 12:25133527-25133549 TGCTGAAGGGGGAAGGGTGGTGG - Intronic
1094206503 12:27845739-27845761 GGCAGGAAGGGGCCGGGGGAGGG - Intergenic
1094259726 12:28479464-28479486 TGGGGTAGGGGGAAGGGGGAAGG + Intronic
1094264268 12:28538247-28538269 TGGGGGGGGGGGAAGGGGGAGGG - Intronic
1094772749 12:33684479-33684501 AGGGAGAAGGGGAAGGGGGAGGG - Intergenic
1095134284 12:38579673-38579695 GGCTGGGAAGGGAAGTGGGAGGG + Intergenic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095559343 12:43547345-43547367 TACTGGAGGGGGAGGGGGAAAGG + Intronic
1095819290 12:46459831-46459853 TGCAGGAGGGGGATGGAGGAGGG + Intergenic
1095860126 12:46907741-46907763 TGCTGCAGGGGGAGAGGGGAGGG - Intergenic
1095863578 12:46947220-46947242 TGAAGGAAGGAGAAAGGGGAAGG - Intergenic
1095947538 12:47762166-47762188 TGCTTGAAGGGAATGGGGGAGGG - Intronic
1095982457 12:47981168-47981190 AGATGGGAAGGGAAGGGGGAAGG - Intronic
1096183943 12:49566284-49566306 GGCTGGCAGGGGAAGGGGGCTGG - Intronic
1096411947 12:51383361-51383383 TGCTGGAGTGGGAAGGTAGATGG - Intronic
1096623339 12:52878147-52878169 AGCTGAAAGGCGGAGGGGGAAGG - Intergenic
1096749165 12:53747918-53747940 TACTGGAAGGGGGTGTGGGAAGG - Intergenic
1096877904 12:54644843-54644865 TAGGGGAAGGGGAAGGGGAAGGG + Intronic
1096891011 12:54771149-54771171 GGATGGTAGGAGAAGGGGGATGG - Intergenic
1097113014 12:56676123-56676145 GGCTGGGAGGGGGAGGGGGAGGG + Intronic
1097174632 12:57135715-57135737 TGCAGGGAGGGGATGGGGGATGG - Intronic
1097453330 12:59764473-59764495 TGGTGGAGGGGGAGGGGGGAGGG - Intronic
1097540699 12:60938522-60938544 TGGTGAAAGGGAAAGGGGGAAGG - Intergenic
1097602216 12:61706866-61706888 GGATGGGAGGGGAGGGGGGAGGG + Intergenic
1097695361 12:62769851-62769873 GGCTGGAGGGGAAAGAGGGAGGG + Intronic
1097710870 12:62915576-62915598 GGATTGAAGGGGAAGTGGGAGGG - Intronic
1098255590 12:68611656-68611678 TGCGGGAAGTGGCAGGAGGAAGG + Intronic
1098358372 12:69632000-69632022 GGAAGGAAGGGGGAGGGGGAGGG - Intergenic
1098603973 12:72367423-72367445 AGCTGGAAGGAGGAAGGGGAAGG - Intronic
1098938408 12:76506743-76506765 TCCTGGAAGGGGAAAGTGGCTGG + Intronic
1098953767 12:76667987-76668009 TGGTGGGAGGGGAAGGAAGAGGG - Intergenic
1099433605 12:82618482-82618504 TGCTGCCAGGGGATGGAGGATGG - Intergenic
1099734224 12:86547304-86547326 AGCAGGAAGAGGAAGGGGGGAGG - Intronic
1099796972 12:87411654-87411676 TGGTGGAAGGGGAAGCAGGCAGG - Intergenic
1099826241 12:87780612-87780634 TGCTGCCAGGGTATGGGGGAGGG + Intergenic
1100324723 12:93530227-93530249 AGGAGGAAAGGGAAGGGGGAAGG - Intergenic
1100399944 12:94220754-94220776 TGGTGGAGGGGGAAGGGGTAAGG + Intronic
1100535209 12:95502247-95502269 TGCTGGAAGGCCAAGGTGGGAGG - Intronic
1100713789 12:97284746-97284768 TGCTGGATGGAGAAGGTGCATGG - Intergenic
1101026257 12:100609489-100609511 TGCTGCCAGGGGATGGGGGAGGG + Intronic
1101348566 12:103907209-103907231 GGAAGGAAGGGGGAGGGGGAGGG + Intergenic
1101358823 12:104007294-104007316 ATCTGGAAAGAGAAGGGGGAGGG - Intronic
1101640173 12:106581801-106581823 TGCTGGAAGTGGAAGTGAGGGGG - Intronic
1101685911 12:107020618-107020640 TGGTGGAAGGGGAAGGGAAAGGG - Intronic
1102079924 12:110089648-110089670 TGCAGGAAGAGGAGAGGGGATGG + Intergenic
1102230383 12:111257682-111257704 AGGAGGAAGGGGAAGGAGGAGGG - Intronic
1102728101 12:115083541-115083563 TGAAGGAAGGGGAAGAGAGAGGG + Intergenic
1102834968 12:116047711-116047733 TGCTTGAGGGTGAAGAGGGATGG - Intronic
1103200530 12:119084308-119084330 TTCTGGAAGGTGAGAGGGGAAGG + Intronic
1103593702 12:122010150-122010172 TGCTTCCAGGGGAGGGGGGACGG - Intergenic
1103604979 12:122079441-122079463 TGCTGGCAGGGGAAGAGGCCAGG - Intronic
1103698350 12:122835084-122835106 GGAGGGTAGGGGAAGGGGGAGGG - Intronic
1103775782 12:123365164-123365186 TCCGCGAAGGGGGAGGGGGAAGG + Intergenic
1104073247 12:125366012-125366034 GGCTGGGAAGGGAAGTGGGAAGG - Intronic
1104250304 12:127087158-127087180 TGCTGGGTGGGGAAGGTGGTTGG + Intergenic
1104256655 12:127145691-127145713 TGCTGGAAAGGCAAGGGACAGGG - Intergenic
1104410940 12:128557178-128557200 TGCTGGGCTGGGAAGTGGGAAGG - Intronic
1104451663 12:128874007-128874029 GGGAGGAAGGGGAAGGGGAAGGG - Intronic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1104554044 12:129783973-129783995 TGCTGGAAGAGGGAACGGGATGG - Intronic
1104580632 12:130008529-130008551 TGCCGGAAAGGGAGGGGGGCAGG + Intergenic
1104805191 12:131585455-131585477 TGTGGGATGGGGGAGGGGGAGGG + Intergenic
1104842735 12:131832380-131832402 TGGGGGAACGGGAAGGGGGAAGG + Intronic
1104980572 12:132571540-132571562 TGCTGGCAGGGGGCGGGGGCGGG + Intronic
1104983012 12:132582407-132582429 TGGGGGAGGGGGAACGGGGAAGG - Intronic
1105435914 13:20378256-20378278 AGGTGGAAGGGGAAGGGGCCAGG - Intergenic
1105445519 13:20452128-20452150 TACTAGAAGAGGAAGGGAGAGGG + Intronic
1105760755 13:23512264-23512286 TGGTGGCAGGTGAGGGGGGACGG - Intergenic
1105896236 13:24719061-24719083 TGCTGAAAAGCGAAGGTGGAGGG - Intergenic
1106223671 13:27769154-27769176 TGCTGGAAGGGGACAGGATATGG - Intergenic
1106625143 13:31412941-31412963 GGATGAAAGGGGAAGGGGCATGG + Intergenic
1106675894 13:31957653-31957675 AGGGGGAAGGGGAAGGGGAAGGG + Intergenic
1106865478 13:33959703-33959725 TGGTGGTAGAGGAAGGGGCAGGG - Intronic
1107017170 13:35716858-35716880 TGCTGGCTGGGGAAGCGGGCTGG - Intergenic
1107524330 13:41214754-41214776 TGCTGCTAGGGGAACGGGGAAGG + Intergenic
1107652349 13:42557941-42557963 TGCGGTGGGGGGAAGGGGGAGGG + Intergenic
1108025809 13:46176047-46176069 GGCTGGGAAGGGTAGGGGGAAGG + Intronic
1108315713 13:49235140-49235162 GGATGGAGGGGGAAGGGGGAGGG + Intergenic
1108324049 13:49312925-49312947 TGCTGGAGGTGGGAGGGGAAAGG - Intronic
1108687714 13:52835264-52835286 TGCTGTGATGGGGAGGGGGAGGG + Intergenic
1108689612 13:52848999-52849021 TGTTGGCAGGGGCTGGGGGAAGG - Intergenic
1109084633 13:57954385-57954407 TGCGGTGGGGGGAAGGGGGAGGG - Intergenic
1109569950 13:64174761-64174783 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1109633251 13:65080680-65080702 GGCTGGAAGGGGTTGGGGGGTGG - Intergenic
1109927745 13:69168251-69168273 AGCTGGAAGGGGAATGGAGTGGG - Intergenic
1110330572 13:74267572-74267594 GGCTGGAAAGTGTAGGGGGAAGG + Intergenic
1110690252 13:78424176-78424198 AATTGGAAGGGGAAGGGGAAGGG + Intergenic
1111085935 13:83374724-83374746 TGCTGCCAGGGGATGGAGGAGGG + Intergenic
1111605183 13:90529186-90529208 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1111690363 13:91556064-91556086 TGGTGGAAGGGATAGGGGTATGG - Intronic
1111714489 13:91863002-91863024 TGGGGGAAGGGAAAGGGAGAGGG - Intronic
1112135775 13:96576150-96576172 TTCTGGAAGGGAACGGGCGAGGG + Intronic
1112167906 13:96939392-96939414 TCCTGGAAGAGGAAGGTTGACGG - Intergenic
1112320580 13:98403534-98403556 TGCTGGGTGGGGAAGTGGGTGGG + Intronic
1112513025 13:100026834-100026856 AGTTGGAAGGGGAAGCAGGAGGG - Intergenic
1112588050 13:100737193-100737215 TGCCAGAAGGGCAAGTGGGATGG + Intergenic
1113159591 13:107364972-107364994 AGGGGGATGGGGAAGGGGGAGGG - Intronic
1113179797 13:107612104-107612126 GGGAGGAAGGGGAGGGGGGAGGG + Intronic
1113319112 13:109214837-109214859 TGGTGGAAGGTGAAGAGGAAGGG + Intergenic
1113366817 13:109684169-109684191 TGCTGGCAGGGGCTGGGGGGAGG - Intergenic
1113459743 13:110473276-110473298 TGCTGGAAGGCCATGGGAGAAGG - Intronic
1113647208 13:112006967-112006989 GGCAGGGAGGGGGAGGGGGAGGG + Intergenic
1113711325 13:112467257-112467279 TGCGGGAAGGGGAAGAGGAAGGG - Intergenic
1113749168 13:112766615-112766637 TAAGGGAAGGGGAAGGGGGAGGG + Intronic
1113783008 13:112987232-112987254 CGCTGGAAGGGGCAGGTGGAGGG - Intronic
1113835978 13:113328818-113328840 TCCTGGTAGGGAAAGGGAGAGGG - Intronic
1113864570 13:113512572-113512594 TGCTGGAACTGGAAGGGGGCCGG + Intronic
1113864585 13:113512640-113512662 TGCTGGGACTGGAAGGGGGCTGG + Intronic
1113864598 13:113512708-113512730 TGCTGGAACTGGAAGGGGGCCGG + Intronic
1113955600 13:114098639-114098661 GGCAGGAAGGGCAAGGGGCATGG + Intronic
1113975566 13:114225419-114225441 GGGAGGAAGGGGAGGGGGGAGGG + Intergenic
1114050487 14:18916727-18916749 AGCTGGCATGGGAAGGAGGATGG - Intergenic
1114112070 14:19485205-19485227 AGCTGGCATGGGAAGGAGGATGG + Intergenic
1114668979 14:24398935-24398957 TGCTGGAGGGGGAAGGCTGGGGG + Exonic
1114909352 14:27171053-27171075 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1114928960 14:27443369-27443391 TGGTGGAAAGGCAAAGGGGAAGG + Intergenic
1115181776 14:30635421-30635443 GGATGGAAGAGGATGGGGGAGGG - Intronic
1115344810 14:32331048-32331070 TGCTAGATGGTGATGGGGGAAGG + Intronic
1115507918 14:34110436-34110458 TTCTGGAAGAGAAAGGAGGAGGG - Intronic
1115520661 14:34230073-34230095 AGCTGGGAAGGGTAGGGGGAAGG + Intronic
1115703922 14:35978621-35978643 TGGAGGGAGGGGGAGGGGGAGGG + Intergenic
1115724489 14:36198463-36198485 TACTAGAAGGGGAAGGGGAATGG + Intergenic
1116078531 14:40143837-40143859 TGGGGCAGGGGGAAGGGGGAGGG + Intergenic
1116106345 14:40513230-40513252 TGCTGCTAGGGAAAGGGGTAGGG - Intergenic
1116196227 14:41729340-41729362 TGATGGAAGGTGAAGTGGGGAGG - Intronic
1116495471 14:45554761-45554783 TGGTGGAAGGTGAAGAGGAAGGG + Intergenic
1116583574 14:46674239-46674261 TGCTGCCAGGGGATGGGGGAGGG - Intergenic
1116604326 14:46969784-46969806 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1117043481 14:51789248-51789270 GGCTGGGAGGGGTAGGGGAAAGG - Intergenic
1117401107 14:55358962-55358984 TGCTGGGATGGGAAGGAGGGAGG + Intronic
1117648931 14:57882176-57882198 TTCTCCAGGGGGAAGGGGGATGG - Intronic
1118033371 14:61839878-61839900 TTGTGGAGGGGAAAGGGGGAGGG + Intergenic
1118405670 14:65421354-65421376 TGGTAGAGGTGGAAGGGGGAAGG + Intronic
1118836448 14:69481527-69481549 TGCTGCAAGGTGAAGGGGAAGGG + Intergenic
1118905382 14:70019614-70019636 AGCTGGGAGGGGAAGGGGCAAGG + Intronic
1118919337 14:70135739-70135761 GGCTGGTAAGGGAAGTGGGAAGG + Intronic
1119533032 14:75376483-75376505 TGGTGGAAGGTGAAGAGGGAGGG - Intergenic
1119862830 14:77948878-77948900 TAGGGGAAGGGGGAGGGGGAAGG - Intergenic
1119897863 14:78235655-78235677 TGCTGAAAGCGGAATGGAGATGG - Intergenic
1119991616 14:79204331-79204353 TGTTGGAAGAGGGAGGGTGAGGG - Intronic
1120676722 14:87429140-87429162 TGTTGTGGGGGGAAGGGGGAGGG + Intergenic
1121080403 14:91103335-91103357 GGCTAAAAGGAGAAGGGGGAAGG - Intronic
1121362838 14:93277782-93277804 TGCGGGATGTGCAAGGGGGAAGG + Intronic
1121420678 14:93811269-93811291 TGCTGGATGGGTAAGGGGGTGGG - Intergenic
1121505378 14:94473129-94473151 TGCTGGTGGGGGAAGGGGGAAGG - Intronic
1121572873 14:94960752-94960774 TTCTGGAAGGAAAAGTGGGAAGG - Intergenic
1121693220 14:95892637-95892659 TGCTGGAGGGGAAATGGAGATGG - Intergenic
1121774860 14:96583941-96583963 TGCTGAGAGGAGCAGGGGGAAGG + Intergenic
1121801249 14:96776019-96776041 TGCAGGAAGGGGAAAGGGTTTGG - Intergenic
1121922244 14:97892853-97892875 TGCAGAGAAGGGAAGGGGGAGGG + Intergenic
1121994165 14:98589021-98589043 TGGTGGAAGGTGAAGGGGAGTGG - Intergenic
1122300976 14:100730963-100730985 GGCTGGAGGGGGTGGGGGGAGGG - Intronic
1122415709 14:101548613-101548635 AGATAGAAGGGGAAGAGGGAAGG + Intergenic
1122489538 14:102104741-102104763 GGCTGGAAAGGGAAAGGAGAGGG - Intronic
1122600647 14:102920016-102920038 TGGTGGATGGTGAATGGGGATGG - Intergenic
1122924129 14:104892015-104892037 TGGAGGTAGGGGTAGGGGGAGGG + Intronic
1123032391 14:105458165-105458187 TGCTGGGACGGGGAGGGGGAAGG - Intronic
1123102059 14:105811019-105811041 TGGTGGAAGGTGAAGGTGAAGGG + Intergenic
1123950466 15:25267588-25267610 GGCTGGAGGGGGAAAAGGGAGGG + Intergenic
1124054978 15:26233959-26233981 TGCTGGTTTGGGAAGGTGGAAGG - Intergenic
1124062683 15:26308479-26308501 TGTTGAATGGGGAAGTGGGATGG + Intergenic
1124247748 15:28085260-28085282 AGCTGGGAGTGAAAGGGGGAAGG - Intronic
1124461865 15:29899498-29899520 TGGTGGCAGGGAAAGGGGCAGGG + Intronic
1124495463 15:30184043-30184065 GGCTGCAAGTGGTAGGGGGAAGG + Intergenic
1124748110 15:32354603-32354625 GGCTGCAAGTGGTAGGGGGAAGG - Intergenic
1124793695 15:32754477-32754499 TGGTGGAAGGTGAAGGGGAGAGG - Intergenic
1124824233 15:33077505-33077527 TGGAGTCAGGGGAAGGGGGAGGG - Intronic
1124849824 15:33325689-33325711 GGCAGAGAGGGGAAGGGGGAAGG - Intronic
1125198205 15:37072820-37072842 TGATGGTGGGGGAAGGGGGGAGG - Intronic
1125240707 15:37572230-37572252 TGTAGGAAGGTGAAGGAGGAAGG - Intergenic
1125376508 15:39035987-39036009 GGGTGGAAGGGGGAGGGGGGAGG - Intergenic
1125384310 15:39121134-39121156 TACTAGAGGTGGAAGGGGGAGGG + Intergenic
1125566211 15:40680378-40680400 TGCTGCCAGGGGATGGGGGAGGG + Intergenic
1125732018 15:41897900-41897922 TGCAGGAAGGGCAACGGTGATGG + Exonic
1126123733 15:45276330-45276352 TGGGGTGAGGGGAAGGGGGAGGG + Exonic
1126344234 15:47675937-47675959 TGATGGAATGGGGAGGGGGGAGG + Intronic
1126778449 15:52119071-52119093 TGGGGGAAGGGGAATGGGAAGGG + Exonic
1126883675 15:53126279-53126301 TGCTGGCAGGGGTTGGGGGCAGG + Intergenic
1127136900 15:55933535-55933557 GGGGGGAGGGGGAAGGGGGAGGG + Intronic
1127198342 15:56614930-56614952 TGGTGGAAGGGGAGGGTGGCAGG - Intergenic
1127228216 15:56958230-56958252 TGCAGGAAGGGGAAAGAAGATGG - Intronic
1127280912 15:57491856-57491878 TGCAGGAAGGAGGAGGAGGAGGG - Intronic
1127507635 15:59611027-59611049 TGAGGGGAGGGGGAGGGGGAGGG - Intronic
1127980764 15:64033264-64033286 AGGGGGAGGGGGAAGGGGGAAGG + Intronic
1128052228 15:64674576-64674598 TGCTTGAAGGAGAAGGGCTATGG - Exonic
1128109808 15:65069052-65069074 TGCGGGAAGGGGAAGGAGAAGGG - Intronic
1128301350 15:66567995-66568017 AGCAGGGAGGGGAAGGGGGGAGG + Intergenic
1128545131 15:68561450-68561472 AGCTGGAAGGGGAAGGCGCTGGG - Intergenic
1128586370 15:68853940-68853962 TGGTGTAAGGGGTTGGGGGAGGG + Intronic
1128736070 15:70054684-70054706 TTCTGGAGGGAGAAGGGGCAGGG + Exonic
1128930177 15:71697268-71697290 TGATGTAATGGAAAGGGGGATGG + Intronic
