ID: 976577168

View in Genome Browser
Species Human (GRCh38)
Location 4:86686481-86686503
Sequence TTATGCATAAAGGATGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976577168 Original CRISPR TTATGCATAAAGGATGGGCT GGG Intronic
901203724 1:7482189-7482211 TTATGCTTGAAGGATGGGGCTGG - Intronic
902895536 1:19477261-19477283 TCAGGCAGAGAGGATGGGCTGGG - Intronic
903285542 1:22274722-22274744 TTAAGCATCAATGATGTGCTAGG - Intergenic
903355229 1:22742299-22742321 TTCTGCATTCAGGGTGGGCTGGG + Intronic
903751472 1:25624055-25624077 TTATGCATAAAGGCCTTGCTTGG - Intronic
908078615 1:60548875-60548897 TAATGCAAAAAGCATAGGCTTGG - Intergenic
908204281 1:61829240-61829262 TTAGGCATATAAGAGGGGCTTGG + Intronic
908791882 1:67790907-67790929 ATAGGAATAAAGTATGGGCTGGG - Intronic
909853842 1:80503710-80503732 TTATGCATTAAGAATGATCTAGG - Intergenic
914679464 1:149928878-149928900 TTATCCAGAAGGGATGGGATTGG + Exonic
915448622 1:155989457-155989479 TTATGCCAACAGGAAGGGCTGGG - Intronic
915897912 1:159825661-159825683 CTAGGCATATAGGATGGGGTGGG - Intergenic
916574417 1:166054609-166054631 TAATGCATAAAGGAGGTGCCTGG + Intergenic
921734976 1:218616960-218616982 TTGTGCATAAAGGAGGGGGTGGG + Intergenic
922029619 1:221785376-221785398 ATATACAAAAAGGATGGGCTTGG + Intergenic
922162173 1:223086162-223086184 TTATCTATAAGGGATGTGCTAGG - Intergenic
924040896 1:239982745-239982767 CTATGCTCAAAGGATGGACTGGG - Intergenic
1066792523 10:39081476-39081498 TTATGCATATACGAAGAGCTGGG - Intergenic
1067557758 10:47284533-47284555 ATATACAAAAATGATGGGCTGGG - Intergenic
1068181588 10:53526513-53526535 TTTTGCAGATAGCATGGGCTAGG - Intergenic
1068725222 10:60293143-60293165 TTATGCATCAAGGATTTCCTAGG - Intronic
1069281902 10:66665013-66665035 TTATGTAAAAAAGATTGGCTGGG + Intronic
1069848566 10:71390398-71390420 TTATAAATAAATGATGGGCGAGG + Intergenic
1070188850 10:74093004-74093026 TTATGAATGAAGGCTGGGCACGG + Intronic
1072681088 10:97507344-97507366 TTGTGCATAGAGGCTGGGCATGG + Intronic
1074069936 10:110057093-110057115 TTATGGATAAGAGATGGGCTGGG + Intronic
1074811821 10:117112343-117112365 AGATGCATAAATGATGAGCTAGG - Intronic
1077598279 11:3553567-3553589 CTCTGCATAAAGGATTTGCTGGG - Intergenic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1079717873 11:23771195-23771217 ATCTGGATAAAGGATGGGATTGG - Intergenic
1083291440 11:61692577-61692599 TTATGCATAAAGGGTGGGAGTGG - Intronic
1083480011 11:62937998-62938020 TTCTGCATAGAGAATGGGGTGGG - Intronic
1086316580 11:85601301-85601323 TTATGCATAAACTATGGACCAGG - Intronic
1090761931 11:129845297-129845319 GTATGCATGAAGGAAGGGGTAGG + Intronic
1090761936 11:129845367-129845389 GTATGCATGAAGGAAGGGGTAGG + Intronic
1094237843 12:28189212-28189234 GTATGCATAAAGAAGGGGGTGGG + Intronic
1096804300 12:54130968-54130990 GTATGCCTTGAGGATGGGCTGGG + Intergenic
1096854649 12:54471727-54471749 TTATGCATGAGGGCTGGGCGTGG + Intronic
1097100073 12:56581468-56581490 TTGTGCAAAATGGACGGGCTTGG + Exonic
1099747964 12:86731975-86731997 TTATGCTTAAAGGAGGGGCTAGG + Intronic
1100257783 12:92901994-92902016 TTTTGCAAAAAGAATGGGATTGG + Intronic
1100409854 12:94304910-94304932 TAATGCATAAAGCAGGGCCTAGG + Intronic
1100420090 12:94424255-94424277 TTGTGCAAAATGGACGGGCTTGG - Intronic
1102631531 12:114285041-114285063 TTATGCAGCAAGGAGGGGCTGGG - Intergenic
1102769077 12:115457707-115457729 TTATGTCTGAAGGTTGGGCTTGG - Intergenic
1103400198 12:120638836-120638858 TTAAGGAAAATGGATGGGCTGGG - Intergenic
1105355614 13:19656832-19656854 TTGTTCATAAAAGATGGGCCAGG + Intronic
1106650120 13:31681589-31681611 TTATTAAGTAAGGATGGGCTTGG - Intergenic
