ID: 976576471

View in Genome Browser
Species Human (GRCh38)
Location 4:86677962-86677984
Sequence TGGGGCCATTTGCAGTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976576462_976576471 17 Left 976576462 4:86677922-86677944 CCAAAATGGATCCTAAAATAATT 0: 1
1: 0
2: 1
3: 28
4: 372
Right 976576471 4:86677962-86677984 TGGGGCCATTTGCAGTTGGTGGG 0: 1
1: 0
2: 3
3: 11
4: 170
976576463_976576471 6 Left 976576463 4:86677933-86677955 CCTAAAATAATTCTATTTCAGCA 0: 1
1: 0
2: 5
3: 36
4: 488
Right 976576471 4:86677962-86677984 TGGGGCCATTTGCAGTTGGTGGG 0: 1
1: 0
2: 3
3: 11
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976576471 Original CRISPR TGGGGCCATTTGCAGTTGGT GGG Intronic
902733201 1:18383501-18383523 TGGGGGAATCTGCAGATGGTGGG - Intergenic
907374517 1:54024841-54024863 TGGGGCCAATTGTAGGTGGAGGG - Intergenic
907978035 1:59452733-59452755 AGGGGCCACTTGCTGTTGGCCGG - Intronic
909191249 1:72555348-72555370 GGGCGACATTTGCAGTTGCTTGG + Intergenic
909607963 1:77525646-77525668 TGGGGCCAGTTGGAGGTGTTTGG - Intronic
910482794 1:87676654-87676676 TGGTGCCACCTGCACTTGGTGGG - Intergenic
913103629 1:115592764-115592786 TTGTGCCATTTGCAGTGGGGAGG + Intergenic
917185837 1:172354403-172354425 TGGTGCTATTTGCAGTGGGGAGG - Intronic
917211498 1:172636507-172636529 TCGTGCCATTTGCAGTGGGGAGG - Intergenic
917407799 1:174726702-174726724 TGGTGCCATCTGCTGTTTGTGGG + Intronic
918161244 1:181902090-181902112 TCGTGCCATTTGCAGTGGGGAGG + Intergenic
918871033 1:189975378-189975400 TGAGCCCTTTTACAGTTGGTGGG - Intergenic
921148869 1:212384475-212384497 TGGGCACAATTGCAGTTGGTGGG - Intronic
921254244 1:213325181-213325203 AGGAGCCATTTGCATTTGGTTGG + Intergenic
923654287 1:235901757-235901779 TTGGGCAATTGGGAGTTGGTTGG + Intergenic
1063753624 10:8980827-8980849 TGGGGCCATTTTCTTTAGGTGGG - Intergenic
1064819933 10:19317360-19317382 TGGGGCCACTGGGAGGTGGTTGG - Intronic
1065955356 10:30688910-30688932 TGAGGCCCTTTGGAGATGGTGGG - Intergenic
1069705247 10:70455444-70455466 TGGGGCCCTTTGATGTTAGTGGG - Intergenic
1070554057 10:77514554-77514576 TGTGGCCATTTTCAGTAGTTGGG - Intronic
1070825661 10:79388980-79389002 TGGGGCCAGCTGCAGGCGGTAGG - Intronic
1072286213 10:93917951-93917973 TGGGGGCATTTGGAGATGGGAGG + Intronic
1073186879 10:101620370-101620392 TGGAGGCATTTGCTTTTGGTGGG - Intronic
1073352719 10:102831292-102831314 AGGGTGAATTTGCAGTTGGTTGG + Intronic
1073484382 10:103807414-103807436 TGGGGCCAGGGGCAGCTGGTAGG - Intronic
1073695783 10:105865547-105865569 TGGGGCCATTTACAGTTGCTAGG - Intergenic
1073947793 10:108771341-108771363 TGTGGCTATTTGCATTTTGTGGG + Intergenic
1075509767 10:123062200-123062222 TTGGGCCATTTGCACTGGCTTGG + Intergenic
1075642419 10:124074375-124074397 TTGTGCCCTTTGCAGTTGGGTGG - Intronic