1129001775 15:72341498-72341520 TCCTGGAATGGGAAGGGGTGGGG + Exonic
1129035457 15:72646159-72646181 TGGGGGAAGGGGCTGGGGGAAGG - Intergenic
1129056562 15:72824444-72824466 GGCTGGAAGGGCATGGGGCAGGG + Intergenic
1129076098 15:72997327-72997349 TTCTGGAAGGAGAGAGGGGAAGG + Intergenic
1129095288 15:73200475-73200497 AGCAGGAAAGGGAAGGGGAAAGG + Intronic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129160541 15:73745250-73745272 TGCTGGAGAGGAAAGGGGGTGGG - Intronic
1129214427 15:74091057-74091079 TGGGGGAAGGGGCTGGGGGAAGG + Intergenic
1129237062 15:74230014-74230036 GGCTGGCTGGGGAAGAGGGATGG + Intergenic
1129288945 15:74548523-74548545 TGCTAGAAGGGGAAGGGTAGAGG - Intronic
1129446883 15:75625236-75625258 AGGGGGAAGGGGATGGGGGAGGG - Intronic
1129454385 15:75668932-75668954 TGCTGGAAGGGACAGGAGGAGGG + Intergenic
1129615731 15:77097719-77097741 TGCAGGAGAGGGAAGGGGAAGGG + Intergenic
1129620719 15:77142812-77142834 TGTTGTAAGGGGCTGGGGGAAGG + Intronic
1129700295 15:77763813-77763835 TGCTGCCTGGGGAAGTGGGAGGG - Intronic
1129731564 15:77935403-77935425 TGGTGGAAGGGGCAGGTGGGAGG + Intergenic
1130049145 15:80468591-80468613 TGCTAGAAGGGGTAGGGAGGAGG - Intronic
1130703003 15:86204505-86204527 GGAAGGAAGGGGAAGGGGAAGGG - Intronic
1130710739 15:86278623-86278645 TGGGGGAAAGGGAAGGGGAAGGG - Intronic
1131342220 15:91613108-91613130 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1131641577 15:94299035-94299057 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1131733000 15:95301763-95301785 GCTTGGAAGGGTAAGGGGGATGG + Intergenic
1131874834 15:96794026-96794048 TGCTAAAAGGGGAAGAGAGAGGG + Intergenic
1131947063 15:97635204-97635226 GGGTGGAAGGAGAAGGAGGAGGG - Intergenic
1131962739 15:97806869-97806891 GGCTGGAATGGAAAAGGGGAGGG - Intergenic
1132353420 15:101154621-101154643 TGCTGGGGGGCGAAGGGGAAGGG - Intergenic
1132802483 16:1761200-1761222 TGTGGGAAGGGGAAGGAGGCAGG - Intronic
1132840139 16:1974851-1974873 AGTTGGAAGGTGGAGGGGGAGGG + Intronic
1132861072 16:2072059-2072081 AGCTGCTCGGGGAAGGGGGAAGG - Intronic
1132868177 16:2104056-2104078 TGGTGGAGGGGGGAGGGGGAAGG + Intronic
1132895280 16:2226208-2226230 AGCTGGAACGAGAAGGGGCAAGG - Intronic
1133228399 16:4354491-4354513 GGCTGGAAAGGGAAGGGGACAGG - Intronic
1133330153 16:4967953-4967975 GGAAGGGAGGGGAAGGGGGAGGG - Intronic
1133360173 16:5167941-5167963 TGGGGGGAGGGGGAGGGGGAGGG + Intergenic
1133372083 16:5252829-5252851 TTCTGGAAGGGGGAGGTGGTGGG - Intergenic
1133474030 16:6102563-6102585 TGCTGGAAGGGGTGGGAGGGTGG - Intronic
1133897612 16:9944420-9944442 TGATGACAGAGGAAGGGGGAGGG - Intronic
1133924126 16:10180643-10180665 TGCGAGAAGGGGCTGGGGGATGG - Intronic
1133928957 16:10216653-10216675 TAGAAGAAGGGGAAGGGGGAGGG + Intergenic
1134104322 16:11475134-11475156 GGCTGGAGGGGAAAGAGGGAGGG - Intronic
1134433208 16:14231133-14231155 TGGGGTAAGGGGAGGGGGGAGGG + Intronic
1134449400 16:14354225-14354247 AGGAGGAAGGGGGAGGGGGAAGG + Intergenic
1134449404 16:14354232-14354254 AGGGGGAGGGGGAAGGGGGAAGG + Intergenic
1134479279 16:14603533-14603555 TGGTGGAGGAGGAAGGGGGAAGG - Intronic
1134523597 16:14929068-14929090 TGGTGGAGGGGGAGGGGGAAGGG - Intronic
1134549300 16:15131868-15131890 TGGTGGAGGGGGGAGGGGGAAGG + Intronic
1134711191 16:16327553-16327575 TGGTGGAGGGGGAGGGGGAAGGG - Intergenic
1134719043 16:16370855-16370877 TGGTGGAGGGGGAGGGGGAAGGG - Intergenic
1134770600 16:16806037-16806059 AGGGGGAAGGGGAAGGGAGAAGG - Intergenic
1134777383 16:16864981-16865003 GGGTGGCAGGGGAAGGGGTAGGG - Intergenic
1134948383 16:18341030-18341052 TGGTGGAGGGGGAGGGGGAAGGG + Intergenic
1134955638 16:18381140-18381162 TGGTGGAGGGGGAGGGGGAAGGG + Intergenic
1135145938 16:19962730-19962752 AGCTGGAAGGAGAAGGCAGAAGG + Intergenic
1135506169 16:23038367-23038389 TTCTGGAAGAGGAAGAAGGAAGG + Intergenic
1135530309 16:23247345-23247367 AGCTGGAAGAGGAAAGGGCATGG - Intergenic
1135543030 16:23346722-23346744 AGAGGGGAGGGGAAGGGGGAAGG - Intronic
1135669550 16:24363384-24363406 TGGGGGAATGGGAAGGTGGATGG + Intergenic
1135678537 16:24437801-24437823 TGGTGGAAGGGGAAGAGGAATGG - Intergenic
1135853374 16:25984563-25984585 GGATGGAAGGGCAAGGAGGAAGG - Intronic
1135917257 16:26616223-26616245 TGGTGGAAGGGTGAAGGGGAAGG + Intergenic
1135963432 16:27016469-27016491 TGCTAGAAGAAGAAGGGGAAGGG - Intergenic
1136244224 16:28964131-28964153 TGGTGAAAGGGGAGGGGTGAAGG - Exonic
1136254768 16:29030645-29030667 GGCTAAAAGGGCAAGGGGGAGGG - Intergenic
1136367412 16:29815135-29815157 GGCAGGAAGAGGAAGGGGGCGGG - Intronic
1136382191 16:29900864-29900886 TGCTGGAAGGAGAAAGAAGAGGG + Exonic
1137292334 16:47060458-47060480 TGCTGGGAGGCTAAGTGGGATGG + Intergenic
1137460912 16:48662489-48662511 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1137526266 16:49239063-49239085 TGATGGAAGGGAAAGGAGGAAGG + Intergenic
1137626242 16:49910565-49910587 TTCTGGTGGAGGAAGGGGGAGGG - Intergenic
1137677927 16:50313078-50313100 TGCTGGAGAGGGAAGGGCGGTGG + Intronic
1137844563 16:51674579-51674601 AGCTGGAAGAGGCAGGAGGAAGG - Intergenic
1138066420 16:53946066-53946088 TGGTGGAGGAGGATGGGGGAAGG + Intronic
1138300239 16:55920024-55920046 TGCTGGTGGGGGAAGGGTGGTGG - Intronic
1138535992 16:57660588-57660610 TACTGGAATGGGGAGGGGGAGGG + Intronic
1138672913 16:58629868-58629890 TGATGAAATGGGAACGGGGAGGG - Exonic
1138752511 16:59440788-59440810 GGGAGGGAGGGGAAGGGGGAGGG - Intergenic
1138891913 16:61154038-61154060 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1139062977 16:63277849-63277871 TGCTGGAAGTGGAAGTTAGAAGG + Intergenic
1139094568 16:63690112-63690134 TGATGGAAGAGGAAATGGGATGG - Intergenic
1139164377 16:64548734-64548756 TGTAGGAGGAGGAAGGGGGAGGG - Intergenic
1139511864 16:67432246-67432268 GGAGGGAAGGGGAAGGGGGGGGG + Intronic
1139692921 16:68652482-68652504 TGATGGAAGAGGAGGGAGGAAGG + Intronic
1139806012 16:69566049-69566071 TTCAGGACGGGGAAGGGGAAGGG - Exonic
1139940961 16:70605019-70605041 GGCTGGTGGGGGAAGGGAGAAGG + Intronic
1139949127 16:70660739-70660761 TGCAGGAAGTGGAGGGGGGCAGG + Intergenic
1140007432 16:71092272-71092294 TTGTGGAAGGGGAAAGGGCATGG - Intronic
1140076017 16:71699494-71699516 AGCTGGAAAGGGAATGGGAAGGG - Intronic
1140255654 16:73334084-73334106 TGCTGAAAGAGGAAGGAGAAAGG + Intergenic
1140874406 16:79137704-79137726 GGCAGGAAGGGGATGGAGGAGGG - Intronic
1141449965 16:84092566-84092588 TGCTGGACGGGGACAGGGGTGGG + Intronic
1141482763 16:84317948-84317970 TGCAGGAAGGAAAAGAGGGAGGG + Intronic
1141513817 16:84529634-84529656 GGCTGGAAGTGGAAGGGAGCTGG + Intronic
1141693917 16:85611314-85611336 GGCTGGGAGGGGGAGGGGGAGGG - Intergenic
1141765105 16:86052967-86052989 GGCTGGGAGGGGCAGAGGGAGGG + Intergenic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1142172142 16:88628458-88628480 TGCTGGAAGGGCAAGAGGCCTGG + Intronic
1142234735 16:88916647-88916669 GGCTGGGTGGGGAAGGGGGATGG + Intronic
1142251725 16:88994969-88994991 TTCTCCAAGGGGAAGGGGAAGGG - Intergenic
1142378941 16:89721184-89721206 TGCAGAAAGGGGAGGGGGGCCGG - Intronic
1142388820 16:89784707-89784729 TTGGGGAAGGGGAAGGGGAAGGG + Intronic
1142411135 16:89917848-89917870 GGGTGGAAGCGGGAGGGGGATGG - Intronic
1203141917 16_KI270728v1_random:1772303-1772325 GGCTGCAAGGGGGAGGAGGAGGG - Intergenic
1142600722 17:1052367-1052389 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600739 17:1052411-1052433 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600756 17:1052455-1052477 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600773 17:1052499-1052521 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600790 17:1052543-1052565 TGCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600808 17:1052587-1052609 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600826 17:1052631-1052653 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600844 17:1052675-1052697 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600860 17:1052719-1052741 TTCCGGAAGGGGCTGGGGGACGG + Intronic
1142600877 17:1052763-1052785 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600894 17:1052807-1052829 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600911 17:1052851-1052873 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600929 17:1052895-1052917 TTCAGGAAGGGGCTGGGGGAGGG + Intronic
1142600945 17:1052939-1052961 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600961 17:1052983-1053005 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600978 17:1053027-1053049 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142600995 17:1053071-1053093 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142601013 17:1053115-1053137 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142601031 17:1053159-1053181 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142601049 17:1053203-1053225 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142601066 17:1053247-1053269 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142601083 17:1053291-1053313 TTCCGGAAGGGGCTGGGGGAGGG + Intronic
1142672996 17:1496023-1496045 TGAGGGAAGGGGAAGGGTGAGGG - Intronic
1142672998 17:1496029-1496051 TGCTGGTGAGGGAAGGGGAAGGG - Intronic
1142759274 17:2033956-2033978 TTGTGGGAGGGAAAGGGGGAAGG - Intronic
1143005164 17:3827077-3827099 GGGGGAAAGGGGAAGGGGGAAGG + Intronic
1143020386 17:3914547-3914569 TGCTGGAAGAGGCTGGGGGAAGG - Intronic
1143171374 17:4932515-4932537 AGCTGCAGGGGGAAGGGGGCTGG + Intronic
1143183581 17:4998158-4998180 TGAGGGCTGGGGAAGGGGGAGGG + Intronic
1143390910 17:6558736-6558758 TGGTGGGAGGGGAAGGGGTCTGG - Intergenic
1143410663 17:6706571-6706593 GGCTGGAAGGGGGTGGAGGATGG - Intronic
1143500579 17:7336510-7336532 TGCTGGGAGGGGCAGGGGCGGGG - Exonic
1143524345 17:7463493-7463515 TGGTGGAGGGGGGAGTGGGACGG - Exonic
1143597988 17:7926993-7927015 TGCTAGATGGGGAAGAGGCAGGG + Intronic
1143651515 17:8266660-8266682 TGCAGGAAGGGCCAGGGTGAGGG - Intronic
1143727649 17:8860451-8860473 TACTGGGTGGGGAAGGGGGCTGG - Intronic
1144224369 17:13130706-13130728 TGTTTGATGGGGGAGGGGGAGGG + Intergenic
1144300508 17:13919329-13919351 AGTGAGAAGGGGAAGGGGGAAGG - Intergenic
1144343602 17:14331301-14331323 TCCTGGAAGGGGCTGGGGGTGGG - Intronic
1144425065 17:15133706-15133728 TGCTGGAAGGGTACGGGGCGGGG - Intergenic
1144817524 17:18046198-18046220 TGCTGGATGGGGCAGTGGAAAGG + Intronic
1144891426 17:18496445-18496467 TGCTGGAAGGAGGAGGGGAGGGG + Intergenic
1145002226 17:19313314-19313336 TGCTGGATGGGTGAGGGGCAGGG + Intronic
1145140795 17:20447872-20447894 TGCTGGAAGGAGGAGGGGAGGGG - Intergenic
1145287466 17:21516957-21516979 ACCTAGAAGGGGAAGGGGAAGGG + Intergenic
1145293228 17:21566703-21566725 TGCTGGAGGGGAAAGAGGAAGGG + Intronic
1145386739 17:22419234-22419256 TGCTGGAGGGGAAAGAGGAAGGG - Intergenic
1145739361 17:27259696-27259718 GGATGGGAGGGGAAGGAGGAAGG - Intergenic
1145768902 17:27478649-27478671 TGCAGGAAGGGCAAGGAGGTCGG - Intronic
1145809518 17:27756128-27756150 TGCTAGAAGGGGAAGGTGGCGGG + Intergenic
1145855851 17:28156564-28156586 TTGTGGGAGGGGGAGGGGGATGG + Intronic
1145908988 17:28531945-28531967 TTCTGGAAGGGAAAGAGGGAGGG + Intronic
1145937498 17:28723498-28723520 GACTGGAGGAGGAAGGGGGAGGG + Intronic
1146013646 17:29215368-29215390 TGCTGGCAGGGGCAGCTGGAAGG + Intergenic
1146034281 17:29391501-29391523 TAGAGGATGGGGAAGGGGGAAGG - Intronic
1146422242 17:32698360-32698382 GGAGGGAAGGGGGAGGGGGAGGG - Intronic
1146497697 17:33337654-33337676 TTCTGGAGGGGCAAGGAGGATGG + Intronic
1146497750 17:33338030-33338052 TTCTGGAAGGGCAAAGAGGATGG + Intronic
1146497777 17:33338196-33338218 TTCTGGAAGGGAAAGGAGGATGG + Intronic
1146497785 17:33338237-33338259 TTCTGGAAGGGCAAGGAGGCTGG + Intronic
1146575182 17:33984779-33984801 TGCTGAAAGGAGATGGAGGAAGG + Intronic
1146627117 17:34443295-34443317 TGCTAGAAGGTGGAGTGGGAGGG + Intergenic
1146634181 17:34491899-34491921 TCTGGGAAGGGGAATGGGGATGG - Intergenic
1146660320 17:34661307-34661329 GGCAGGAAGGGGAGAGGGGAGGG - Intergenic
1146930101 17:36770885-36770907 AGGTTGAAGGGGAAGGGGAAGGG - Intergenic
1147151869 17:38521208-38521230 TGCTGGGAGGCCAAGGTGGACGG + Intergenic
1147194944 17:38760258-38760280 AGCTGGCAGGAGAAGGGAGAGGG + Intronic
1147582629 17:41635829-41635851 TGCTGGGCGGGGATGGGGGGAGG + Intergenic
1147653090 17:42072936-42072958 TGCTGACAGGGGGTGGGGGAAGG - Intergenic
1147757666 17:42779625-42779647 TACTGGAATGGGGATGGGGAGGG + Intergenic
1147759872 17:42790604-42790626 TTCTGGAGTGGGAAGCGGGAGGG + Intronic
1147856488 17:43484224-43484246 TGAGGGAAGCGGAAGGAGGAAGG + Intronic
1147882243 17:43661395-43661417 TGGTGGAAGGAGAACGGGGTGGG + Exonic
1147970487 17:44217000-44217022 TGCTGTAAGGGGAAGAGGGGTGG + Intronic
1147975889 17:44247890-44247912 TGCTGGAAGTGGTTGGGGGTAGG + Intergenic
1148027727 17:44600140-44600162 GGCTGGGGGAGGAAGGGGGAGGG - Intergenic
1148149509 17:45388368-45388390 CGCGGGATGGGGAAGGGGGCTGG + Intergenic
1148578691 17:48728519-48728541 TGCTGGGAGCGGGAGGGGGGCGG - Exonic
1148674687 17:49438564-49438586 AGCTGGATGGGGGAGGGGGCCGG + Intronic
1148682503 17:49482817-49482839 TGCTTGAAGTGGGAGGGGGGAGG + Intergenic
1148783740 17:50135239-50135261 GGCTGGAAGGGGGAGGGGTGGGG + Exonic
1148830299 17:50426510-50426532 TGCTGGCGGGGGGCGGGGGAGGG - Intronic
1148891581 17:50811421-50811443 TGCTGGGTGGGTGAGGGGGAAGG - Intergenic
1149131940 17:53313296-53313318 TGTTGGAAAGGGAAGAGAGAAGG - Intergenic
1149168882 17:53785723-53785745 TGAAGGAAAGGGAAAGGGGAAGG + Intergenic
1149367264 17:55958328-55958350 TGATGGAAAGGGAAGGGAGCTGG + Intergenic
1149417001 17:56469934-56469956 TGTTGGTAGGGGCAAGGGGAGGG - Intronic
1149518459 17:57299514-57299536 TGCGGGAAGGGGAAGGGACGTGG + Intronic
1149718289 17:58816553-58816575 GGATGGCAGGGGATGGGGGAAGG - Intronic
1150053438 17:61988947-61988969 TGGGGGTAGGGGAATGGGGATGG - Intronic
1150207571 17:63420572-63420594 TCCGGAGAGGGGAAGGGGGAGGG - Exonic
1150441114 17:65192272-65192294 GACTGGGAAGGGAAGGGGGAAGG + Intronic
1150539730 17:66084659-66084681 GGCTGGAAAGGGTAGTGGGAAGG + Intronic
1150693615 17:67385478-67385500 TGGGGGGAGGGGAGGGGGGAGGG - Intronic
1150808473 17:68337502-68337524 TCCTGGAAGGCGAAGGAGGAAGG + Intronic
1150973094 17:70052997-70053019 TTCTGGCAGAGGAAGGGGAAAGG - Intergenic
1151407850 17:73901068-73901090 TGCTGGATGGTGAGAGGGGAAGG - Intergenic
1151418097 17:73979867-73979889 AGCTAGATGGGGAAGGAGGAGGG - Intergenic
1151476149 17:74345249-74345271 GGTGGGAAGGGGAAGGAGGATGG + Intronic
1151629887 17:75303255-75303277 TGGTGGAAGGTGATGGGGAAGGG + Intergenic
1151747908 17:76021617-76021639 TGGTGGGCGGGGAAGGGGGGAGG - Intronic
1151890431 17:76948043-76948065 TTCAGGAAGGGGAAGAAGGAGGG - Exonic
1151993966 17:77596960-77596982 TGATGGAAGAGGAAAAGGGAGGG + Intergenic
1152017766 17:77762972-77762994 TGCCGGGAGGGGATGGGGGCAGG + Intergenic
1152208061 17:78986779-78986801 GGCTGGAGGGGGAAGTGGGAGGG + Intergenic
1152223659 17:79082781-79082803 TGCTGCAAGGGCAGGGGGGCAGG - Intronic
1152571999 17:81125016-81125038 TGCAGGCAGGGGCAGGGGCAGGG + Intronic
1152609221 17:81307449-81307471 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1152609255 17:81307532-81307554 AAGGGGAAGGGGAAGGGGGACGG - Intergenic
1152740928 17:82018043-82018065 TGCAGGGAGGGGAAAGGGTAGGG - Intergenic
1152748572 17:82052179-82052201 TGCTGGGAGGGGAGGCGGGGCGG - Exonic
1152766759 17:82145643-82145665 TTCTGGAAGGCGCAGAGGGAGGG + Intronic
1152814656 17:82400203-82400225 AGCTGGGAGGGGCAGGGGGGAGG - Intronic
1203163428 17_GL000205v2_random:72562-72584 TGTGGGATGGGGGAGGGGGAAGG - Intergenic
1153706330 18:7749198-7749220 TGCTGAAAGGGAATGGAGGAGGG + Intronic
1153708475 18:7772432-7772454 GGAAGGAAGGGGAAGGGGAAGGG - Intronic
1153782332 18:8505446-8505468 TGCTGGGAGGGGGTGGGAGAGGG + Intergenic
1153852122 18:9104702-9104724 GGGTGGAAGGGGGAGGGAGAAGG - Intronic
1153871019 18:9320242-9320264 GGCTGGAGCTGGAAGGGGGAGGG - Intergenic
1154121383 18:11655186-11655208 AGCTGGAAGCCAAAGGGGGAGGG - Intergenic
1154208468 18:12358215-12358237 TGCTGGAAAGGGGAAGGTGATGG + Intronic
1154412077 18:14146986-14147008 CGCTGCAAGAGCAAGGGGGATGG + Intergenic
1154966763 18:21366289-21366311 TGGGGTAAGGGGATGGGGGAGGG - Intronic
1155087039 18:22468713-22468735 TGCTGCCAGGGGATGGGGGCAGG + Intergenic
1155256053 18:23999280-23999302 AGCTGGAAGGGTGAGGGGAAGGG + Intronic
1155322366 18:24631986-24632008 TCCTGCAACGGGGAGGGGGAGGG + Intergenic
1156021687 18:32606581-32606603 TGCTGCTAGGGGGATGGGGAGGG + Intergenic
1156564771 18:38175279-38175301 TGCTGGAAAGGAATGGAGGAAGG - Intergenic
1156651673 18:39233529-39233551 AGCTGGAAAGGGAATGGGAAGGG + Intergenic
1156814785 18:41296718-41296740 TGCTAGGAGGGGAATGGTGATGG - Intergenic
1156886575 18:42141856-42141878 TGGTGGCAGGGGAGGGGAGATGG + Intergenic
1157298732 18:46464556-46464578 TGCTGCAATGGGAAAGGGGCGGG - Intergenic
1157470281 18:47983160-47983182 AGGAGGAAGGGGAAAGGGGAAGG - Intergenic
1157490985 18:48123567-48123589 TCCTGCAAGAGGCAGGGGGAGGG - Intronic
1157605839 18:48925444-48925466 TGCTTTAAGGGAAATGGGGAAGG - Intronic
1157670963 18:49528289-49528311 AGCTGGAGGGGGAAAAGGGAGGG - Intergenic
1157712995 18:49862896-49862918 TGCTGGCTGGGGAGGGGGGTGGG - Intronic
1157866459 18:51190417-51190439 TGATTGAAGGGGAAGTGGGGAGG - Intronic
1157899242 18:51498098-51498120 TTCTCCAAGGGGAAGGGAGAAGG + Intergenic
1158178384 18:54683802-54683824 TGGTGGAAGGGGAACGTGAAGGG + Intergenic
1158393448 18:57061986-57062008 TGCAGGAAAGGGAAAGGTGAAGG + Intergenic
1158801463 18:60915346-60915368 GGCTGGAGGGGAAAGAGGGAGGG - Intergenic
1158915331 18:62120203-62120225 TGGGGGAAGGGGAAGGGGAAGGG + Intronic
1159002581 18:62987367-62987389 TGCTGGATGGGAACGAGGGATGG - Intergenic
1159179957 18:64890059-64890081 TTAAGGAAGGGGAAGGAGGAGGG + Intergenic
1159311994 18:66720945-66720967 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1159409698 18:68055226-68055248 TGCTGGAGGGGGAAGGAGGAAGG - Intergenic
1159983261 18:74811874-74811896 TGGGGTAAGGGGAAGGGGGAGGG + Intronic
1159984948 18:74830917-74830939 GGCTGGGAAGGGTAGGGGGAAGG - Intronic
1160025916 18:75215998-75216020 GGTTGGAAGGGGAGGGGGGCTGG + Intronic
1160141931 18:76332124-76332146 GAAAGGAAGGGGAAGGGGGAGGG + Intergenic
1160347018 18:78140343-78140365 TGCAGGGAGGTGAATGGGGAAGG - Intergenic
1160545057 18:79647413-79647435 GGGAGGAAGGGGAGGGGGGAGGG + Intergenic
1160589293 18:79933724-79933746 GGCGGGAAGGGGAAGCAGGAGGG - Intronic
1160659526 19:291573-291595 GGCGGGGAGGGGAGGGGGGAGGG + Intergenic
1160788923 19:913764-913786 GGCTGGGAGGGGCAGGTGGAAGG - Intergenic
1160881669 19:1323563-1323585 TGCAGGAGGTGGAGGGGGGATGG + Intergenic
1161403783 19:4080890-4080912 GGTGGGGAGGGGAAGGGGGAGGG + Intergenic
1161817706 19:6509896-6509918 TGCTGGAAGGGGTGGGGAGGGGG + Intergenic
1161821620 19:6533742-6533764 AGGGGGAGGGGGAAGGGGGAAGG - Intronic
1161848858 19:6728414-6728436 GGCTGGAGGGGGCAGGAGGAGGG - Intronic
1161857479 19:6773850-6773872 TGCTGGGTGGGAACGGGGGACGG + Intronic
1162105489 19:8367288-8367310 TTCTGGAGGGTGACGGGGGAAGG + Intronic
1162514253 19:11138692-11138714 TGCTGGAAGGGGAACGGCCTGGG - Intronic
1162552272 19:11364470-11364492 CGCTGGCAGGGGTAGGGGCAGGG - Exonic
1162638960 19:11992279-11992301 TGCTGGATAGGTAAGAGGGAGGG - Intergenic
1162713403 19:12612929-12612951 TGCTGTTAGGGGAAGAGGGGAGG + Intronic
1162713550 19:12613852-12613874 TGCTGTTAGGGGAAGAGGGGAGG + Intronic
1162873701 19:13604791-13604813 AGGAGGAAGGGGAAGGGGAAGGG + Intronic
1163067518 19:14809879-14809901 TGCAGGCAGGGCAAGGGGGTGGG + Intronic
1163085388 19:14975890-14975912 GGAAGGAAAGGGAAGGGGGAAGG + Intronic
1163117659 19:15197967-15197989 TAATAGAAGGGGAAGGGGCAGGG + Intronic
1163167612 19:15508663-15508685 TGCTGGCGGGGCAAGGGCGAAGG + Intronic
1163227327 19:15973495-15973517 TGTTGGGAGGGTCAGGGGGAGGG - Intergenic
1163273294 19:16266984-16267006 TGCTGGAAGGGAGCGAGGGAGGG + Intergenic
1163327591 19:16615069-16615091 TGCTTCAAGGGGAATGGGGGTGG + Intronic
1163362386 19:16855367-16855389 TGCTGGGGGGGGGGGGGGGAAGG - Intronic
1163363917 19:16865671-16865693 AGGGGGAAGGGGAAGGGGAAGGG - Intronic
1163386317 19:17002207-17002229 TGATGGTTGGGGAAGGGGAAGGG + Intronic
1163445255 19:17342099-17342121 TAGGGGAAGGGGAAGGGGAAGGG - Intronic
1163628678 19:18405244-18405266 AGGTGGCTGGGGAAGGGGGAGGG - Intergenic
1163662593 19:18587726-18587748 TGCTGGAAGGGGACCCGGAAGGG - Intronic
1163728278 19:18934749-18934771 TGGTGGAGGGGTAAGGTGGAAGG - Intronic
1163845746 19:19637386-19637408 TCCTGGAAGGAGAAGGCGGGCGG + Exonic
1164405240 19:27938369-27938391 TTCTGGGAGAGGCAGGGGGATGG + Intergenic
1164529541 19:29037879-29037901 TGTGTGTAGGGGAAGGGGGAGGG - Intergenic
1164956678 19:32392388-32392410 GGAAGGAAGGGAAAGGGGGAGGG + Intergenic
1165176538 19:33934489-33934511 GGCTGGAAAGGGAAGAGGGGAGG + Intergenic
1165475218 19:36026492-36026514 GGCTGCGAGGGGAAGGAGGACGG - Intronic
1165477861 19:36042074-36042096 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
1165768940 19:38367377-38367399 TGCGGGGAGAGGAATGGGGAGGG - Intronic
1165879257 19:39031449-39031471 TGGTGGGAGGGGAAGGGGGCGGG - Intronic
1166085638 19:40472819-40472841 AGGAGGAGGGGGAAGGGGGAAGG + Intronic
1166182103 19:41116384-41116406 TGGTGGAAGGATAAGGAGGAGGG + Intronic
1166351250 19:42199459-42199481 TGATGGAGGAGGAAGGGGGGCGG - Exonic
1166560217 19:43727818-43727840 TGCTGGAAGACGAAGGGGAAGGG - Intergenic
1167019041 19:46860970-46860992 GGCGGGGAGGGGAAGGGGGGAGG - Intergenic
1167055952 19:47111977-47111999 TCGGGGAAGGGGATGGGGGAGGG - Intronic
1167106757 19:47434747-47434769 TGCTGGAGGGGTGAGGGAGAAGG - Intronic
1167140105 19:47644470-47644492 TAGGGGAAGGGGAAGGGGTAGGG - Intronic
1167198534 19:48047736-48047758 AGATGGAAAGGAAAGGGGGAAGG + Intergenic
1167440683 19:49507036-49507058 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1167455766 19:49596175-49596197 GGCTACAAGGGCAAGGGGGATGG + Exonic
1167671719 19:50857348-50857370 AGGAGGAAGGAGAAGGGGGAAGG + Intronic
1167830317 19:52014709-52014731 TCCTGGAAGGGGAGGGGTGCTGG - Exonic
1168059778 19:53884335-53884357 GGCTGGGAGGGGAGGGGGGCTGG + Intronic
1168252782 19:55149788-55149810 TGTGGGGAGGGGGAGGGGGAGGG + Intergenic
1168290098 19:55353392-55353414 TGCTGGAATGGAGAGGGAGAAGG + Exonic
1168373526 19:55856388-55856410 CACTGGAAGGGGAAGGGGAGTGG - Intronic
1168434416 19:56305964-56305986 TGGGGGCAGGAGAAGGGGGAGGG + Intronic
1168464965 19:56594930-56594952 GGATGGAAGGGGAGGAGGGATGG - Intergenic
1168649944 19:58086445-58086467 GGCTGGAAGGGCAACGGGGCAGG + Intronic
924995781 2:359216-359238 AGCTAGCAGGGGAAGTGGGAAGG - Intergenic
925186497 2:1850170-1850192 GGAAGGAAGGGGGAGGGGGAGGG - Intronic
925301319 2:2815016-2815038 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
925418466 2:3690415-3690437 GGGGGGGAGGGGAAGGGGGAGGG - Intronic
925755363 2:7128037-7128059 GGGAGGAAGGGGAGGGGGGAGGG - Intergenic
925947641 2:8880411-8880433 TGCGGGAGGAGGAAGGAGGAGGG + Intronic
926023104 2:9514363-9514385 GGGGGGAGGGGGAAGGGGGAAGG + Intronic
926124508 2:10263916-10263938 GGGGGGAGGGGGAAGGGGGAAGG + Intergenic
926160342 2:10483514-10483536 TGCTGTATGTGGAAGTGGGAAGG - Intergenic
926240467 2:11081136-11081158 GGAGGGAGGGGGAAGGGGGAGGG - Intergenic
926401479 2:12501599-12501621 GGCAGGAAGGGGAAGGGTGGAGG - Intergenic
926420151 2:12687819-12687841 GGCTGGAGGGGAAAGAGGGAGGG + Intergenic
926530097 2:14033476-14033498 ACCAGGAAAGGGAAGGGGGAGGG + Intergenic
926638026 2:15204859-15204881 TGCAGTTGGGGGAAGGGGGAGGG + Intronic
927000634 2:18791045-18791067 GGAGGGAAGGGGAAGGGGAAAGG - Intergenic
927060718 2:19416832-19416854 TCCTGGGAGGGGCTGGGGGAAGG + Intergenic
927200629 2:20575928-20575950 TGGGGGAAGGGGACTGGGGAGGG + Intronic
927305211 2:21563380-21563402 GTCTGGGAGGGGTAGGGGGAAGG + Intergenic
927488379 2:23504627-23504649 AGCTGGAACTGGAAGGGGGTAGG + Intronic
927513031 2:23656380-23656402 TGAGGGAAGGCGAAGGGGAAGGG + Intronic
927557428 2:24045649-24045671 GGAAGGAAGGGGGAGGGGGAGGG + Intronic
927709331 2:25315128-25315150 AACTGGAAGGGGAAGGGTGTGGG - Intronic
927843030 2:26457326-26457348 GGCTGGAAGGGCAAGGGGGCAGG + Exonic
927861857 2:26565070-26565092 TAGGGGAAGGGGAAGGGGAAGGG - Intronic
928072150 2:28227706-28227728 GGCTGGAATGGGAAGGGGTGTGG - Intronic
928666520 2:33555355-33555377 AGCTGGAAGGGGCCGGGAGAGGG + Intronic
929088734 2:38194070-38194092 TGCTGGAAGGGGAAGTGATGGGG - Intergenic
929748812 2:44688708-44688730 TTCTGTGTGGGGAAGGGGGAAGG - Intronic
929773272 2:44911072-44911094 TGGTGGAAGGGCAAAGGGGAAGG + Intergenic
929809150 2:45174198-45174220 GGATGCAAGGGGAAGGTGGAGGG + Intergenic
929857671 2:45650601-45650623 TGGGGGAGGGGGAAGGGGGAGGG - Intergenic
930041661 2:47129644-47129666 TGCTGCCAGGGGATGGGGGAGGG + Intronic
930126487 2:47801810-47801832 TTTTGGTGGGGGAAGGGGGAAGG + Intronic
930964386 2:57303547-57303569 TGCTGGGAAGGGGAAGGGGAAGG + Intergenic
931235203 2:60406949-60406971 TGCTGGGAGAGGAAGGGGAGAGG - Intergenic
931401364 2:61934255-61934277 TCCTGGAAGGGCCATGGGGATGG + Intronic
931407024 2:61988999-61989021 TGCTGCTAGCGGATGGGGGAAGG + Intronic
931668621 2:64627428-64627450 GGCTGGAGGCGGAAGGGGGAGGG - Intergenic
931822184 2:65963206-65963228 TGCGGTGAGGGGAGGGGGGAGGG - Intergenic
932078925 2:68693398-68693420 TGCTGGTATGGGAAGGGAGGTGG + Intronic
932291758 2:70586786-70586808 GTCTGGAAGGGTAAGGGGGAAGG - Intergenic
932583033 2:73004954-73004976 TTCTGGAAAGGGCAGCGGGAGGG - Intronic
932605186 2:73160574-73160596 GGATGGAAGGGTAGGGGGGATGG + Intergenic
932627114 2:73306392-73306414 TTCTGGAAGAGCAAGTGGGATGG + Intergenic
932671254 2:73739723-73739745 TGCAGGAAGTGTAAGGGGCAGGG - Intergenic
932819369 2:74886538-74886560 TGGTGGAAGGAGAAGAGGGGCGG + Exonic
933513481 2:83270950-83270972 AGCTGGAAGGGGAAGAGGGAGGG - Intergenic
933596567 2:84288899-84288921 TGCTGGAAGGGAACATGGGAAGG + Intergenic
933823792 2:86139833-86139855 TCATGGAATGGGAAGGGGAAGGG + Exonic
933943042 2:87260942-87260964 TGAAGGAAGGGGAGGGGTGAAGG + Intergenic
935210677 2:100937365-100937387 TGATGGCAGGGGTAGGGAGATGG + Intronic
935234380 2:101126116-101126138 TGGTGGAAGGTGAAGGGAGCTGG + Intronic
935308386 2:101759615-101759637 GGAGGGAAGGGGAATGGGGAAGG - Intronic
935308396 2:101759637-101759659 GGATGGGAGGGGAATGGGGAGGG - Intronic
935644112 2:105318885-105318907 CCCTGGAAGTGGAAGGGAGAGGG - Intronic
935799581 2:106680756-106680778 TGGTGTGGGGGGAAGGGGGAGGG - Intergenic
935892747 2:107697146-107697168 TGATGGGAGGGGAAGGGAGTGGG + Intergenic
935958306 2:108400122-108400144 AGCTGGAAGGGGAGGGGGTAAGG - Intergenic
935986168 2:108675316-108675338 TGGGGGAAGAGGAGGGGGGAAGG + Intronic
936138609 2:109918931-109918953 TGGGGGAAGAGGAGGGGGGAAGG + Intergenic
936174030 2:110203249-110203271 TGCTGGAGTGGGGTGGGGGAGGG + Intronic
936206087 2:110452554-110452576 TGGGGGAAGAGGAGGGGGGAAGG - Intronic
936263368 2:110980734-110980756 GGCAGGAAGGGGCAGGGGCAGGG - Intronic
936337171 2:111600620-111600642 TGAAGGAAGGGGAGGGGTGAAGG - Intergenic
936400326 2:112159931-112159953 AGATGGAAGGTGATGGGGGAAGG - Intronic
936511421 2:113150475-113150497 TGCTGCTGGGGGATGGGGGAGGG + Intergenic
936749841 2:115628956-115628978 TGGGGTAGGGGGAAGGGGGAAGG - Intronic
936971126 2:118177281-118177303 TGGTGGAACGGGAGTGGGGAAGG - Intergenic
937181255 2:119997766-119997788 TGCTGGCTGGGGGAGGGGGGCGG - Intergenic
937207565 2:120246276-120246298 GGCTGGAGGAGGAAGGGGGATGG + Intronic
937250638 2:120521688-120521710 AGCTGCAAGGGGCAGGTGGAGGG - Intergenic