1075913248 10:126144652-126144674 TAGGGCCATTTGCAATTTGATGG + Intronic
1078680964 11:13475276-13475298 TCGTGCCTTTTGCAGTTGGGTGG - Intergenic
1078822657 11:14897615-14897637 AAGGGACATTTGCAGATGGTTGG + Intergenic
1082135934 11:48549022-48549044 TGGGGTCATTTTCAGAAGGTTGG + Intergenic
1083019288 11:59489984-59490006 TAGGTCCATTTGTAGGTGGTTGG - Intergenic
1084043121 11:66554153-66554175 TGGGGCCAGGTGCAGTGGCTGGG + Intronic
1086884569 11:92190288-92190310 TGGGGCCCCTTGGTGTTGGTGGG - Intergenic
1087258939 11:95989198-95989220 TGTGGTCATTTGCAGTCAGTTGG - Intronic
1088815114 11:113415383-113415405 TGGGGACCCTTGGAGTTGGTTGG + Intronic
1091388258 12:108925-108947 TGGGACCCTTTGCAGTTGCTGGG - Intronic
1092095292 12:5837171-5837193 TGGGTGCCTTTGCACTTGGTAGG - Intronic
1093585427 12:20829921-20829943 TGTGGCCATTTGGTTTTGGTGGG + Intronic
1096585712 12:52618323-52618345 TGTGGCCAGTGGCAGTGGGTGGG - Exonic
1096905640 12:54932844-54932866 TCGTGCCATTTGCAGTGGGGAGG - Intergenic
1098384960 12:69908917-69908939 TGGGGCCTTTTGAAGGTGGAGGG - Intronic
1100430301 12:94526271-94526293 TTGGGGCAGATGCAGTTGGTTGG - Intergenic
1102795917 12:115688708-115688730 TGGGGCCTTTTCCAGATGTTAGG - Intergenic
1102852396 12:116261086-116261108 TGGGGCCTTTGGCAGGTCGTGGG - Intronic
1102867413 12:116385041-116385063 GGGGTCCATTGGCAGCTGGTAGG + Intergenic
1103219656 12:119233011-119233033 TGGGGCTATTTCCAAGTGGTGGG - Intergenic
1105890183 13:24677074-24677096 AGGAGCCATTTGCACTGGGTGGG + Intergenic
1108815336 13:54283953-54283975 CTGGGCTTTTTGCAGTTGGTAGG + Intergenic
1113672759 13:112186093-112186115 TGGGGCCTTTAGGAGGTGGTAGG + Intergenic
1114774584 14:25466697-25466719 TCTGGCCATTTGCACTTGTTAGG - Intergenic
1115806836 14:37061266-37061288 TGGGACCAGTTGCTGTTCGTTGG - Intronic
1117685132 14:58245058-58245080 GTGGGCCATTTGCAGCTGTTTGG + Intronic
1117837488 14:59822139-59822161 TGGGGCCTTTTCTGGTTGGTAGG + Intronic
1117909702 14:60625216-60625238 TGGTGACATAGGCAGTTGGTGGG - Intergenic
1118989794 14:70787551-70787573 TGGGGCCCATTGCAGCAGGTGGG - Intronic
1119705598 14:76780962-76780984 AGAGGCCCTTTGCAGTTGCTGGG + Exonic
1120811577 14:88808917-88808939 TTGTGCCATTTGCAGGGGGTAGG - Intergenic
1121242378 14:92440079-92440101 TGGTGACATTTGCAGCTGGGAGG + Intronic
1122359065 14:101147899-101147921 TAGGGGCATTTTCTGTTGGTTGG + Intergenic
1124200438 15:27674523-27674545 TGGGGCCACTTGGAGGTGATGGG + Intergenic
1127684212 15:61325976-61325998 TGGGGCATTTAGTAGTTGGTTGG + Intergenic
1130336156 15:82958893-82958915 TGGGGGCACTTGCAGCTGGCTGG - Intronic
1131528417 15:93171482-93171504 TGGGGCCATTTAGAGGAGGTGGG + Intergenic
1131566078 15:93486669-93486691 TGGGGCCATTTGAAGAGGTTTGG + Intergenic
1133800051 16:9077943-9077965 TGGGACAATTTGAAGTTGGGGGG + Intergenic