937542407 2:122974219-122974241 TTGTGGGAGGGGGAGGGGGAAGG - Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937614439 2:123905022-123905044 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
937903780 2:127041804-127041826 TGCTGGAGGGAGAAGGGCAAAGG - Intergenic
937917048 2:127104427-127104449 GGCTGGAAGTGGATGTGGGAAGG + Intronic
937921576 2:127135288-127135310 GGATGGAACGGGAAGGTGGAGGG + Intergenic
938144035 2:128819452-128819474 TGCTGGAAGCAGTAGAGGGAAGG - Intergenic
938307594 2:130265873-130265895 TGCTGGGTGGGGAAGGGTGGGGG - Intergenic
938390276 2:130899462-130899484 AGCAGGACTGGGAAGGGGGATGG + Intronic
938447738 2:131390969-131390991 TGCTGGGTGGGGAAGGGTGGGGG + Intergenic
938576704 2:132610887-132610909 TGCTGGAAGGGAAAAGGGCATGG + Intronic
938647977 2:133350896-133350918 AGCTGACAGGTGAAGGGGGAAGG - Intronic
938657338 2:133447619-133447641 AGGGGGAAGGGGAAGGGGAAAGG - Intronic
938736530 2:134191448-134191470 TGGTGGGGGGGGTAGGGGGAGGG - Intronic
938836041 2:135105212-135105234 AGCGGGAGGGGGAAGGGGGAGGG - Intronic
938949949 2:136246219-136246241 TGCTGGTGGGGGGTGGGGGAGGG + Intergenic
938957675 2:136314504-136314526 GGAAGGAAGGGGAAGGGGAAGGG - Intergenic
939254355 2:139723261-139723283 GGCTAGAAGGGAAAGAGGGAGGG - Intergenic
939708040 2:145479242-145479264 TGCTGCCAGGGGATAGGGGAGGG + Intergenic
939712455 2:145540115-145540137 TGGTGTGGGGGGAAGGGGGAGGG - Intergenic
939766126 2:146252154-146252176 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
939835990 2:147130595-147130617 TGTTGGAAGGTGAAGGAAGAAGG - Intergenic
939901870 2:147860269-147860291 AGCTGAAAGGGGAATGAGGAGGG + Intronic
940080025 2:149790767-149790789 TGCAGTGAGGGGAAGGGGGAGGG - Intergenic
940274181 2:151921873-151921895 TGGCGGAAGGCGAAGGGGAAGGG - Intronic
940372944 2:152922913-152922935 GGCAGGGAGGGGAAGGGGAAGGG - Intergenic
940503934 2:154528274-154528296 AGCTGCAAGGGGATGGGGGAGGG + Intergenic
940598342 2:155823265-155823287 TGGTGGGAGGGGGTGGGGGATGG + Intergenic
940653085 2:156456771-156456793 TGCTGGAAAGGGGAGGGTGAAGG + Intronic
940963099 2:159807543-159807565 TGGTGGAAGAGGAAGGGTGCAGG + Intronic
941038211 2:160590557-160590579 AGGGGGAAGAGGAAGGGGGAGGG - Intergenic
941078481 2:161033106-161033128 AACGGGAAGGGGAAGGGGAAGGG + Intergenic
941179466 2:162240806-162240828 GGCAGGAAAGGGAAGGAGGAAGG - Intronic
941218825 2:162748865-162748887 GGGAGGGAGGGGAAGGGGGAGGG - Intronic
941886137 2:170529574-170529596 TGCAGGAAGGGGATGAGGGATGG - Intronic
942430659 2:175907602-175907624 TGGTTGAAGAGGAAGGGGGTTGG + Intergenic
942814431 2:180034736-180034758 TGCTATCAGGGGATGGGGGAGGG + Intergenic
942913734 2:181277543-181277565 TTCTCGAAGGAGAAGTGGGATGG + Intergenic
943444336 2:187965375-187965397 GGCTGAAAAGGGTAGGGGGAAGG + Intergenic
943623055 2:190170578-190170600 TCCTGGTTGGGGATGGGGGATGG - Intronic
943710381 2:191087509-191087531 TCCTGGATGGGGTAGTGGGATGG - Intronic
943725376 2:191246240-191246262 AGAGGGAAGGGGAAGGGGGCGGG + Intronic
943820974 2:192320429-192320451 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
943920726 2:193705043-193705065 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
943928781 2:193822183-193822205 TGTTGGGGGGGGAGGGGGGAGGG + Intergenic
944047915 2:195434628-195434650 GGGCGGAAGGGGAAGGGGAAGGG - Intergenic
944264749 2:197711028-197711050 TCCTGCAAGAGGAAGGGGCAGGG - Intronic
944654635 2:201865353-201865375 TGGTGGATGGAGAAGGTGGAGGG - Intronic
944848441 2:203692272-203692294 GGTGGGAAGGGGTAGGGGGAAGG + Intergenic
944866405 2:203866678-203866700 TGCAGGAAGGGGGAATGGGAGGG + Intergenic
944903508 2:204239795-204239817 ATCTGGGAGGGGAAGGGGTAGGG - Intergenic
945273196 2:207962209-207962231 TCCAGGAAGGGGAAGGAGGCTGG + Intronic
945348279 2:208746631-208746653 TGTGGGGGGGGGAAGGGGGAGGG - Intronic
945915054 2:215694810-215694832 GGATGGGAGGGGAAGAGGGAGGG + Intergenic
946010496 2:216560149-216560171 AGAAGGAAGGGGAAGGGGAATGG - Intronic
946142918 2:217706654-217706676 AGGAGGAAGGGGAAGGGGAAGGG + Intronic
946171789 2:217899975-217899997 GGCTGGCAGGGGCCGGGGGAAGG - Intronic
946320653 2:218952313-218952335 TGGTGGAAGGTGGAGGGGGGCGG + Intergenic
946366962 2:219254312-219254334 GGCTGGAAGGGCAGGGGTGAAGG - Intronic
947166646 2:227268690-227268712 TGAGGGAAGGGGCAGGGGGGAGG + Intronic
947242829 2:228015061-228015083 TGGGGGAGGGGGGAGGGGGAGGG - Intronic
947293684 2:228606481-228606503 TGGTGTAGGGGGAGGGGGGAGGG - Intergenic
947542111 2:230986580-230986602 TGATGCAGGGGGAAGGGGGCAGG - Intergenic
948031718 2:234823201-234823223 TGCTGGGATGGGAATGGTGATGG + Intergenic
948111527 2:235460120-235460142 TGCTGTGAGAGGAAGGGGCAGGG - Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948384452 2:237572927-237572949 CCCTGGCAGGGGATGGGGGAGGG - Intergenic
948432336 2:237927697-237927719 GGCTGGAAGAGGAAAGGGGCGGG + Intergenic
948550072 2:238765333-238765355 ATCAGGAAGGGCAAGGGGGAGGG - Intergenic
948875406 2:240824303-240824325 TGCAGCCAGGGCAAGGGGGACGG - Intergenic
948907456 2:240986622-240986644 GGCTGGATGGCGCAGGGGGAGGG + Intronic
948944226 2:241211307-241211329 CGATGGGAGAGGAAGGGGGAGGG - Intronic
1168815263 20:732441-732463 TGATAGATGAGGAAGGGGGAAGG - Intergenic
1168840760 20:908588-908610 TGCTCCAGGGGCAAGGGGGAAGG + Intronic
1168979387 20:1991880-1991902 TGCTGGGATGGGGAGGGGAAAGG + Intronic
1169083815 20:2815030-2815052 TGCTGGGTGGGTATGGGGGAGGG + Exonic
1169178616 20:3542542-3542564 AGGTGGAAGGGGGAAGGGGAAGG - Intronic
1169178635 20:3542586-3542608 AGGGGGAAGGGGAAGGGAGAAGG - Intronic
1169241022 20:3980964-3980986 TGTTGGGGGGGGCAGGGGGAGGG + Intronic
1169258441 20:4117551-4117573 TGGCAGAAGGGGAAGGGGGAGGG + Intergenic
1169680619 20:8208393-8208415 TGATGGAAGGGGAAGGGAGGAGG + Intronic
1169755950 20:9043397-9043419 GGCTGGAAGGGAAAGAGGGAAGG + Intergenic
1169758902 20:9069392-9069414 TGACTGCAGGGGAAGGGGGATGG - Intronic
1169804942 20:9549865-9549887 AGCTGGAGGGGAAAGAGGGAGGG - Intronic
1169855588 20:10098822-10098844 GGCTGGTAAGGGAAGGGGGAAGG + Intergenic
1170134823 20:13061383-13061405 TGGTGGAGGGGGCAGGTGGATGG - Intronic
1170578751 20:17682458-17682480 TGCGGGGAGGTGAAGGGGGCAGG + Intergenic
1170607795 20:17886766-17886788 TGCTGGCAGGGGACTGGGGATGG - Intergenic
1171221004 20:23397952-23397974 TGCTGGAAAAGAAAGAGGGAAGG + Intronic
1171357990 20:24565428-24565450 TGCTGGGACAGGATGGGGGACGG + Intronic
1171394761 20:24824801-24824823 TGGTGGAAGTGGAAGTCGGAGGG - Intergenic
1171779957 20:29409709-29409731 CTCTGGAAGGGAAAGAGGGAGGG - Intergenic
1171954953 20:31454599-31454621 TCCTGGATGGGGATGTGGGAGGG + Intergenic
1171969971 20:31558292-31558314 GGCTGGAGGGGGGAGGAGGAGGG - Intronic
1172221503 20:33277407-33277429 CGCTTGAAGGGGAAGGGAGTGGG - Intronic
1172224410 20:33295824-33295846 GGAAGGAAGGGGAAGGGGAAGGG + Intronic
1172265080 20:33604818-33604840 TTCTGGAAGGGTAGGGGAGAAGG - Intronic
1172468715 20:35175512-35175534 TGATGGTGGGGGAAGGGGGACGG - Intronic
1172798967 20:37563298-37563320 GGCTGGGAGGGGAAGGGAGTTGG + Intergenic
1172977821 20:38919846-38919868 TGATGGAGGTGGAAGGGGGTGGG - Exonic
1173053023 20:39583674-39583696 AGAGGAAAGGGGAAGGGGGAAGG + Intergenic
1173143175 20:40502616-40502638 TGCTGGGTGAGGAAGGAGGAGGG - Intergenic
1173294280 20:41742199-41742221 GGAAGGAAGGGGAAGGAGGAAGG - Intergenic
1173310865 20:41894963-41894985 CGGTGGATGGGGAAGAGGGATGG + Intergenic
1173375228 20:42476985-42477007 TGGTGGAAGGAGAAGGGGGAAGG - Intronic
1173375422 20:42478203-42478225 GGGTGAAAGGAGAAGGGGGAAGG + Intronic
1173426420 20:42947350-42947372 TGCTGCCAGGGGCTGGGGGAAGG - Intronic
1173471077 20:43324119-43324141 TGGGGGGTGGGGAAGGGGGAGGG - Intergenic
1173648614 20:44649337-44649359 AGCTGGCAGGAGAAGTGGGAAGG - Intronic
1173869592 20:46332942-46332964 TGCTGGAAGAGGGGAGGGGAGGG + Intergenic
1174012863 20:47464673-47464695 TGGTGGCAGGGGAAGGAGAATGG - Intergenic
1174296692 20:49550361-49550383 GGCTGGAGGGGAAAGAGGGAGGG - Intronic
1174485017 20:50855573-50855595 GACTGGAAGGGGAAGGGGAAGGG + Intronic
1174573998 20:51524109-51524131 TTCTGGAAAGAGAAGGGGGAAGG + Exonic
1175132569 20:56800686-56800708 TGATGGAAGAAGAAGGGGAAGGG - Intergenic
1175320519 20:58084669-58084691 GGGTGGGAGGGGAAGGAGGAAGG - Intergenic
1175349944 20:58310210-58310232 TCCAGGGAGGGGAAGGGGAAGGG - Intronic
1175386375 20:58597968-58597990 TGCAGGAAGGGGATCGGGGAGGG + Intergenic
1175438276 20:58971147-58971169 GGCTGGAAGGGGAGCAGGGAGGG + Intergenic
1175565014 20:59967755-59967777 GGAGGGAAGGGGAAGGGGAAGGG - Intronic
1175639813 20:60619572-60619594 TGTTGGAAGGGCATGTGGGAGGG + Intergenic
1175724397 20:61307799-61307821 TGCTGGCATGGGAAGGTGTAAGG + Intronic
1175831551 20:61967580-61967602 GGAAGGGAGGGGAAGGGGGAAGG - Intronic
1175843055 20:62042613-62042635 TGCTGGAAGGGGAGCGTGCAGGG - Intronic
1175904995 20:62375307-62375329 TGCCAGGAGGGGGAGGGGGAGGG + Intergenic
1175997143 20:62816971-62816993 GGCGGGAAGGGGAAGGGGAAGGG + Intronic
1176350359 21:5789478-5789500 TGTTGGGGGGGGAGGGGGGAGGG + Intergenic
1176357173 21:5910062-5910084 TGTTGGGGGGGGAGGGGGGAGGG + Intergenic
1176544680 21:8187548-8187570 TGTTGGGGGGGGAGGGGGGAGGG + Intergenic
1176563631 21:8370593-8370615 TGTTGGGGGGGGAGGGGGGAGGG + Intergenic
1176709216 21:10135247-10135269 TTCTGGAAGGGGGAGGCTGAGGG + Intergenic
1176860956 21:14011341-14011363 CGCTGCAAGAGCAAGGGGGATGG - Intergenic
1177138907 21:17336993-17337015 TGCTGGGAAGTGAAGGGGGAAGG - Intergenic
1177249383 21:18572288-18572310 TGGTGGAAGGGGAAGGGGAGGGG + Intergenic
1177322096 21:19535992-19536014 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1177392633 21:20496047-20496069 TGCTGTTGGGGGAGGGGGGAGGG - Intergenic
1177419011 21:20831344-20831366 TTCTGTAAGGGATAGGGGGAAGG - Intergenic
1177572859 21:22909614-22909636 TGGGGTCAGGGGAAGGGGGAGGG + Intergenic
1177670232 21:24215019-24215041 TGCTGGAAGGGACGGGAGGAGGG + Intergenic
1178083085 21:29085927-29085949 TACAGGAAGGGGTTGGGGGAAGG - Intronic
1178281343 21:31285380-31285402 TGCTGGAAAGGTCACGGGGATGG + Intronic
1178686688 21:34717170-34717192 TCCAGGAAAGGCAAGGGGGAGGG + Exonic
1179203522 21:39250004-39250026 TTCTGGAAGAGGAAGCTGGAAGG + Intronic
1179218642 21:39387859-39387881 AGCTGGAAGGGGGAGGGGGGGGG + Intronic
1179264096 21:39786958-39786980 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1179572524 21:42286367-42286389 GGCTGGAAGGCGAAGGAGGAGGG - Intronic
1179572994 21:42288908-42288930 TGGTGGAAGGCAAAGTGGGATGG + Intronic
1179600788 21:42476144-42476166 TGCTGCCAGTGGGAGGGGGAGGG - Intronic
1179946918 21:44684758-44684780 TACAGGAAGGAGATGGGGGAAGG + Intronic
1179948559 21:44697037-44697059 TGCTGGATGGGCAGGAGGGAGGG - Intronic
1179948569 21:44697078-44697100 TGCTGGATGGGCAGGAGGGAGGG - Intronic
1179982171 21:44901312-44901334 TGCAGGAAAGGGCAGGAGGAAGG - Intronic
1180015113 21:45076612-45076634 TACTGGGAGGCCAAGGGGGAAGG + Intronic
1180468963 22:15639101-15639123 AGCTGGCATGGGAAGGAGGATGG - Intergenic
1180871676 22:19150213-19150235 TGCTCGATGGAGAAGGGGCAGGG + Exonic
1180988593 22:19920049-19920071 GGCTGGGATGGGAAGGGGCAAGG - Intronic
1180998166 22:19975756-19975778 TCCTGGAAGGGAAAGGTGGTGGG + Exonic
1181114302 22:20621500-20621522 TGCTGGGAGGGGTGGGGGCATGG - Intergenic
1181236669 22:21451124-21451146 ACCTCGAAGGGGAGGGGGGAGGG + Exonic
1181453021 22:23036644-23036666 TGCTGAAAGAGGAAGGGGAGAGG + Intergenic
1181639887 22:24190871-24190893 TGCTGGAAAGGGGAGGTGGGGGG - Intergenic
1181815482 22:25433600-25433622 TGTCGGAAGGGGAAGGGGAAGGG + Intergenic
1181852761 22:25761755-25761777 GGCTGGGAGGGGCAGGGGCAGGG - Intronic
1181885666 22:26020325-26020347 ATCTGAAAGGGGAAGGGGTATGG + Intronic
1182102982 22:27670728-27670750 CTCAGGAGGGGGAAGGGGGAAGG - Intergenic
1182314514 22:29436037-29436059 GGCTGGGAGGGTAAGGGGCAGGG + Intergenic
1182521010 22:30884563-30884585 TGCTTGAGGGAGATGGGGGAGGG + Intronic
1182557879 22:31138801-31138823 TGCAGGGAGGGGAGGGGAGAGGG + Intronic
1182695444 22:32196014-32196036 GGCTGGGAGGGTAAGGGGCAGGG - Intronic
1182728292 22:32466557-32466579 TGCTGAAAGGAAAAGGTGGAGGG + Intergenic
1182772684 22:32806531-32806553 TGGTGGAAAGGCAATGGGGAGGG + Intronic
1182886391 22:33777630-33777652 GGGAGGGAGGGGAAGGGGGAGGG + Intronic
1183131452 22:35840523-35840545 TGCTGGGAGGGGGTGGGGGGAGG - Intronic
1183153084 22:36053507-36053529 AGCAGGGAAGGGAAGGGGGAAGG - Intergenic
1183265720 22:36824010-36824032 TGCTGGAAGGGGCTGGGGCTGGG + Intergenic
1183408140 22:37640324-37640346 TGGGGGGAGGGGGAGGGGGAGGG - Intronic
1183413257 22:37667713-37667735 TGGTGGAAGGGGAAGGGAAAGGG - Intergenic
1183507985 22:38220029-38220051 AGCTGGTAGGGTAAGGGAGAGGG - Exonic
1183703895 22:39465185-39465207 TGGGGGCAGGGGAAGAGGGAGGG + Intronic
1183788306 22:40044854-40044876 TGCTGCAAGGCGAAACGGGAGGG + Intronic
1184031199 22:41895841-41895863 TGTTGAAAGGGGATGGGGGCTGG + Intronic
1184092530 22:42299959-42299981 GGCGGGGAGGGGGAGGGGGAGGG + Intronic
1184132075 22:42522831-42522853 TGGTGGAAGGCGAAGTGTGAGGG - Intergenic
1184140189 22:42573915-42573937 TGCTGGAGAGGGGAGGGGGTGGG - Exonic
1184220111 22:43094555-43094577 TGCTGCAAGGGGGAGGGAGGAGG - Intergenic
1184312216 22:43653778-43653800 TGGAGGAAGGGGCAGGGGGAGGG + Intronic
1184378913 22:44132873-44132895 TGCTGCAGGAGGAAGGAGGAAGG - Exonic
1184486840 22:44784960-44784982 TGCAGGAATGGGGCGGGGGATGG - Intronic
1184507823 22:44914700-44914722 TGGTGGATGGGGAAGGGGAAGGG + Intronic
1184729814 22:46366055-46366077 AGGTGGAGGGGGAAGGTGGAGGG + Intronic
1184753445 22:46502404-46502426 AGAGGGAAGGGGAAAGGGGAGGG + Intronic
1184753463 22:46502455-46502477 AGAGGGAAGGGGAAAGGGGAGGG + Intronic
1184805536 22:46792887-46792909 TGCGGGAAGGAGGAGGGGAAAGG - Intronic
1185143540 22:49117164-49117186 TGCAGGCAGGGGCAGGGGCAGGG + Intergenic
1185229812 22:49673560-49673582 AGGGGGAAGGGGAAGGGGGAGGG + Intergenic
1185243955 22:49763410-49763432 TGGGGGAAGAGGAAGGAGGAGGG + Intergenic
1185327936 22:50236650-50236672 GGCTGGAGGGGGCAGGAGGAAGG + Intronic
1185411175 22:50683795-50683817 TGGTGGAGGGGGATGGTGGAGGG + Intergenic
1203249548 22_KI270733v1_random:103785-103807 TGTTGGGGGGGGAGGGGGGAGGG + Intergenic
949493519 3:4610947-4610969 AGGGGGAAGGGGAAGGGGAAGGG - Intronic
949493526 3:4610960-4610982 AGAAGGAGGGGGAAGGGGGAAGG - Intronic
949493543 3:4611009-4611031 GGGAGGAAGGGGAAGGGGAAGGG - Intronic
949494541 3:4619574-4619596 GGAGGGCAGGGGAAGGGGGAAGG - Intronic
949507872 3:4743732-4743754 TTGTTGAGGGGGAAGGGGGAGGG + Intronic
949851552 3:8425760-8425782 TGCTAGACTGGGAAGGGGGAGGG - Intergenic
950024558 3:9811202-9811224 GGCTGGAAGGGGCACGGAGAGGG - Intronic
950091356 3:10297554-10297576 TGGGGGGAGGGGACGGGGGAGGG - Intronic
950181297 3:10915303-10915325 TGCTGGAGGGGGAAGCAGAAGGG - Intronic
950426926 3:12929362-12929384 AGCTGGAAGGGGCAGAAGGACGG + Intronic
950520493 3:13495116-13495138 GGCTGGAAGGAGCAGGTGGAGGG - Intronic
950703243 3:14764969-14764991 TGCTGGAAGAGGAACTGGGGTGG - Intronic
950731559 3:14963914-14963936 TGCTGGGTGGGGAGGGGGGTAGG - Intronic
951217821 3:20040840-20040862 AGGTGGAAGCGGGAGGGGGAGGG - Intronic
951285119 3:20801412-20801434 GGCTGGAAAGGGTAGTGGGAAGG + Intergenic
951795915 3:26538204-26538226 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
951930116 3:27955879-27955901 GGAAGGAAGGGGAAGGGGAAGGG - Intergenic
952102585 3:30032056-30032078 GGCTGGAAAGGGAAGGGAGAAGG - Intergenic
952107551 3:30087617-30087639 AGGTGGAGGGGGAGGGGGGAGGG - Intergenic
952165638 3:30745937-30745959 TGGGGGAAAGGGGAGGGGGAAGG - Intronic
952181887 3:30925500-30925522 TGCTGAAAGGCAAAAGGGGAAGG - Intergenic
953027607 3:39153825-39153847 TGCTGGAAGCGGGGCGGGGAGGG - Intronic
953136889 3:40189493-40189515 GCCTGGAAGGGGAGGGGAGAGGG - Intronic
953266178 3:41390945-41390967 TGAAGGGAAGGGAAGGGGGATGG - Intronic
953384554 3:42499234-42499256 TGGTGGAGTGGGAAGGGGGCTGG - Intronic
953544533 3:43854657-43854679 TGCTTGAAAGGGAAGGTGGAAGG + Intergenic
953639724 3:44695186-44695208 TGGGGTGAGGGGAAGGGGGACGG + Intergenic
953753065 3:45624208-45624230 TGCTGAAAGGGGTTGGGGCAAGG - Intronic
953807026 3:46079488-46079510 AGCTGGAAGTGGAAGGGAGGAGG - Intergenic
953979091 3:47404847-47404869 TGCAGCAAGGAGAAGGGGGAAGG - Intronic
954136570 3:48584716-48584738 AGCCGGTAGGTGAAGGGGGAAGG - Exonic
954260030 3:49432058-49432080 AGCGAGAAGGGGATGGGGGAGGG + Intergenic
954385481 3:50241777-50241799 TGCTGGATGGGGCCTGGGGATGG + Intronic
954976409 3:54699284-54699306 TGCTGGAGGAGCAAGGGGGAAGG + Intronic
955068725 3:55554728-55554750 TGCAGCACGGGGAAGGGGGGAGG - Intronic
955116960 3:56015357-56015379 TGTTGGAAGGGGTCGGGGGAGGG - Intronic
955407679 3:58635811-58635833 TGCTGGAGGGGGCAGGTGCAGGG - Intronic
955434331 3:58885611-58885633 TGCTGGAAATGGTAGGGGGAAGG - Intronic
955504702 3:59619804-59619826 TGGCGGGAGGGGGAGGGGGAGGG + Intergenic
955596321 3:60594615-60594637 TGTTGGAAGGGGAGAGGAGAGGG - Intronic
955932906 3:64075838-64075860 GGCTGGGAAGGGTAGGGGGAGGG - Intergenic
956042061 3:65155146-65155168 GGCTGGGAAGGGTAGGGGGAAGG - Intergenic
956086220 3:65613916-65613938 TGCTAGAAAGGGAAGGGAAAGGG + Intronic
956168239 3:66412568-66412590 AGCTGCAAAGGGAAGGGGGCTGG + Intronic
956230142 3:67005636-67005658 GAAGGGAAGGGGAAGGGGGAGGG - Intronic
956269208 3:67432025-67432047 TGCAGGAAGGGGATGATGGATGG + Intronic
956668252 3:71662167-71662189 TACTGTAAGGGCAAGGTGGAGGG + Intergenic
956800569 3:72754303-72754325 TGGTGGAACGGGAAGAGGGCTGG - Intronic
956858909 3:73303142-73303164 GGTTGGAAGGGGAAGAGGTAGGG + Intergenic
956913638 3:73847428-73847450 GGCTGGAGGGGAAAGGGGGAGGG + Intergenic
957407079 3:79785321-79785343 CACAGGAAGGGGATGGGGGAGGG + Intergenic
957485072 3:80850301-80850323 TGGTGGAAGGGGAAGGGAAAGGG - Intergenic
957532789 3:81461526-81461548 AACTGGAAAGGGATGGGGGAAGG + Intergenic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
957672946 3:83328656-83328678 AAAGGGAAGGGGAAGGGGGAGGG + Intergenic
957741665 3:84278663-84278685 TGGAGGAAGGGGAAGAGGGTAGG + Intergenic
957992514 3:87645219-87645241 TGCATGATGGGGATGGGGGATGG - Intergenic
958129183 3:89395803-89395825 GGATGGGAGGGGAAGGTGGAAGG - Intronic
958828279 3:99058806-99058828 TGCGGGGTGGGGGAGGGGGAGGG - Intergenic
958877925 3:99637410-99637432 GGCGGGAATGGGAGGGGGGAGGG - Intergenic
958880225 3:99660957-99660979 TGCTGGAAAGGGAATGGAAATGG + Intronic
958897568 3:99846148-99846170 TGCTGGTGGGGGACGGGGGGAGG - Intronic
959080328 3:101794171-101794193 TGCTGGAAGTGGAAGTTTGAGGG + Intronic
959573038 3:107906140-107906162 GGCTGGAATGAGAAGGGGAAAGG + Intergenic
959574461 3:107919402-107919424 GCCTGGAAGAGGAAGGAGGAAGG + Intergenic
959644605 3:108683678-108683700 AGCTGGAGGAGGAAGTGGGATGG - Intronic
959719460 3:109470480-109470502 TGCTGAAATGGGAAGGGCCAGGG + Intergenic
960034283 3:113086866-113086888 AGGTGGGAGGGGTAGGGGGAAGG + Intergenic
960141531 3:114155919-114155941 AGGCGGAAGGGGAAGTGGGAGGG - Intronic
960385323 3:117015775-117015797 TGCTGGAACGAGAAGGGGTGGGG - Intronic
960499903 3:118424465-118424487 GGCTGGAAAGGGAAAGGGGGAGG + Intergenic
960544295 3:118894862-118894884 TGATGGTAGGTGAAGGGTGAAGG - Intergenic
960664075 3:120093872-120093894 CGCTTGAAGAGAAAGGGGGATGG + Intronic
960747639 3:120908087-120908109 AGCTGGGAGGTGAAGGGGGCGGG - Exonic
961031967 3:123614123-123614145 TGGAGGAAGGTGAAGGGGAAGGG - Exonic
961117026 3:124339218-124339240 TGCTGGGAGGGGACGGGTGCAGG + Intronic
961212327 3:125135224-125135246 TGCTGGTACGGGTAGGGGGAAGG + Intronic
961387252 3:126529746-126529768 TGATGGGAGGGGAGGAGGGATGG - Intronic
961393936 3:126572921-126572943 TGCTGGAGGGGACAGAGGGAGGG + Intronic
961487129 3:127224510-127224532 TGCTGGAAGAAGGAAGGGGAGGG - Intergenic
961527729 3:127517553-127517575 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
961714199 3:128847575-128847597 GGGAGGAAGGGGAAGGGGGCAGG + Intergenic
961810704 3:129520010-129520032 GGCTGGAAGGGGAGATGGGAGGG - Intronic
962081431 3:132143061-132143083 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
962340052 3:134575154-134575176 GGGAGGGAGGGGAAGGGGGACGG - Intergenic
962425129 3:135262777-135262799 TGCTGGAAGGGGCAGGGAGAGGG - Intergenic
962426697 3:135275261-135275283 GGCTGGGAAGGGTAGGGGGAAGG - Intergenic
962483198 3:135815755-135815777 TGCTGCCAGGGTAAAGGGGAGGG - Intergenic
963143257 3:141965541-141965563 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
963239514 3:142989239-142989261 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
963284138 3:143416978-143417000 TGCTGGAGGAGGATGGGGAAAGG + Intronic
963818210 3:149857712-149857734 TGGGGGAAGGGGATGGGGAAAGG - Intronic
963938861 3:151081426-151081448 AGGGGGAGGGGGAAGGGGGAGGG - Intergenic
964210387 3:154220376-154220398 TACTGGAAATGGAAGGGAGATGG + Intronic
964349672 3:155790600-155790622 TGCTGCAAAGGGATGGGGGAGGG - Intronic
964412048 3:156408031-156408053 TTGTGGAAGGTGACGGGGGAGGG + Intronic
964554351 3:157919221-157919243 TGCAGGGCGGGTAAGGGGGAGGG + Intergenic
964966292 3:162497158-162497180 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
965464281 3:169007527-169007549 GGCTAGAGGGGAAAGGGGGAGGG - Intergenic
965518346 3:169646313-169646335 TGGGGGGAGGGGGAGGGGGAGGG + Intronic
965852230 3:173041803-173041825 TGCGGGATGGGGGCGGGGGAGGG + Intronic
965969131 3:174532174-174532196 TGGGGGAAGGAGAAGGGGAAGGG + Intronic
966185220 3:177221062-177221084 GTCTAGAAGAGGAAGGGGGAAGG - Intergenic
966623630 3:181993061-181993083 TGTGGCAAGGGGGAGGGGGAGGG + Intergenic
966720803 3:183061151-183061173 TGGTGGTAGGGTATGGGGGAGGG + Intronic
966982888 3:185153699-185153721 GGGTGGGAGGAGAAGGGGGAGGG - Intergenic
967055513 3:185825667-185825689 TGCTGCCAGGGCAAGCGGGAAGG + Intergenic
967078120 3:186023561-186023583 TGATGGAGGGGGAAGGGGAGGGG + Intergenic
967095205 3:186172304-186172326 TGATGGAAGGGGAAGTGGAGTGG - Intronic
967114578 3:186325234-186325256 TACTAGAGGGGGCAGGGGGAAGG + Intronic
967151435 3:186654164-186654186 TGCTGGAACGAGAAGGAGCAGGG + Intergenic
967183872 3:186929640-186929662 TGCTGGGTGGGAAAGGGGAAAGG - Intergenic
967364583 3:188671501-188671523 TGTAGTAAGGGAAAGGGGGAGGG - Intronic
967697077 3:192544241-192544263 TGCTGCTGGGGGGAGGGGGATGG + Intronic
967713017 3:192730898-192730920 AGCTGGGAAGGGTAGGGGGAAGG + Intronic
968266972 3:197369907-197369929 GGATGGATGGGGAAAGGGGAGGG - Intergenic
968310688 3:197681041-197681063 TGGGGGGAGGGGACGGGGGAGGG + Intronic
968339315 3:197941473-197941495 GGGAGGGAGGGGAAGGGGGAGGG - Intronic
968857512 4:3138161-3138183 GGCGGGAAGGGGAAGGGAAAAGG - Intronic
968940087 4:3633281-3633303 GGGAGGGAGGGGAAGGGGGAGGG - Intergenic
969074836 4:4569717-4569739 TGCTGCAAGGTGATGAGGGAAGG + Intergenic
969307979 4:6336499-6336521 TTCAGGAAGGGGCAGGAGGAGGG + Intronic
969390247 4:6887377-6887399 GGCTGGAGGGGGAAGGGGGAGGG + Intergenic
969397674 4:6933272-6933294 AAGGGGAAGGGGAAGGGGGAGGG - Intronic
969462825 4:7337819-7337841 AGCTGGGAGTGGCAGGGGGAAGG - Intronic
969506104 4:7588723-7588745 TCCTGGAAGAGGAAGGGCGCTGG + Intronic
969551274 4:7869224-7869246 AGGAGGAAGGGGAAGGAGGAAGG + Intronic
969572865 4:8020228-8020250 TGCTGGTAGGTGGAGGGGGGCGG + Exonic
969632813 4:8348220-8348242 TGGTGGAAGAGGAAGTGAGATGG + Intergenic
970022824 4:11588244-11588266 TGCTGCAAAGGGAAGAGGGGTGG - Intergenic
970169363 4:13274510-13274532 TTCTGGAAGGCCAAGGGGAATGG - Intergenic
970305556 4:14728189-14728211 TGGGGGAGGGGGAGGGGGGAGGG + Intergenic
970679068 4:18486202-18486224 TGGGGGGAGGGGGAGGGGGAGGG + Intergenic
971163462 4:24157940-24157962 TGTTGGAAGGGTAAGGGGTTGGG - Intergenic
971177391 4:24293343-24293365 TGCAGGAAGGGGTGGGGGTAAGG - Intergenic
971331081 4:25681969-25681991 TGAGGGAAGGGGAAGAGAGAGGG - Intergenic
971447882 4:26771638-26771660 TGTTGCCAGGGGATGGGGGAGGG + Intergenic
972668299 4:41189352-41189374 GTCTGGAAGGGGCAGGAGGAAGG + Intronic
972824579 4:42742462-42742484 TACTGGTGGGGGAAGGAGGAAGG + Intergenic
972896267 4:43624806-43624828 TGGGGGAAGGGGAAGGGGGTTGG - Intergenic
973149859 4:46873811-46873833 TGGGGTGAGGGGAAGGGGGAGGG - Intronic
973855860 4:55009201-55009223 TGAGGGAAGGGGAAGTGTGATGG + Intergenic
974488846 4:62537888-62537910 TCCTGGCAGGGGAAGGGGAAAGG + Intergenic
974758720 4:66247634-66247656 TATTGGAAGGTGAATGGGGAGGG + Intergenic
975068824 4:70106257-70106279 GGATGGCTGGGGAAGGGGGAGGG - Intergenic
975270381 4:72425475-72425497 TGGGGTAAGGGGAAGGGGGAGGG - Intronic
975308571 4:72877349-72877371 TGGGAGAGGGGGAAGGGGGAGGG - Intergenic
975515767 4:75246057-75246079 TGCGGTGAGGGGAGGGGGGACGG + Intergenic
975731128 4:77338210-77338232 TGGGGGGAGGGGAAGGGGGAGGG - Intronic
975781362 4:77843680-77843702 TAATGGAAGGCCAAGGGGGAAGG - Intergenic
975804026 4:78093969-78093991 TGGTGGAAGTGGGAAGGGGAGGG - Intronic
976252734 4:83069864-83069886 TGGTGGGAGGGGAAAGGGAAAGG - Intronic
976340240 4:83939180-83939202 GGCTGGGAAGGGAAGGAGGAAGG - Intergenic
976571541 4:86617566-86617588 TGCTGGAAGGGGAAGGGGGAGGG - Intronic
976658083 4:87510586-87510608 AGCTGGAAAGGGAATGGGAAGGG - Intronic
976680845 4:87754231-87754253 TGGGGGGAGGGGGAGGGGGAGGG - Intergenic
976753750 4:88477277-88477299 GAAGGGAAGGGGAAGGGGGAGGG + Intronic
976789199 4:88858719-88858741 GGCTGGCAGGGGATGGAGGAGGG + Intronic
977204943 4:94157267-94157289 TGCGGAGAGGGGGAGGGGGAGGG - Intergenic
977299507 4:95252179-95252201 TGCTGGAAGTGCACGGGAGAAGG + Intronic
977597225 4:98896403-98896425 GAATGGAAGGGGAAGGGGAAAGG + Intronic
977771705 4:100868519-100868541 TGCTGCAGCTGGAAGGGGGAGGG - Intronic
977937875 4:102827249-102827271 TGCTGGAGGAGGAGGGGGAATGG - Intronic
978190295 4:105903400-105903422 AGATGGAAGGGCAAGGGAGAGGG + Intronic
978258163 4:106718095-106718117 TGCTGCCAGGGGATGGGGGAGGG - Intergenic
978287693 4:107098272-107098294 TGCTGCCAGGGGATGGTGGAGGG - Intronic
978695421 4:111571087-111571109 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
979184508 4:117771978-117772000 TGCTGAAGGGGGATGAGGGAAGG - Intergenic
979591987 4:122491326-122491348 TGCTACAAGGGGAAAAGGGAAGG + Intergenic
980208699 4:129756406-129756428 TAGTGGCAGGGGAAGGAGGAGGG - Intergenic
980478633 4:133355821-133355843 TTCTGGAAGGGGTGGGGGAAGGG - Intergenic
980499989 4:133637240-133637262 TGCAGGGAGGGGAAGGGGAATGG + Intergenic
980675866 4:136079768-136079790 GGCTGGAAGGGAAAGAGAGAAGG + Intergenic
980800061 4:137735670-137735692 TACTGGATGGAGTAGGGGGAGGG + Intergenic
980874628 4:138648555-138648577 TGGTGGAAGGTGAAGCAGGAGGG - Intergenic
981032095 4:140135906-140135928 AGGTTGAAGGAGAAGGGGGAGGG - Intronic
981139694 4:141254089-141254111 TGTTCCTAGGGGAAGGGGGATGG - Intergenic
981447514 4:144857102-144857124 TACTAGAATGGGGAGGGGGAAGG + Intergenic
981624741 4:146742698-146742720 GGAGGGAAGGGGAAGGGGGGAGG - Intronic
981990060 4:150907338-150907360 GGGAGGAAGGGGAAGGGGGAGGG + Intronic
982152119 4:152471475-152471497 AGCAGGGAGGGAAAGGGGGAGGG + Intronic
982683501 4:158460003-158460025 TGCTGCCAGGGGATGAGGGATGG + Intronic
982981767 4:162146709-162146731 GGAAGGAAGGGGAAGGGGAAGGG - Intronic
983172305 4:164549801-164549823 GGCTGGAGGGGAAAGAGGGAGGG - Intergenic
983196362 4:164811126-164811148 TGGAGGAGGGGGGAGGGGGAGGG + Intergenic
983440473 4:167777346-167777368 TGGGGTAGGGGGAAGGGGGAAGG - Intergenic
983641650 4:169948995-169949017 TGCTGGAAGAAGAGGGGAGAGGG - Intergenic
983822874 4:172218051-172218073 TGATGGGAAGGGATGGGGGAGGG + Intronic
984017544 4:174443703-174443725 TGATGGAAGTAGAAGTGGGAGGG - Intergenic