1138442932 16:57046026-57046048 TGGGCCCATGTGCAGCTGGCTGG + Intronic
1141149021 16:81551579-81551601 TGGGGCCGTGTGCAGTATGTGGG + Intronic
1141224922 16:82105804-82105826 TGGGGCCTTTCACTGTTGGTTGG + Intergenic
1141890558 16:86924134-86924156 TGGGCGCATTTGCTGCTGGTGGG - Intergenic
1142121828 16:88390301-88390323 TGGGGCCCCTGCCAGTTGGTGGG - Intergenic
1143627004 17:8116270-8116292 TGGGGCCTTCTGCAGATGCTGGG - Intronic
1143653508 17:8279133-8279155 TGGGGCCATGTGCTGTTAGCTGG + Intergenic
1144620165 17:16813578-16813600 GGGGGACCTCTGCAGTTGGTTGG + Intergenic
1144892521 17:18502124-18502146 GGGGGACCTCTGCAGTTGGTTGG - Intergenic
1145796171 17:27656515-27656537 GGGGGACCTCTGCAGTTGGTTGG - Intergenic
1145810620 17:27761838-27761860 GGGGGACCTCTGCAGTTGGTTGG - Intronic
1146277878 17:31526440-31526462 TGGGGCCACCTGCTGGTGGTGGG + Intronic
1148102156 17:45098790-45098812 TGCTGCCATTTGGAGATGGTGGG + Intronic
1150467695 17:65408055-65408077 TTGGGCCAGTTTCAGTTGTTAGG - Intergenic
1150487270 17:65552451-65552473 TGGGGCCTTTTCCTGTTGTTAGG + Intronic
1153680196 18:7493264-7493286 TGGGGCAATTTGCTGTTGGAAGG + Intergenic
1156572572 18:38275007-38275029 TGGAGCCATTTGAAGGTGGAGGG + Intergenic
1157026160 18:43846418-43846440 TGGGAGCATTTGCAGTTGTAAGG - Intergenic
1158535825 18:58307214-58307236 TGGAGCCATTTGCAGCAGGGAGG + Intronic
1158655328 18:59325596-59325618 TGGGGCCTTTTGTAGGTGATTGG + Intergenic
1158668698 18:59455524-59455546 TGGGACCCTTTGCAGTGGTTGGG - Intronic
1158730619 18:60018502-60018524 TGGGGCCATTTGGCGATGTTTGG - Intergenic
1160932351 19:1576761-1576783 TGGGACCCTTTGCAGTGGGGTGG - Exonic
1161144391 19:2668898-2668920 TGGGGACATTTGCGGTTGAGGGG - Intronic
1165725645 19:38110763-38110785 TTGGGGGATTTGCAGCTGGTAGG - Intronic
1165750062 19:38253984-38254006 TGAGGCCATTCTCAGGTGGTGGG - Intronic
1168409483 19:56130403-56130425 AGGGGACATTTGCACTTTGTGGG + Intergenic
926335154 2:11857337-11857359 AGGGGCCATTTGAAGTTGAGAGG + Intergenic
926507191 2:13731813-13731835 TGGGGCCAATTGCTGTAGTTGGG + Intergenic
927127785 2:20028662-20028684 TGGGACCTTTTCCAGTTGGTAGG - Intergenic
927215694 2:20666946-20666968 TGGGGCCAGTGGCAGTCGCTTGG + Exonic
930222181 2:48755900-48755922 TAGGGCCATTTGCAGATGGTAGG - Intronic
932380406 2:71276800-71276822 TGGGGCAGTTGGCAGTGGGTGGG + Intronic
933812831 2:86043877-86043899 TGGGGCCATTTGCCGTGTGCTGG - Intronic
936656130 2:114489686-114489708 TGGGAGCATATGAAGTTGGTAGG + Intronic
938178011 2:129153983-129154005 TGGTGCCATTTTCAGTGGGGTGG - Intergenic
939008718 2:136819908-136819930 TCAGGCCATTTGCATTTGCTAGG + Intronic
941031527 2:160516999-160517021 TGGGGCCATTTTAAGCGGGTGGG + Intergenic
943258763 2:185630720-185630742 TTGTGCCATTTGCAGTGGGGAGG - Intergenic