984164201 4:176288174-176288196 GGAAGGTAGGGGAAGGGGGAAGG - Intergenic
984222452 4:176994695-176994717 AGGGGGAAGGGGAAGAGGGAGGG - Intergenic
984310383 4:178051003-178051025 TGGTGTAAGGGGATGGGGGAGGG - Intergenic
984911437 4:184676929-184676951 AGGGAGAAGGGGAAGGGGGAAGG - Intronic
985127996 4:186714269-186714291 TGCTGGAGTGGGGAGAGGGAGGG + Intronic
985690114 5:1304252-1304274 AAGTGGAAGGGGAAGGGGAAGGG - Intergenic
985985933 5:3516318-3516340 TGATGGAAGGCAAAGGGGGGGGG + Intergenic
986108970 5:4692416-4692438 TGGTGGAAGGTGAATGGGGTTGG + Intergenic
986291997 5:6407589-6407611 CTCTGGAAGGAGAAGAGGGAAGG - Intergenic
986387497 5:7248892-7248914 TACTGGAAGGTGAGGGGGGCTGG - Intergenic
986403998 5:7407420-7407442 TGGCTGAAGGGGAAGGGGAAGGG + Intronic
986600298 5:9466219-9466241 TGGGGTGAGGGGAAGGGGGAGGG + Intronic
986791612 5:11166592-11166614 TGGTGGGAGTGGGAGGGGGAGGG + Intronic
986883940 5:12211207-12211229 GGCTGGGAAGGGTAGGGGGAAGG + Intergenic
986946594 5:13029110-13029132 GGAGGGAAGGGGAAGGGGAAGGG + Intergenic
987066855 5:14298002-14298024 TGCTGCAAGGGGTGGGGGAAAGG + Intronic
987309125 5:16666214-16666236 TGAGGGAGTGGGAAGGGGGATGG - Exonic
987332546 5:16869913-16869935 GAAGGGAAGGGGAAGGGGGAGGG + Intronic
987374274 5:17218747-17218769 TTCTGGAAATGGAGGGGGGACGG - Intronic
987447647 5:18040687-18040709 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
987501282 5:18712660-18712682 GGCTGGAAGGAAAAGGGGAAAGG - Intergenic
987561577 5:19530574-19530596 TGGGGTAGGGGGAAGGGGGAGGG - Intronic
987797926 5:22654025-22654047 GGAAGGAAGGGGAAGGGAGAAGG - Intronic
987940612 5:24531198-24531220 TGGTGACTGGGGAAGGGGGAAGG - Intronic
988589967 5:32540355-32540377 AGATGGAAGGGGAAGCAGGAAGG - Intronic
988608657 5:32704218-32704240 TGCTGCTGGGGGATGGGGGAAGG + Intronic
988836894 5:35042174-35042196 GGCTGGAGGGGGAAGGGAGTTGG + Intronic
988987005 5:36630157-36630179 TGCTAGTGGGAGAAGGGGGAGGG + Intronic
989114976 5:37943535-37943557 TGGTGTGGGGGGAAGGGGGAGGG + Intergenic
989215466 5:38900282-38900304 TGCTGCCAGGGAATGGGGGAGGG + Intronic
989272912 5:39553643-39553665 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
989502353 5:42182745-42182767 TGCTGCCAGGGGATGAGGGAGGG - Intergenic
989690351 5:44136162-44136184 TGGAGGAGGGGGGAGGGGGAAGG - Intergenic
989823045 5:45818606-45818628 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
990304345 5:54480171-54480193 TGGTGGAAGGGGAAGGGAAAGGG - Intergenic
990334926 5:54763429-54763451 TGTGGGGAGGGGAAGAGGGAGGG - Intergenic
990589746 5:57249961-57249983 AGGGGGAGGGGGAAGGGGGAAGG - Intronic
990611350 5:57460041-57460063 TGGGGTCAGGGGAAGGGGGAGGG - Intergenic
990829086 5:59936211-59936233 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
991997014 5:72397964-72397986 GGCTGGAGGGGAAAGAGGGAGGG + Intergenic
992171031 5:74102269-74102291 TGAAGGAAGGGGAGGGGGGGAGG - Intergenic
992349709 5:75916383-75916405 AGGAGGAAGGGGAAGGGGAAGGG - Intergenic
992579038 5:78151961-78151983 GGATGGGAGGGGGAGGGGGAGGG - Intronic
992579074 5:78152036-78152058 GAAGGGAAGGGGAAGGGGGAGGG - Intronic
992605165 5:78448084-78448106 TGGAGTAGGGGGAAGGGGGAGGG - Intronic
992773479 5:80070068-80070090 TCCTGGAAGTGGGAGTGGGAGGG + Intronic
993124939 5:83822387-83822409 TGTTGGAAGTGGCAGGGGCAGGG - Intergenic
993554678 5:89321227-89321249 TGAGGGAAGGGGAAGGGGAAAGG + Intergenic
993901157 5:93584934-93584956 CGCTGGGAGGGGAAGGGGAAGGG - Exonic
994001641 5:94788562-94788584 TGGTGGTGGGGGAAGGGTGATGG - Intronic
994274831 5:97822876-97822898 TGCTGCCAGGGGGATGGGGAAGG + Intergenic
994343733 5:98661780-98661802 TGCTACTAGGGGATGGGGGAGGG - Intergenic
994638091 5:102367541-102367563 GGAGGGAAGGGGAAGGGGAAGGG + Intergenic
994683878 5:102924870-102924892 TGGTGGGAGGTGATGGGGGAAGG - Intronic
994881205 5:105498611-105498633 TGCTGCTAGGGGATGGAGGAGGG + Intergenic
994988996 5:106974658-106974680 TTCTGCAAGGAGAGGGGGGATGG + Intergenic
995236411 5:109833687-109833709 TGTGGGGAGGGGGAGGGGGAGGG + Intronic
995495515 5:112737955-112737977 TGCTGCGGGGGGAGGGGGGAAGG + Intronic
995721222 5:115135614-115135636 TGCTGGAAAGGTAAGGTTGAGGG - Intronic
995767709 5:115636855-115636877 TGCAGGATGGTGAAGGTGGATGG + Intergenic
995785808 5:115826162-115826184 TGCAGGAAGTGGAAGGAGCAGGG - Intergenic
995847191 5:116506678-116506700 TGGCGGGAGGGGGAGGGGGAGGG + Intronic
996175663 5:120353059-120353081 TGGGGGTGGGGGAAGGGGGAAGG + Intergenic
996189494 5:120521812-120521834 TGGGGTAAGGGAAAGGGGGAGGG - Intronic
996206502 5:120744391-120744413 GGTTGGAAGGGGATTGGGGAAGG + Intergenic
996423287 5:123285703-123285725 GGGGGGAAGGGGAAGGGGAAGGG - Intergenic
996542023 5:124640397-124640419 TGGTGGGTGGGGAAGGGGCAGGG - Intronic
996630601 5:125626782-125626804 TGGGGTAAGGGGAGGGGGGAGGG + Intergenic
996819861 5:127614547-127614569 TGGGGTAGGGGGAAGGGGGACGG + Intergenic
996847906 5:127921031-127921053 TGTTGGAAAGGAAAGGAGGAAGG + Intergenic
997082141 5:130752989-130753011 TGGGGTGAGGGGAAGGGGGAGGG - Intergenic
997131337 5:131279448-131279470 TTCTGAAAGGGGGGGGGGGAGGG - Intronic
997291866 5:132742913-132742935 GGGTGGAAGGGAAAGAGGGAGGG - Intergenic
997334431 5:133095856-133095878 GGCTGTCAGGGGATGGGGGAGGG - Intronic
997441098 5:133909077-133909099 TGCAGGAAGGAGAAGGATGAGGG + Intergenic
997663624 5:135609039-135609061 TCCTGGAGGTGGAAGGGGCATGG + Intergenic
997698547 5:135880348-135880370 TGCTGGAAGGGGAAACGGAGAGG - Intronic
997931487 5:138076063-138076085 TTCTGGATGTGTAAGGGGGAGGG - Intergenic
997952080 5:138250286-138250308 TCCTGGGAGGGGAAGAAGGAAGG + Intergenic
998127715 5:139635586-139635608 TGTTTGAAGGGGAAGGGAGAGGG + Intergenic
998253441 5:140567669-140567691 TGCTGGAGGGGGACTGGGAAGGG - Exonic
998353478 5:141515876-141515898 TTATGGAGGGGAAAGGGGGAAGG + Exonic
998372846 5:141672350-141672372 TGCAGGAAGAGCCAGGGGGATGG - Intronic
998537820 5:142951041-142951063 AGGGGGAAGGGGAAGGGGAAGGG - Intronic
998584739 5:143415338-143415360 GGCTGGGAAGGGCAGGGGGAAGG + Intronic
998773593 5:145573489-145573511 TGCGGGCAGAGGAAAGGGGAGGG - Intronic
998825620 5:146098433-146098455 TGATGGAGGGGGAGGAGGGAGGG - Intronic
998826189 5:146103709-146103731 TGCTAGAAGAGGAAGAGGAATGG - Intronic
999126423 5:149249617-149249639 AGCTGGACAGGGAAGGGAGATGG + Intronic
999181948 5:149676064-149676086 GGCTGGGAGGGGCAGGGGCAGGG + Intergenic
999289726 5:150416276-150416298 GGCTGGGAAGGGTAGGGGGAAGG + Intergenic
999629337 5:153553984-153554006 AACTGGGTGGGGAAGGGGGAGGG - Intronic
999720349 5:154394763-154394785 TGCTGGTAGGGGCAGGGAAAAGG - Intronic
999744882 5:154584418-154584440 TGCTGGCAGGGGCATGGGGATGG + Intergenic
1000034148 5:157430311-157430333 TGTTGGTGGGGGTAGGGGGAGGG + Intronic
1000231162 5:159316587-159316609 TGTTGGAGAGGAAAGGGGGATGG - Intronic
1000268189 5:159657979-159658001 GGCTGGGAGGGGAAGGTGGGTGG + Intergenic
1000329866 5:160198019-160198041 AGCTGGAGAGGGAAGGGAGAAGG + Intronic
1001026241 5:168226556-168226578 TGATGGAAGGGTAAGAGGTAGGG - Intronic
1001215418 5:169851726-169851748 TGGTGGAAGGGGAAGCAGGGAGG + Intronic
1001280334 5:170382038-170382060 TGATGGGACGGGAAGGGGCAGGG - Intronic
1001319238 5:170666810-170666832 TGCTGGAGGGAGAAGTGGGCAGG - Intronic
1001397021 5:171424845-171424867 AGGGGGAAGGGGGAGGGGGAGGG + Intronic
1001630294 5:173170018-173170040 GGCTGGAAGGGAAAGAGGGAGGG - Intergenic
1001822550 5:174721247-174721269 GGCTAGAAGGGGGCGGGGGAGGG - Intergenic
1001824300 5:174733236-174733258 GGCTGGAAGGGGGAGAGGGGAGG - Intergenic
1001930285 5:175668132-175668154 TTCTGGAAGGGGAAGGACCAGGG + Intronic
1002065177 5:176648130-176648152 TACTGGAAGGGAAAGGAGGCCGG - Intronic
1002080957 5:176737135-176737157 CCCAGGAAGGGGTAGGGGGAGGG + Intergenic
1002105028 5:176875812-176875834 TGGTGGGAGGGGCAGGGGGTCGG - Intronic
1002173675 5:177389365-177389387 AGCAGCAAGGGGAAGGGGAAGGG - Intronic
1002176977 5:177406019-177406041 TACTGGAAGGGGAAGTGGCAGGG + Exonic
1002186280 5:177456198-177456220 TGCGGGGAGGGGCGGGGGGAGGG + Exonic
1002190847 5:177476795-177476817 TGCTACAAGGGGAAGCGGGGAGG - Intergenic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1002375995 5:178789547-178789569 GGCTGGTAGTGGGAGGGGGAAGG - Intergenic
1002412342 5:179091944-179091966 TGCTGGGAAGGGAAGTGGGTAGG - Intergenic
1002426575 5:179180306-179180328 GGCTGCAAGAGGAAGTGGGACGG + Intronic
1002506010 5:179679523-179679545 AGCTGGAAGGGTGAGGGGTAGGG + Intronic
1002686740 5:181017818-181017840 GGGTGGAGGGGGAAAGGGGAGGG + Intergenic
1002793586 6:452629-452651 TCCTGGAATGGGAAGGGCCAGGG + Intergenic
1002820506 6:720240-720262 TTCTGAAAGGGGCAGTGGGATGG + Intergenic
1003060405 6:2858268-2858290 GGGTGGAAGGGGGAGGGGGAGGG - Intergenic
1003272911 6:4623224-4623246 AGCAGGAAGGGGAAGCGGCAGGG + Intergenic
1003286646 6:4739998-4740020 TGATGGAAAGGAAATGGGGAAGG + Intronic
1003335552 6:5168639-5168661 TCCTGGATGGGGCAGGGGCAGGG + Intronic
1003409941 6:5853175-5853197 TGATGGAAGGGGAAGCAAGAAGG + Intergenic
1003524814 6:6888844-6888866 GGCTGGAAGGAGAAGGGAAAAGG + Intergenic
1003604720 6:7548749-7548771 TGCTGGAGTGGGAATGGGGAGGG + Intronic
1003667638 6:8126628-8126650 TCCAAAAAGGGGAAGGGGGAGGG + Intergenic
1003838437 6:10095346-10095368 AGCTGGAAGAGGATGTGGGAGGG + Intronic
1004274409 6:14222699-14222721 TTATGGAAGGGGCAGGGAGATGG + Intergenic
1004536592 6:16509094-16509116 GGAGGGAGGGGGAAGGGGGAAGG + Intronic
1004607327 6:17206523-17206545 TGGGGGAAGGGAGAGGGGGAAGG + Intergenic
1004924616 6:20404170-20404192 TGCTGGAGGGGGAGGGGGGTGGG + Intronic
1005229258 6:23681342-23681364 TTATAGAAGAGGAAGGGGGATGG - Intergenic
1005348351 6:24911170-24911192 TGCTGGGAGGGGAGGGCGGGTGG + Intronic
1005492971 6:26363719-26363741 TTGGGGAGGGGGAAGGGGGAGGG + Intergenic
1005757733 6:28940350-28940372 TCCTGGGAGAGGTAGGGGGAGGG + Intergenic
1005777624 6:29153400-29153422 GGAAGGAAGGGGAAGGGGAAGGG - Intergenic
1005845118 6:29771084-29771106 TACTGGAAGGGGCAGGGGTGGGG + Intergenic
1006241507 6:32683909-32683931 TGGTGGAAGGTGGAGGGGCAAGG - Intergenic
1006330033 6:33383802-33383824 TCCAGGATGGGGAAGGGTGAAGG - Intergenic
1006338413 6:33432664-33432686 TGCTGGGGGGGAAATGGGGATGG - Exonic
1006554333 6:34852621-34852643 TGCTGCATGGGGTTGGGGGAGGG + Intronic
1006567750 6:34974177-34974199 GAAGGGAAGGGGAAGGGGGAAGG - Intronic
1006567832 6:34974383-34974405 GAATGGAAGGGGAAGGGGAAGGG - Intronic
1006671017 6:35729740-35729762 GGCTGGAGGGGAAAGGGTGAAGG - Intergenic
1006686068 6:35835243-35835265 TGCTTGAAGGGGAAGGGCGGAGG + Exonic
1006828888 6:36956962-36956984 TGCTGAAAAGAGAAGGGGGTAGG - Intronic
1006964496 6:37968688-37968710 GGCGGAAGGGGGAAGGGGGAAGG - Intronic
1007181890 6:39934498-39934520 GGCGGGGAGGGGCAGGGGGAGGG + Intronic
1007255278 6:40523985-40524007 GGCTGGGAAGGGCAGGGGGAGGG + Intronic
1007449446 6:41931838-41931860 TGCTGGGGGTGGAAGGGGGCTGG + Intronic
1007465229 6:42047129-42047151 TGAGGGAAGGGGAAGCCGGAAGG + Intronic
1007631740 6:43276690-43276712 AGCTGGGAAAGGAAGGGGGAGGG - Intronic
1008172857 6:48231693-48231715 GGCTGGAAAGGGTAGTGGGAGGG - Intergenic
1008353591 6:50523817-50523839 TGCTTGATGGGGTTGGGGGATGG - Intergenic
1008518074 6:52337051-52337073 TGCTGGAAGTGGGAAGGGGCGGG - Intergenic
1008677374 6:53834426-53834448 TGCTGGAGGTGGAGGCGGGAGGG - Intronic
1008763436 6:54881904-54881926 TGCGGCAGGGGGAAGGGGGAGGG - Intronic
1008813475 6:55534304-55534326 TTCTGGAAGAGCAAGTGGGAGGG - Intronic
1008937645 6:57009122-57009144 GGCTGGAAAGGGCAGGGGGAAGG + Intronic
1009391416 6:63148227-63148249 AGCTGGGAAGGGTAGGGGGAGGG + Intergenic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1009577217 6:65480950-65480972 TGCTGGGAAGGGTAGGGAGAAGG + Intronic
1009715298 6:67385207-67385229 TGCTGATAGGGAAATGGGGATGG - Intergenic
1009874822 6:69492975-69492997 GGCTGGAAGGGAAAAAGGGAGGG - Intergenic
1010123931 6:72411349-72411371 TGATGGAAGAGGAAGGAGGCAGG + Intergenic
1010211011 6:73363025-73363047 TCTTGGGAGGGGAAGGTGGAAGG - Intronic
1010503880 6:76632564-76632586 GGCTGCTAGGGGATGGGGGAAGG + Intergenic
1010507566 6:76679034-76679056 TTCTGTAGGGGGAGGGGGGAAGG + Intergenic
1010550590 6:77217572-77217594 GACTGAAAGTGGAAGGGGGATGG + Intergenic
1010563868 6:77384526-77384548 GGCTGGAAGGGGACGGGAAATGG + Intergenic
1010640423 6:78319532-78319554 TGCTTGAGGTGGAAGGGGAAAGG - Intergenic
1011291297 6:85779863-85779885 TGCTGTCATGGGATGGGGGAGGG + Intergenic
1011326190 6:86151682-86151704 AGCTGGGAGGGGAAAGGGTAAGG + Intergenic
1011517192 6:88166789-88166811 AGCCGGAAGGGGAAGGGGAGCGG + Intergenic
1011626793 6:89289677-89289699 ATCTGGAAGGGGAAGGGGAAGGG + Intronic
1011632351 6:89339573-89339595 GGTGGGGAGGGGAAGGGGGAAGG + Intronic
1012288530 6:97422617-97422639 TGCTGCCAGGGGATGGAGGACGG + Intergenic
1012336474 6:98065397-98065419 CGCTGGAAGTGGAAGTGGGATGG - Intergenic
1012660767 6:101887721-101887743 TGGGAGAGGGGGAAGGGGGAAGG + Intronic
1012740391 6:103008868-103008890 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1013113792 6:107085404-107085426 TTCTGGCAGGGGGAGGGGAAAGG + Intronic
1013269635 6:108534005-108534027 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
1013269647 6:108534061-108534083 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
1013368955 6:109454366-109454388 TGCTGGCAGGGGAATGGGCTGGG - Intronic
1013422258 6:109977982-109978004 AGCTGGGAGGGGAGGGGTGAAGG - Intergenic
1013943914 6:115699377-115699399 AGCTGGAAGGGGATGGGTGATGG - Intergenic
1014125842 6:117776273-117776295 TGGAGGGAGGGGAAGGGGAATGG - Intergenic
1014976948 6:127898959-127898981 TGCTGGGAAGGGTAGTGGGAGGG + Intronic
1015113501 6:129619624-129619646 GACGGGAAGGGGATGGGGGAGGG + Intronic
1015254651 6:131164407-131164429 TGCTGAGAGAGGAAGGGAGATGG + Intronic
1015295603 6:131588675-131588697 TACTGGGAGGGGTAGGAGGATGG + Intronic
1015566175 6:134573852-134573874 TGCTTGCAGGGGACGGGGAAGGG + Intergenic
1015575348 6:134665427-134665449 TGTTAGAAGGGGGAGGGGGAAGG + Intergenic
1015638640 6:135306201-135306223 TGCTGGTAGGTGAGTGGGGATGG + Intronic
1015693587 6:135955275-135955297 TACGGGAAGGGGAAGGGGAAGGG + Intronic
1015730476 6:136341894-136341916 TGCTGGAGGGGGAAGGTACAGGG - Intergenic
1015886809 6:137926162-137926184 AGCTGGAGGGAAAAGGGGGATGG + Intergenic
1016057348 6:139592620-139592642 TGCTGAAAGGTGAAGGTTGAAGG + Intergenic
1016074319 6:139778001-139778023 TAATGGAAGGGGAGGGGGCAAGG + Intergenic
1016758874 6:147716071-147716093 TCCTGGGAGTGGAAGGGGGCAGG - Intronic
1017105139 6:150880256-150880278 GGCTGGAGAGGGATGGGGGAGGG - Intronic
1017237496 6:152131960-152131982 TGCTGGGAGGGGATGTGGCAGGG + Intronic
1017259668 6:152371668-152371690 AGAGGGGAGGGGAAGGGGGAGGG + Intronic
1017946318 6:159099129-159099151 TGCTGGAAGTGGGAGAAGGAAGG + Intergenic
1018083514 6:160278928-160278950 TGAGGAACGGGGAAGGGGGAAGG - Intergenic
1018461673 6:164004704-164004726 GGAGGGAAGGGGGAGGGGGAGGG + Intergenic
1018890195 6:167977304-167977326 TGTGGGAGGGGGGAGGGGGAAGG - Intergenic
1019043493 6:169125158-169125180 AGCTGGAAGGGGGATGGGGTGGG - Intergenic
1019159077 6:170057617-170057639 AGGGGGAAGGGAAAGGGGGAGGG - Intergenic
1019159101 6:170057664-170057686 AGGGGGAAGGGAAAGGGGGAGGG - Intergenic
1019316254 7:388342-388364 TGCAGGAAGGTGGACGGGGAGGG - Intergenic
1019319403 7:408799-408821 GGCTGGAACAGGAAGGGCGAGGG + Intergenic
1019472027 7:1226123-1226145 AGGAGGAAGGGGAAGGGAGAAGG + Intergenic
1019619963 7:1987135-1987157 AGCTGGCAGGGGAGGGGTGAGGG - Intronic
1019832733 7:3349381-3349403 AACTGGAAGGGGAATGGGGCTGG + Intronic
1020283556 7:6663819-6663841 AGGTGGGAGGTGAAGGGGGAGGG + Intergenic
1020446604 7:8275435-8275457 TGGTGGAAGTGGAAAAGGGAGGG - Intergenic
1020485524 7:8715295-8715317 TGCTGTGAGGGGATGGGGTAAGG + Intronic
1020667783 7:11069321-11069343 TTCTGGAAGGGAGATGGGGAAGG + Intronic
1021179942 7:17494652-17494674 AGCTGGAAGGGGAATGGAGTGGG - Intergenic
1021680037 7:23120986-23121008 GGCTGGAAAGGGTAGAGGGAAGG - Intronic
1021781530 7:24111589-24111611 TGCTGAAGTGGGAAGGGTGACGG - Intergenic
1022145387 7:27533467-27533489 TGCGGGTGGGGGCAGGGGGAGGG - Intronic
1022616689 7:31938415-31938437 AGCTGGAAGGGGTGGGGGGCTGG + Intronic
1022645433 7:32224927-32224949 CTCTGGAAGGGGATGGGAGAAGG + Intronic
1022872643 7:34495385-34495407 TGCTGGGAGGTGAAGGAGGATGG - Intergenic
1023464826 7:40442863-40442885 TGGTGTGGGGGGAAGGGGGAGGG - Intronic
1023844081 7:44111431-44111453 CCCTGGAAGTGGAAGGGGCATGG + Intronic
1023889282 7:44381122-44381144 TGTTGGATGGGGAAGGCAGAGGG - Exonic
1023974144 7:45015444-45015466 TCCAGGAAGGGGAAGGGGAAGGG - Intronic
1024369243 7:48560384-48560406 TGCTGCAGGGGTATGGGGGAGGG + Intronic
1024542674 7:50491809-50491831 AGCTGGAGGGGAAAGAGGGAGGG - Intronic
1024574703 7:50754343-50754365 TGCTGTGAGGAGAAGGGTGAAGG + Intronic
1024594515 7:50920847-50920869 GGCAGGGAGGGGAAGGGGGAAGG - Intergenic
1025121597 7:56308695-56308717 TGGTGTAGGGGGAAGGGGGGAGG - Intergenic
1025257775 7:57397245-57397267 GGAAGGAAGGGGAAGGGGAAGGG - Intergenic
1025777360 7:64570516-64570538 AGGGGGAGGGGGAAGGGGGAGGG + Intergenic
1026106683 7:67426926-67426948 AGGGGGAAGGGGAAGGGGAAGGG - Intergenic
1026112435 7:67469139-67469161 TGAGGGAAGGGGAAGGGAAAGGG - Intergenic
1026197555 7:68186065-68186087 TGCTGGAAGGGTGGGGGGGTGGG - Intergenic
1026501759 7:70948684-70948706 TGGTGGAAGGTGAAGGGGGCCGG - Intergenic
1026780204 7:73261249-73261271 GGCTGGAAAGAGAAGGGGAAGGG - Intergenic
1026877612 7:73888381-73888403 GGCTGGACTGGGCAGGGGGAGGG + Intergenic
1026894707 7:74003322-74003344 TTCTGGAAGGGGTAGGGGTGTGG - Intergenic
1026894741 7:74003477-74003499 TTCTGGAAGGGGTAGGGGTGTGG - Intergenic
1027021062 7:74814667-74814689 GGCTGGAAAGAGAAGGGGAAGGG - Intronic
1027066964 7:75131257-75131279 GGCTGGAAAGAGAAGGGGAAGGG + Intronic
1027148547 7:75715892-75715914 AGGCGGAAGGGGAAGGGGAAGGG + Intronic
1027941789 7:84691518-84691540 TGGTGGAAGGTGAAGGGGAGCGG - Intergenic
1027953420 7:84849291-84849313 TGGTGAAAGGGTAAAGGGGAAGG - Intergenic
1028042341 7:86069861-86069883 GGCTGGAGGTGGAAGGGGGATGG - Intergenic
1028306244 7:89269204-89269226 TGGGGTAGGGGGAAGGGGGAGGG - Intronic
1028366835 7:90041977-90041999 TGTGGGATGGGGCAGGGGGAGGG - Intergenic
1028412113 7:90541086-90541108 TGATGGAAGGGAAATGGAGACGG - Intronic
1029457007 7:100676394-100676416 TGTTGGTGGGGGAAGGGGGAGGG + Intronic
1029483598 7:100826819-100826841 TGCTGGAACGGGAGGGGGGCGGG - Intronic
1029546364 7:101212440-101212462 TGCAGGAAGGAGATGGGGGTGGG + Intronic
1029873616 7:103723251-103723273 TGCTGGGAGGGGTACGGGGAGGG + Intronic
1029952414 7:104601202-104601224 TGCTGGAAGATGAAGGGGGAAGG + Intronic
1030413277 7:109209661-109209683 TGTTGGCAGGGGCAGGAGGAGGG - Intergenic
1030902399 7:115140615-115140637 TCGTGGAAGGGGAAGGAGAACGG - Intergenic
1031243877 7:119281705-119281727 TGCTGCCAGGGGATGGGGAAAGG + Intergenic
1031937776 7:127753475-127753497 TGGTGGCAGGGGAAGAGGAAAGG - Intronic
1032059832 7:128715275-128715297 TGCAGGAAGGGGAAGTGCAAAGG - Intronic
1032138919 7:129308430-129308452 TGCTGCCAGGGGATGGGAGAGGG + Intronic
1032263786 7:130356471-130356493 TGGGGGAAGGGGATGGGTGACGG - Intronic
1032436212 7:131902382-131902404 TAGTGGAAGGGGAAGGGAAAGGG - Intergenic
1032445413 7:131978486-131978508 TGGGGGGGGGGGAAGGGGGAGGG - Intergenic
1032506098 7:132435767-132435789 TGTAGGAAGGGGAAGGGAGATGG - Intronic
1032589210 7:133176936-133176958 CGTGGGAAGGGGGAGGGGGAGGG - Intergenic
1032796940 7:135285261-135285283 AGCTGGATGGGCAAGGAGGAGGG + Intergenic
1033045969 7:137962450-137962472 TCAGGGAAGGGGAAGGAGGATGG - Intronic
1033052015 7:138014247-138014269 TGGTGGAAGGGGAAGCAGGCAGG + Intronic
1033053691 7:138030297-138030319 GGCTGGAGGGGAAAGAGGGAGGG - Intronic
1033184184 7:139210862-139210884 TGGTGGAAGGTGAAGGAGGAAGG + Intergenic
1033431240 7:141291624-141291646 TGGTGGATGGGGAAGGAGTAAGG - Intronic
1033804359 7:144937518-144937540 AGGGGGAAGGGGAAGGGGAAAGG - Intergenic
1033804365 7:144937531-144937553 AGGGGGAAGGGGAAGGGGGAAGG - Intergenic
1033804372 7:144937544-144937566 AAAGGGAAGGGGAAGGGGGAAGG - Intergenic
1033804404 7:144937635-144937657 GGAAGGAAGGGGAAGGGGAAAGG - Intergenic
1033821021 7:145134215-145134237 TGGTGGAAGGCGAATGAGGAGGG - Intergenic
1033908242 7:146233606-146233628 TGGTGTGGGGGGAAGGGGGAGGG - Intronic
1033973892 7:147075772-147075794 TGGGGTAGGGGGAAGGGGGAGGG - Intronic
1034173996 7:149086329-149086351 TGATGGAAGGTGAAGGGGGCTGG + Intronic
1034308629 7:150067793-150067815 TGGTGGGGGGGGATGGGGGATGG + Intergenic
1034584619 7:152078173-152078195 TCCTAGAAGGAGAAGAGGGAGGG + Intronic
1034720400 7:153286935-153286957 TGCGGGTGGGGGACGGGGGACGG - Intergenic
1035410559 7:158637397-158637419 TGCTGGAAGGTCACTGGGGAAGG + Intronic
1035911145 8:3567513-3567535 AGGGGGAAGGGGATGGGGGAGGG + Intronic
1036117832 8:5979331-5979353 TGTTGGCAGGGCAAAGGGGAGGG - Intergenic
1036470403 8:9047737-9047759 TGTTGGAAGGGGAGAGGGGAGGG - Intronic
1036505035 8:9347450-9347472 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
1036633691 8:10532791-10532813 TGAAGGAAGGGGATGGGGGCTGG + Intronic
1036658897 8:10695083-10695105 GGCTGGATGGGGGAGGGGAAGGG + Intronic
1036723434 8:11200041-11200063 TGCAGGAGGGGGAAGGGGCGTGG + Intronic
1036760108 8:11502858-11502880 CGGTGGCAGGGGAAGGGGGGTGG + Intronic
1037732507 8:21539535-21539557 TGTTGGAGGGGGAGGGGGGAGGG + Intergenic
1037862476 8:22415748-22415770 TGCTGGAAGGGTGACAGGGAGGG - Exonic
1037900082 8:22682984-22683006 TGGAGGAAGGGGACGGGGTAAGG + Intergenic
1037946607 8:22993506-22993528 TGCTGGAAGGGACAGGAAGAAGG + Intronic
1037980449 8:23249776-23249798 AGCTGGAAGGGGAAAGGGCACGG - Intronic
1038155468 8:24985231-24985253 GGCTGGATTGGGATGGGGGAGGG + Intergenic
1038265994 8:26040477-26040499 TGCTGGGAGGGGGACGTGGAGGG + Intronic
1038384749 8:27132524-27132546 TGTTTGCAGGGGAATGGGGAGGG - Intergenic
1039127627 8:34220915-34220937 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
1039385653 8:37133572-37133594 TGCTGGAATGGGGAGAGGGAAGG + Intergenic
1039385860 8:37135036-37135058 TGCTGGAATGGGGAGTGGGAAGG - Intergenic
1039421073 8:37441234-37441256 TGCTGCCTGGGGATGGGGGAGGG + Intergenic
1039447716 8:37646084-37646106 TGCTGGAGGGAGAGGGAGGACGG + Intergenic
1039459810 8:37734821-37734843 TGTGGGAAGGGGAGGGGAGACGG + Exonic
1039564662 8:38542490-38542512 GGAGGGGAGGGGAAGGGGGAGGG - Intergenic
1040533367 8:48283716-48283738 TGCTGGAAGAAGAAGCAGGAGGG + Intergenic
1040777448 8:51063011-51063033 TGGGGGAGGGGGAGGGGGGAGGG + Intergenic
1040852400 8:51914577-51914599 AACAGGAAGGGGAAGGGGAAGGG - Intergenic
1041174761 8:55183944-55183966 AGCTGGCAGGGGGAGGGGAAAGG - Intronic
1041284837 8:56249557-56249579 AGGAGGAAGGGGAAGGGGAAGGG - Intergenic
1041366608 8:57112724-57112746 TGCTGGAAGGGGAAAATAGAAGG + Intergenic
1041724998 8:61010031-61010053 GGCTGGGATGGGAATGGGGAGGG + Intergenic
1041823150 8:62062748-62062770 TGCTGCCAGGGGGTGGGGGAAGG - Intergenic
1041910813 8:63086481-63086503 TGATGGAAGGAGAAGGGAGAGGG - Intergenic
1041962343 8:63632998-63633020 TGAGGGGAGGGGAAGGGGGAGGG + Intergenic
1042190282 8:66178831-66178853 AGGAGGAAGGGGAAGTGGGAAGG + Intergenic
1042207946 8:66347826-66347848 TGCTGCAGGGGAGAGGGGGAGGG - Intergenic
1043214871 8:77573595-77573617 TGCTGCCAGGGGATGGAGGAAGG - Intergenic
1043371265 8:79595798-79595820 TGCTGGAAGGGGAATGCAGATGG + Intergenic
1043393332 8:79812289-79812311 TCCTGGAAGGGAGAAGGGGAAGG + Intergenic
1043428743 8:80173982-80174004 AGCAGGAATGGGAAGGGTGAAGG - Intronic
1043431810 8:80202102-80202124 GGAGGGGAGGGGAAGGGGGAGGG + Intronic
1043751967 8:83948910-83948932 GGAAGGAAGGGGAAGAGGGAAGG + Intergenic
1043823620 8:84898717-84898739 TGCCTGAAGGGTAAGGGTGAGGG + Intronic
1043938288 8:86167979-86168001 AAGGGGAAGGGGAAGGGGGAGGG + Intergenic
1044115545 8:88328848-88328870 GGCTGAAAGAGGAAGGGGGAAGG + Intergenic
1044254111 8:90039619-90039641 TGCTGCAAGAGGCAGGGGAAAGG - Intronic
1044413370 8:91909747-91909769 TGCTGGAAGAGGAGGAGGAAGGG + Intergenic
1044812360 8:96076401-96076423 TGGGGTAGGGGGAAGGGGGAAGG + Intergenic
1045035899 8:98176264-98176286 GGCTGGAGTGGGATGGGGGAAGG + Intergenic
1045247197 8:100453397-100453419 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
1045247236 8:100453594-100453616 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
1045290001 8:100824966-100824988 AGGTGGAAGGGGAAGGATGAAGG - Intergenic
1045481688 8:102597849-102597871 TGGTGGAAGGGGAAGAGGCATGG + Intergenic
1045722817 8:105133729-105133751 AGTGGGAAGGGGAAGGGGAAAGG - Intronic
1045824432 8:106380110-106380132 TGGGAGAAGGGGAAGGGGAATGG - Intronic
1045960065 8:107956707-107956729 TGCTGGAAGAGGAATGGGGGAGG + Intronic
1046318399 8:112537019-112537041 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1046766346 8:118074144-118074166 TGCGGGGACGGGGAGGGGGAGGG + Intronic
1047521632 8:125599488-125599510 AGGTGGAAGGCCAAGGGGGAAGG - Intergenic
1048151588 8:131900386-131900408 TGGTGGAAGGGGAAGGGAGGAGG + Intergenic
1048237622 8:132707295-132707317 TGTTGGAAGGGGCAGCTGGAGGG + Intronic
1048628166 8:136210019-136210041 TGGTGCAAGGAGAAGGGGGTTGG - Intergenic
1048720836 8:137322502-137322524 AGCTGGATGGGGAAGGTTGAAGG + Intergenic
1048799325 8:138181587-138181609 AACTGGAAGGTGACGGGGGAAGG - Intronic
1048944110 8:139428638-139428660 TGCAGGAAGGGGAGAGGAGAGGG - Intergenic
1049093182 8:140532326-140532348 TTCTGGAAGGGGAAGGGGCAGGG - Intronic
1049153822 8:141055137-141055159 TGGTGGAAGGGGAGTGTGGAAGG - Intergenic
1049294091 8:141820865-141820887 TGCTTGAATGTGTAGGGGGAAGG - Intergenic
1049359557 8:142205810-142205832 GGATGTGAGGGGAAGGGGGAAGG + Intergenic
1049392936 8:142381410-142381432 TGCTGGAAGGGGGAGGCCGGAGG - Intronic
1049575281 8:143386972-143386994 TGGTGGAAGGGGACGGTGGTTGG - Intergenic
1049615371 8:143573539-143573561 TGGTGGAAGCGGAAGCGGGCAGG - Intergenic
1049712396 8:144071232-144071254 AGGGGGGAGGGGAAGGGGGAGGG - Intergenic
1049738432 8:144222300-144222322 TGATGGAAGTGGATGGAGGAGGG + Intronic
1049745212 8:144260378-144260400 GGCTGGTTGGGGCAGGGGGAGGG + Intronic
1049772782 8:144391481-144391503 TGCTGGCCGGGGAAGGGGTGGGG - Intronic
1049773354 8:144393795-144393817 GGCTGGCAGGGGTAGGGTGAGGG + Exonic
1050090872 9:2015957-2015979 AGTTGGAAGGGGAACGGGAAAGG + Intronic
1050203486 9:3173894-3173916 TCGTGGAAGGAGAAGGAGGAGGG + Intergenic
1050237988 9:3603135-3603157 TGCAGGAAGAGGAAGGAGAATGG - Intergenic
1050285252 9:4095181-4095203 GGCTGGGAAGGGTAGGGGGAAGG - Intronic
1050672225 9:8010467-8010489 GGCTGAAAGGACAAGGGGGACGG + Intergenic
1050721829 9:8600042-8600064 TGCAGCCAGGGGATGGGGGAGGG - Intronic
1051281568 9:15446654-15446676 GGCTGAAAGGGGAGAGGGGAAGG + Intronic
1051297746 9:15614844-15614866 AGTTAGATGGGGAAGGGGGAAGG - Intronic
1051362071 9:16289812-16289834 AGCTGAATGGGGAAGTGGGAGGG + Intergenic
1051414230 9:16821848-16821870 TTCTGGAAGGCCAAGGCGGACGG + Intronic
1051500841 9:17776101-17776123 TGCTGGAAGAGCAAGGATGAGGG - Intronic
1051692428 9:19729707-19729729 GGCTGGATAGGGAAGGAGGAAGG + Intronic
1051735113 9:20189924-20189946 TGCTGGGAGGGGAGGGGAGATGG + Intergenic
1051923243 9:22292467-22292489 GGCTGGAAAGGTAATGGGGATGG - Intergenic
1051977046 9:22963045-22963067 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1051989514 9:23135215-23135237 GGCTGGGAGGAGAAGGGGCAGGG - Intergenic
1051991284 9:23154990-23155012 TGCTGCAGGGGGATGGGAGAGGG + Intergenic
1052851450 9:33380826-33380848 TGCTGGAATGGAAAGAGGAAAGG - Intergenic
1052951816 9:34219732-34219754 GGAGGGGAGGGGAAGGGGGAGGG - Intronic