944672550 2:202007137-202007159 TGGTGCCAGTTGCATTTGGGTGG + Intergenic
944960106 2:204862956-204862978 TTGCGCCATTTGCAGTTGGGAGG - Intronic
947526572 2:230880310-230880332 TGGCGGCATTTCCAGTTAGTGGG + Intergenic
1170111413 20:12808076-12808098 TGGAGGCATTTGCAGATGTTAGG + Intergenic
1172941370 20:38656847-38656869 TGGGGCTACCTGCAGTTGTTGGG - Intergenic
1174596849 20:51690912-51690934 AGGGGCCATTTGCTGTGTGTGGG - Intronic
1175091382 20:56507342-56507364 TGGGGCCCCTAGCAGTTGGGAGG + Intronic
1178350210 21:31867434-31867456 TGGGCCCATCTGTAGTTGGGAGG + Intergenic
1180614464 22:17118858-17118880 TGTGGCCCTTTGCAATGGGTAGG - Exonic
1180815010 22:18783848-18783870 TGGGGCCATTTGCCTTGGCTTGG + Intergenic
1181201198 22:21218185-21218207 TGGGGCCATTTGCCTTGGCTTGG + Intronic
1181453984 22:23044712-23044734 TCGTGCCATTTGCAGTGGGGAGG - Intergenic
1183648642 22:39141168-39141190 TGGGGCCCTTTCCTGTTGTTGGG - Intronic
1184905568 22:47483602-47483624 TGGTGCCACTTGCAGTGGGCAGG - Intronic
1184941116 22:47765869-47765891 TGGGGCGAGCTGCAGATGGTTGG + Intergenic
1203225715 22_KI270731v1_random:77246-77268 TGGGGCCATTTGCCTTGGCTTGG - Intergenic
1203265113 22_KI270734v1_random:9538-9560 TGGGGCCATTTGCCTTGGCTTGG + Intergenic
954783962 3:53079904-53079926 TGAGGACATTGGCAATTGGTGGG + Intronic
955589521 3:60520079-60520101 TGGTGCCACTTGCAGTTGAGAGG - Intronic
956688104 3:71850822-71850844 TTGGGAGATTTGCAGTTTGTAGG + Intergenic
958834689 3:99131001-99131023 TGGGTCCTTTTGCTCTTGGTGGG + Intergenic
968459992 4:720004-720026 TGGGGCCAGTTGCAGCAGTTTGG + Intronic
969395463 4:6917723-6917745 GCAGGCCATCTGCAGTTGGTCGG + Intronic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
974312416 4:60230086-60230108 TGGGGCTTTTTGTGGTTGGTAGG + Intergenic
976576471 4:86677962-86677984 TGGGGCCATTTGCAGTTGGTGGG + Intronic
978705332 4:111702312-111702334 TGGGGCCATTTGCTGGTGAAAGG - Intergenic
988647495 5:33110273-33110295 TGGGGCCTGTTGCAGGGGGTCGG - Intergenic
990776258 5:59309122-59309144 TGAGTCCATTTTCAGTTGGAGGG + Intronic
990851558 5:60210926-60210948 TTGGGCCATTTGCAGTGGCCTGG - Intronic
991393202 5:66172334-66172356 TCGGGCCATTTTAAGTTGTTTGG + Intronic
991452057 5:66762444-66762466 TGGGGGGATTTGGAGTTGATGGG + Intronic
992614350 5:78534749-78534771 TGGCACCATTTGCTGTTGATGGG - Intronic
999670828 5:153957985-153958007 TGGGGCAATTTGCAGAGGATAGG + Intergenic
1002881556 6:1256986-1257008 TGGGGCCATTTCCTTTTGGTGGG - Intergenic
1003148026 6:3525478-3525500 TGGGGCCACTTGCTCTTGGACGG - Intergenic
1003632201 6:7797566-7797588 TGTCGCCATTTGCAGTTGGATGG - Intronic
1006436901 6:34030402-34030424 TGGGCCCACATGGAGTTGGTGGG + Intronic
1008463118 6:51799004-51799026 TTGGTACATTTGGAGTTGGTAGG - Intronic