1053104004 9:35395014-35395036 TGCTTGAAAAGGAAGGAGGAGGG + Intronic
1053119930 9:35538846-35538868 TGCTGCTAAGGGAAGGGGGAAGG - Exonic
1053233819 9:36434323-36434345 TGGGGGAAGGAGGAGGGGGAGGG + Intronic
1053337265 9:37286890-37286912 GGAGGGAAGGGGGAGGGGGAGGG - Intronic
1053343769 9:37362796-37362818 TGGTGGGACGGGAAGGGTGAAGG - Intergenic
1053413455 9:37930434-37930456 TGCAGGGAGGGGAGAGGGGAAGG + Intronic
1053605325 9:39652531-39652553 TACTGGAAGGGGCAGGAGGGAGG - Intergenic
1053863240 9:42409158-42409180 TACTGGAAGGGGCAGGAGGGAGG - Intergenic
1054248218 9:62689885-62689907 TACTGGAAGGGGCAGGAGGGAGG + Intergenic
1054450663 9:65401992-65402014 GGGAGGGAGGGGAAGGGGGAGGG + Intergenic
1054451677 9:65406677-65406699 AGCTGGAAGGGGCACAGGGAAGG + Intergenic
1054562333 9:66724410-66724432 TACTGGAAGGGGCAGGAGGGAGG + Intergenic
1054714491 9:68543463-68543485 TCCAGGAAGTGGCAGGGGGATGG + Intergenic
1054775568 9:69121379-69121401 GGCGGGGAGGGGAAGGGGGTGGG - Intronic
1054809255 9:69421910-69421932 TGCGGGAAGTGGAAGGCGGAAGG - Intergenic
1054884207 9:70178305-70178327 TGGTGGAAGGGGCAGAGAGAGGG + Intronic
1055426826 9:76205226-76205248 AGCTGGAAGCGGGAGGTGGAGGG - Intronic
1055758001 9:79574725-79574747 TTATGGAAAGGGAAGGGGAAAGG - Intronic
1055768826 9:79694101-79694123 TGCTGGCAGGGCAAGGGCGGAGG + Intronic
1056019799 9:82430115-82430137 TGCTGGAAGAGGAGTGGGGGAGG + Intergenic
1056096005 9:83254115-83254137 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1056530472 9:87482512-87482534 GGAGGGGAGGGGAAGGGGGAAGG + Intergenic
1057072039 9:92106915-92106937 TGCTGGAAGAGGAGGAGGGGAGG - Intronic
1057120452 9:92568226-92568248 TGCGGTGGGGGGAAGGGGGAAGG - Intronic
1057629579 9:96708496-96708518 TGCTGGAAAGAGAAGAGGGAGGG - Intergenic
1057942404 9:99296602-99296624 TGGCGGAAGTGGAAGGGGGCGGG - Intergenic
1058049452 9:100392201-100392223 AGAGGGAGGGGGAAGGGGGATGG - Intergenic
1058554651 9:106153871-106153893 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1058983856 9:110194324-110194346 TGCTGGAGGGGAAAAAGGGAGGG + Intronic
1059340015 9:113592371-113592393 TGCTGGAAGTGGGAGGTGTAGGG + Intronic
1059552768 9:115246195-115246217 TGAGGGGAGGGGAAAGGGGATGG - Intronic
1059688803 9:116663602-116663624 TGCTGCTAGGGGCAGGGAGAAGG + Intronic
1059889588 9:118786548-118786570 TGGTGGCAGGAGAAGGGGGTTGG + Intergenic
1059949275 9:119445215-119445237 AGGGGGAGGGGGAAGGGGGAGGG - Intergenic
1060057865 9:120431112-120431134 TGGGGTGAGGGGAAGGGGGAGGG + Intronic
1060106042 9:120874166-120874188 GGCTAGAAGGGGAAGAAGGATGG + Intronic
1060121407 9:120993884-120993906 TGGAGGAAGGGGAATGGGAATGG + Intronic
1060124038 9:121024300-121024322 AGCGGGAGGGGGGAGGGGGAGGG + Intronic
1060124071 9:121024355-121024377 AGCGGGAGGGGGGAGGGGGAGGG + Intronic
1060149029 9:121275605-121275627 TGGTGGGAGGGGAGGTGGGAGGG - Intronic
1060163935 9:121392976-121392998 TGGGGGAAGGGGAAGGGGAAGGG + Intergenic
1060190330 9:121588549-121588571 GGGTGAAGGGGGAAGGGGGAAGG + Intronic
1060205972 9:121683076-121683098 TCCTGGAAGGGAAGGAGGGAAGG + Intronic
1060219502 9:121756916-121756938 TGCTGGAAGGGGCACGGCCAGGG + Intronic
1060358360 9:122931498-122931520 TCCGGGAAGGGGGAGGGGCAAGG + Exonic
1060563738 9:124570235-124570257 GGCTGGAGGGGAAAGGGGAAAGG - Intronic
1060587360 9:124795003-124795025 AGCTGCCCGGGGAAGGGGGATGG - Exonic
1060834650 9:126745963-126745985 TGATGCCAGGGGATGGGGGAAGG + Intergenic
1060960962 9:127680396-127680418 TGCTGGAGGGGGAAGGGCCGTGG - Intronic
1060967669 9:127720871-127720893 GGGAGGAAGGGGAAGGGGGAGGG - Intronic
1061233473 9:129328444-129328466 CCCTGGAAGGGGAGGGAGGAAGG + Intergenic
1061242144 9:129380987-129381009 TGCTGGAGGTGGGAGGGGCAGGG - Intergenic
1061251473 9:129428871-129428893 GGGTGGAAGGGGAAGGAGGGTGG - Intergenic
1061308487 9:129746731-129746753 AGCTTGAAGGGGAAGTGGGGAGG - Intronic
1061331885 9:129899794-129899816 GGAAGGAAGGGGAAGGGGAAGGG + Intronic
1061360433 9:130138486-130138508 GAGCGGAAGGGGAAGGGGGAGGG - Exonic
1061741629 9:132710840-132710862 GAAGGGAAGGGGAAGGGGGAAGG - Intergenic
1061749651 9:132769062-132769084 TGCTAGGAGGGGAAATGGGAGGG + Intronic
1061860262 9:133464329-133464351 TGGTGGATAGGGAAGGGGGATGG + Intronic
1061875358 9:133540854-133540876 TGCAGGAAGGGAGAGGGAGAGGG - Intronic
1061942643 9:133891650-133891672 GGATGGAGGGGGAAGCGGGAGGG + Intronic
1062050630 9:134444725-134444747 AGAAGGAAGGAGAAGGGGGAAGG - Intergenic
1062053583 9:134459388-134459410 TGCTGCAGGGAGAAGAGGGAAGG - Intergenic
1062096450 9:134706314-134706336 TGCAGGAAGGGGAAGGCAGAGGG + Intronic
1062143736 9:134976726-134976748 TGGGGGAGGGGGAAGGGGGAGGG - Intergenic
1062225268 9:135446675-135446697 GGCTGGCAGGGGTGGGGGGAGGG + Intergenic
1062225339 9:135446862-135446884 GGCTGGCAGGGGTGGGGGGAGGG + Intergenic
1062225376 9:135446956-135446978 GGCTGGCAGGGGTGGGGGGAGGG + Intergenic
1062225447 9:135447143-135447165 GGCTGGCAGGGGTGGGGGGAGGG + Intergenic
1062229364 9:135472873-135472895 TGTTAGAAAGGGAAGGGAGATGG - Intergenic
1062523749 9:136970070-136970092 TCCAGGATGGGGAAGGAGGAAGG + Intronic
1062593604 9:137287200-137287222 GGCTGGAAAGGGAACGGGGATGG + Intergenic
1202793976 9_KI270719v1_random:104217-104239 TTCTGGAAGGGGGAGGCTGAGGG + Intergenic
1203465942 Un_GL000220v1:87046-87068 TGTTGGGGGGGGAGGGGGGAGGG + Intergenic
1185540493 X:899405-899427 AGGAGGAAGGGGAAGGGGAAGGG - Intergenic
1185550526 X:980193-980215 GGCTGCAAGGGGGAGGAGGAGGG + Intergenic
1185581247 X:1212987-1213009 AGAGGGGAGGGGAAGGGGGAGGG - Intergenic
1185581350 X:1213202-1213224 GGGAGGAAAGGGAAGGGGGAGGG - Intergenic
1185615737 X:1420656-1420678 TTCTGGGCGGGGAAAGGGGAAGG + Intronic
1185640510 X:1587844-1587866 GGAGGGGAGGGGAAGGGGGAGGG - Intergenic
1185640994 X:1588862-1588884 TGGAGGAAAGGGGAGGGGGAGGG - Intergenic
1185756639 X:2659146-2659168 GGAGGGGAGGGGAAGGGGGAAGG - Intergenic
1185756923 X:2659753-2659775 AGGGGGAAGGGGAGGGGGGAGGG - Intergenic
1186014353 X:5174403-5174425 TGGTGTAAGGGAAAGGGGAAGGG + Intergenic
1186108609 X:6231589-6231611 TGCAGGAGGCTGAAGGGGGAAGG + Intergenic
1186149339 X:6657652-6657674 GGATGGAAGGGGAAGGGAGCTGG - Intergenic
1186229811 X:7441005-7441027 TGCCGGGAAGGGAAGGGGGAAGG + Intergenic
1186293219 X:8121840-8121862 TGGGGGAGGGGGAGGGGGGAGGG - Intergenic
1187023826 X:15411781-15411803 TGGTGGAAGGAGGAGCGGGAGGG - Intronic
1187045982 X:15647540-15647562 AGGGGGGAGGGGAAGGGGGAGGG + Intronic
1187051961 X:15703842-15703864 AGGGGGGAGGGGAAGGGGGAGGG + Intronic
1187228997 X:17403145-17403167 TGCTGGATGGGGAAAGAGAATGG + Intronic
1187301760 X:18057809-18057831 TGCTGGAAGCAGAAAGGGGATGG - Intergenic
1187348355 X:18488568-18488590 TTCTGGGAGGGGAAAAGGGAAGG + Intronic
1187367254 X:18675497-18675519 TGCGGGAAGGGGCAGGGGAGCGG - Intergenic
1187528515 X:20075425-20075447 TGCTGCATGGGGGTGGGGGATGG + Intronic
1187805030 X:23110432-23110454 TTGTGGGAGGGAAAGGGGGAGGG - Intergenic
1187882887 X:23862878-23862900 GGATGGAAGGGGAGGGAGGAGGG + Intronic
1187948644 X:24450801-24450823 GGGAGGAAGGGAAAGGGGGAGGG + Intergenic
1188110053 X:26186194-26186216 TGGGGTAAGGGGAGGGGGGAGGG + Intergenic
1188335065 X:28921510-28921532 GGGAGGAAGGGGAAGAGGGAGGG - Intronic
1188360912 X:29252115-29252137 TGGGGTAAGGGGAGGGGGGAGGG + Intronic
1188478278 X:30610598-30610620 GGCTGGAGGGGAAAGAGGGAGGG - Intergenic
1188513346 X:30959897-30959919 TGGTAGAAGGTGAAGGGGAAGGG + Intronic
1188676098 X:32941647-32941669 TACTAGAAGGGGAAGGAGGGAGG + Intronic
1188839018 X:34991966-34991988 TGGGGTAAGGGGAGGGGGGAGGG + Intergenic
1189076844 X:37925020-37925042 GGCTGGGAAGGGTAGGGGGAGGG - Intronic
1189208271 X:39260668-39260690 AGGTGTAAGGGGAAGGGGCATGG - Intergenic
1189285000 X:39845759-39845781 GGCTGGACTGGGAAGGGGAAGGG - Intergenic
1189385229 X:40531553-40531575 TGGAGGAAGGGGAAGGGGGTTGG + Intergenic
1189777392 X:44482689-44482711 TGCTGGAGGGGGAAGACAGAAGG - Intergenic
1190325507 X:49204832-49204854 TGGAGGAGGGGGGAGGGGGAGGG - Intergenic
1190801882 X:53796710-53796732 TGAAGTAAGGGGAAGGTGGAGGG - Intergenic
1190976101 X:55402504-55402526 TGGGGTCAGGGGAAGGGGGAGGG + Intergenic
1191039844 X:56067729-56067751 TGTAGGAGGGGGACGGGGGAAGG - Intergenic
1191182283 X:57576437-57576459 TACTAGAGGGGGACGGGGGAGGG + Intergenic
1191184696 X:57596716-57596738 TGCAGGAAAGGGAGGGGAGAGGG - Exonic
1191215279 X:57927072-57927094 TACTAGAGGGGGACGGGGGAGGG - Intergenic
1191646390 X:63486102-63486124 TGAGAGAAGGGGGAGGGGGAGGG + Intergenic
1191766028 X:64699156-64699178 TGGTGGGAGGGAAATGGGGATGG - Intergenic
1191996439 X:67100733-67100755 TGCTGTAAGGTGCAGGAGGAAGG + Intergenic
1192029638 X:67495485-67495507 TGGCAGAAGGGGAAGGGGAAGGG - Intergenic
1192249182 X:69397034-69397056 TCCACGAAGGGGGAGGGGGAGGG - Intergenic
1192287126 X:69750158-69750180 TGGGGGGAGGGGGAGGGGGAGGG - Intronic
1192291709 X:69803810-69803832 GGCTGGGAAGGGGAGGGGGAAGG - Intronic
1192430951 X:71111285-71111307 AGTGGGAAGGGCAAGGGGGAGGG - Intronic
1192624945 X:72716775-72716797 AGCTTGAAGGGGAGTGGGGAAGG - Intergenic
1192943607 X:75940009-75940031 TGAGGGATGGGGTAGGGGGAAGG - Intergenic
1193360249 X:80572501-80572523 TGGTGGAAGGAGAAGAGGGGCGG - Intergenic
1193595759 X:83442914-83442936 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1193624430 X:83799102-83799124 TGCTGAAAAGGGTAAGGGGAAGG + Intergenic
1193738654 X:85190969-85190991 TGGTGTAGGGGGAGGGGGGAGGG + Intergenic
1194348513 X:92796029-92796051 AGGGGGAAGGGGAGGGGGGAAGG + Intergenic
1194449246 X:94022832-94022854 TCCTGGAAGGAGAGTGGGGAGGG + Intergenic
1194913774 X:99679700-99679722 TGATGGAAGGTAAAGAGGGAAGG + Intergenic
1195090246 X:101451431-101451453 TGCTGCCAGGAGATGGGGGAAGG + Intronic
1195270176 X:103221030-103221052 TGGTGGTTGGGGAAGGGGGCGGG - Intergenic
1195275432 X:103276292-103276314 TGCGGGGCGGGGAGGGGGGAGGG - Intronic
1195276881 X:103289879-103289901 TGCTGGATGGGGCTGGGGGGAGG - Intergenic
1195282329 X:103348318-103348340 CGCTGGAAGGGGAAGGGGCCGGG - Intergenic
1195306114 X:103585667-103585689 TGGCGGAAGGGGAACGGGTACGG + Intronic
1195433004 X:104810264-104810286 TGGGGTGAGGGGAAGGGGGAGGG + Intronic
1195501959 X:105612645-105612667 TGCTGTCAGGGGATGGGGGAGGG - Intronic
1195596087 X:106691522-106691544 GGCTGGGAAGGGAAGGAGGAGGG - Intergenic
1195612578 X:106884892-106884914 GGCTGGAAAGTGTAGGGGGAGGG + Intronic
1195696227 X:107669602-107669624 AGGAGGAGGGGGAAGGGGGATGG - Intergenic
1195735374 X:108007483-108007505 TACTGGAGGGGAAAGGAGGAAGG + Intergenic
1196007343 X:110850636-110850658 GGCTGGAGGTGGAAGGGGGATGG - Intergenic
1196171787 X:112596118-112596140 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
1196243143 X:113366770-113366792 TGCTGCCAGGGGAAGGGGAGAGG + Intergenic
1196316909 X:114237818-114237840 TGGGGTAAGGGGCAGGGGGAGGG - Intergenic
1196624029 X:117857248-117857270 GTCAGGAAGGGAAAGGGGGAAGG + Intergenic
1196806452 X:119591643-119591665 TGCTGGAAGGTGAAGTGGACTGG + Intronic
1196810513 X:119625487-119625509 AGCAGGAAGGGGAAGTGGGAAGG + Intronic
1197063628 X:122212843-122212865 TGGGGGAAGGGGAAGTGGGGAGG + Intergenic
1197164449 X:123361222-123361244 ACCTGGAAGGGGAAGAGAGAAGG - Intronic
1197316110 X:124967817-124967839 AGCAGGAAGGGTATGGGGGAAGG - Intergenic
1197342898 X:125294794-125294816 TCTTGGAAGGGGAAGGGAAAGGG - Intergenic
1197373953 X:125659269-125659291 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
1197457612 X:126697225-126697247 AGGGGGTAGGGGAAGGGGGAGGG + Intergenic
1197668280 X:129246839-129246861 TGGTGGGGGGGGAGGGGGGAGGG + Intergenic
1197730411 X:129804900-129804922 TTCTTGAAATGGAAGGGGGAAGG + Exonic
1197845818 X:130801260-130801282 TTATGGTGGGGGAAGGGGGAAGG + Intronic
1198115839 X:133543985-133544007 TTCTGGTAGGCCAAGGGGGATGG + Intronic
1198454586 X:136803879-136803901 AGCTGGAAAGGGAATGGGAAGGG + Intergenic
1198517826 X:137427060-137427082 GGGAGGAAGGGGATGGGGGAGGG + Intergenic
1198553101 X:137765072-137765094 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1198997151 X:142586048-142586070 GGGGGGAAGGGGGAGGGGGAAGG + Intergenic
1199381356 X:147176323-147176345 TGCTGGAGGGGAAAGAGGAAGGG + Intergenic
1199415097 X:147573368-147573390 TGCTGCCAGGGGATTGGGGAAGG - Intergenic
1199573746 X:149292878-149292900 TGCTGGAAAGGGGATAGGGAAGG + Intergenic
1199601992 X:149546532-149546554 CGCTGGGAGAGGCAGGGGGAGGG - Intronic
1199648396 X:149932952-149932974 CGCTGGGAGAGGCAGGGGGAGGG + Intronic
1199827630 X:151515832-151515854 TGGGGGAAGAGGATGGGGGAGGG - Intergenic
1199873964 X:151917994-151918016 TGCTGGTGGGGGATGGGGGCGGG - Intronic
1200068934 X:153518299-153518321 TGCGGGAAGGCGAGAGGGGAAGG - Intronic
1200091605 X:153638656-153638678 TCCTGGAAGGGGGACGGGGTGGG + Intergenic
1200155191 X:153971373-153971395 CGCTGGGCGGGGAAGCGGGACGG - Exonic
1200316421 X:155137283-155137305 TGAGGGGAGGGGGAGGGGGAGGG - Intronic
1200397738 X:156001119-156001141 TTCTAGACAGGGAAGGGGGATGG - Intronic
1201230140 Y:11856260-11856282 AGAGGGAAGGGGAAGGGGAAGGG + Intergenic
1201264243 Y:12190772-12190794 TGCAGGAAGGGGCAGGGGCTAGG - Intergenic
1201286021 Y:12379401-12379423 TGGTGGAAGGTGAAGGGAGCAGG + Intergenic
1201340237 Y:12925579-12925601 AGCTGGAAGGAGAAAGGGTAAGG + Intergenic
1201598226 Y:15696094-15696116 TGCTGGGAAGGGAAGGGAAAAGG + Intergenic
1201778209 Y:17689721-17689743 TGCGGTAGGGGGAGGGGGGAGGG - Intergenic
1201823347 Y:18216271-18216293 TGCGGTAGGGGGAGGGGGGAGGG + Intergenic
1201916308 Y:19185269-19185291 TGCAGTGGGGGGAAGGGGGAGGG - Intergenic
1202268687 Y:23048658-23048680 TGGGGGGAGGGGGAGGGGGAGGG - Intergenic
1202421679 Y:24682398-24682420 TGGGGGGAGGGGGAGGGGGAGGG - Intergenic
1202449107 Y:24987680-24987702 TGGGGGGAGGGGGAGGGGGAGGG + Intergenic