1011590452 6:88965913-88965935 TTGCGCCATTTGCAGTGGGGAGG + Intergenic
1015281317 6:131437345-131437367 TGGGGCTATTTTTAGTTGGTAGG - Intergenic
1017361631 6:153579410-153579432 TTGTGCCATTTGCAGTGGGGAGG + Intergenic
1017396999 6:154012951-154012973 TGGAGCCTTTGGCAGGTGGTTGG - Intronic
1021498912 7:21307775-21307797 TGGTCCCATCTGCAGTTGATGGG + Intergenic
1021597910 7:22336663-22336685 TCGTGCCATTTGCAGTGGGGAGG + Intronic
1022714216 7:32883437-32883459 TGTGGGCATTTGAAGATGGTTGG - Intronic
1023930446 7:44702174-44702196 TGGGGGCATTTGCAGGTGAGAGG - Intronic
1024161428 7:46680431-46680453 AGGTGCCATTTGGAGATGGTTGG + Intronic
1024806489 7:53147666-53147688 TGGGGCCATTTCCAGTTAGAGGG - Intergenic
1026071791 7:67128452-67128474 TGGAGCCCTTTGCATCTGGTCGG + Intronic
1026705110 7:72683810-72683832 TGGAGCCCTTTGCATCTGGTCGG - Intronic
1029562069 7:101309142-101309164 TGAGGACAGTTGCAGTTGGGTGG - Intergenic
1031660627 7:124419806-124419828 TGAGGACACTTTCAGTTGGTTGG + Intergenic
1032580080 7:133096263-133096285 TTGTGCCATTTGCAGTGGGGAGG - Intergenic
1033850310 7:145487280-145487302 TGGGACAATTTGAAGTTGGAAGG + Intergenic
1035574719 8:697230-697252 TGGGGCCATTTGCAGCTGTCAGG - Intronic
1037433596 8:18840187-18840209 GGGGGACATTTGCAGGTGGGTGG - Intronic
1041374865 8:57203298-57203320 TGAGGCCCTATGCAGGTGGTGGG + Intergenic
1042867507 8:73368671-73368693 TGGGGCCTTTTAGAGCTGGTTGG - Intergenic
1044741145 8:95327745-95327767 TAGGGACATTTGCAGTAGTTTGG + Intergenic
1046890386 8:119416008-119416030 TGGGGCCATCTGCAGGGGATTGG - Intergenic
1046943345 8:119952576-119952598 TGGGGCCAGTAGCAGTGGGAGGG - Intronic
1048895393 8:138988001-138988023 TGGGGCCTTTGGCAGATGATTGG - Intergenic
1051801140 9:20935723-20935745 TGAGGCCATTTGAATTTGATTGG + Intronic
1052456816 9:28710120-28710142 TGGGGCCATTGGGAGCTGATTGG + Intergenic
1052524611 9:29598570-29598592 AGGGGCCATTTGCAGTCCTTGGG - Intergenic
1052590179 9:30481923-30481945 TGGGGCCTTTTTTGGTTGGTAGG - Intergenic
1056616851 9:88175834-88175856 TGGGGCCATTGGCAGTGGGTGGG - Intergenic
1056914451 9:90733387-90733409 TGGCGCCCTTTGCAGCTGGGAGG - Intergenic
1057251573 9:93507594-93507616 TGGGGCCAGATGCAGGAGGTGGG + Intronic
1058001884 9:99874194-99874216 TGGGGCCAATTGCAGGGGGCAGG + Intergenic
1061456549 9:130702323-130702345 TGTGGCCATTTTCAGTGGGATGG + Intronic
1189616406 X:42788936-42788958 TTGTGCCATTTGCAGTGGGGAGG - Intergenic
1192116045 X:68412200-68412222 TGGGGACATTTGCAGCTGTAGGG - Intronic
1194994816 X:100580386-100580408 GGGGGCCATTTGCCTTTGGATGG - Intergenic
1195776553 X:108412536-108412558 AGGGGCCATTTTCTGTTTGTAGG + Intronic
1198843201 X:140880830-140880852 TGGGTCCACTTCCAGGTGGTGGG - Intergenic
1199613275 X:149635298-149635320 AGGGGCCATTTCCTGTTGGAAGG + Intergenic