1106911981 13:34472533-34472555 TTATCTATCAAGGAAGGGCTAGG + Intergenic
1107964902 13:45589331-45589353 ATATGAACAAAGGATTGGCTGGG + Intronic
1111882520 13:93975433-93975455 TTATTCATGAATGATGAGCTGGG + Intronic
1111966070 13:94863161-94863183 GTGTGCATACATGATGGGCTGGG - Intergenic
1112215978 13:97432803-97432825 TTCTGCCTAAATGATGGGCATGG - Intergenic
1112965007 13:105178597-105178619 TTAGGCATAAAGGCTGGGAATGG + Intergenic
1113795650 13:113056175-113056197 TTGTGCATAAACTAAGGGCTCGG - Intronic
1121120124 14:91371363-91371385 GTATGCATGCAGGGTGGGCTGGG + Intronic
1123128728 14:105968569-105968591 AGATGCATAAAGGGTGGGATGGG + Intergenic
1125443876 15:39732327-39732349 TTATGCATGACGGTTGGGCATGG + Intronic
1137412003 16:48236563-48236585 TTATGCATATACTATGTGCTGGG - Intronic
1139570869 16:67811196-67811218 TTATCCAAAAAGCTTGGGCTTGG - Intronic
1139638784 16:68275720-68275742 GTAAGCATAAAGGATGGGGATGG + Intronic
1143605974 17:7986230-7986252 TTAATCATACAGGATGGGCCAGG + Intergenic
1144144427 17:12383653-12383675 TTATAAATAAAGGAGGTGCTGGG + Intergenic
1146531258 17:33609497-33609519 TGATGCTTGAAGGATGAGCTAGG - Intronic
1146842128 17:36163533-36163555 TTATGTTTAAAGGATGGGCAGGG - Intergenic
1146854436 17:36251492-36251514 TTATGTTTAAAGGATGGGCAGGG - Intronic
1146870339 17:36375384-36375406 TTATGTTTAAAGGATGGGCAGGG - Intronic
1146877696 17:36426465-36426487 TTATGTTTAAAGGATGGGCAGGG - Intronic
1147073220 17:37976008-37976030 TTATGTTTAAAGGATGGGCAGGG - Intergenic
1147084742 17:38055546-38055568 TTATGTTTAAAGGATGGGCAGGG - Intronic
1147100689 17:38179512-38179534 TTATGTTTAAAGGATGGGCAGGG - Intergenic
1147386509 17:40085623-40085645 TTATTCATAGAGGGTGGGCATGG - Intronic
1148475184 17:47923993-47924015 ACATTCATTAAGGATGGGCTGGG - Intronic
1150083625 17:62262559-62262581 TTATGTTTAAAGGATGGGCAGGG - Intergenic
1150461787 17:65359651-65359673 TTATCAATAAAGGAGGTGCTTGG + Intergenic
1150910772 17:69385195-69385217 TTATGCATATAGGCTGGGCGCGG + Intergenic
1151351735 17:73535932-73535954 TTAGGAAGAAAGGATGTGCTTGG - Intronic
1152407078 17:80103952-80103974 TTCTGCATAAAGGTGCGGCTTGG - Intergenic
1153762812 18:8348172-8348194 TCATGCATTAAGCATGAGCTAGG + Intronic
1155340175 18:24805811-24805833 GTATTCATAAAGGATGTGATTGG - Intergenic
1155786683 18:29912022-29912044 TTATGGATACAGGATGGGAGTGG - Intergenic
1158069634 18:53455491-53455513 TTATGCATAAAGTAAGGAATGGG + Intronic
1158974108 18:62694953-62694975 TTTAGCAAAAAAGATGGGCTGGG - Intergenic
1166256806 19:41612416-41612438 TTTTGCTTAAAAGATGCGCTTGG - Intronic
1167897137 19:52591136-52591158 TTCTACATAAAACATGGGCTTGG - Intergenic
925624682 2:5831068-5831090 TTATGATGAAATGATGGGCTGGG + Intergenic
926464877 2:13175762-13175784 TTATGAGTACAGGATGGGCATGG + Intergenic
926898018 2:17716463-17716485 TAATGCAACAATGATGGGCTAGG + Intronic
927315101 2:21672660-21672682 ATAAGCATAAATGTTGGGCTTGG - Intergenic
929079003 2:38103964-38103986 TTATGCATAAGGGATAGATTTGG + Intronic
930704214 2:54488127-54488149 TTATTCATAAAGGATATGATGGG - Intronic
931374168 2:61693241-61693263 TTATATATAAAGGCTGGGCGTGG - Intergenic
932348118 2:71008866-71008888 TTATGCACAGATGCTGGGCTTGG - Intergenic
938158345 2:128960200-128960222 TTATGAATAGAGGCTGGGCAGGG - Intergenic
939706123 2:145456206-145456228 TTATGGGCAAAGGATGTGCTTGG - Intergenic
939783078 2:146473900-146473922 TTATGCAGCAAGTATGGGGTGGG - Intergenic
940321134 2:152377834-152377856 TTAAAGATAAAAGATGGGCTGGG + Intronic
944087034 2:195861500-195861522 TTATGCATCTATGATGTGCTAGG + Intronic
945697036 2:213119767-213119789 TTATGCACACAGGATGTGGTAGG - Intronic
946178872 2:217938141-217938163 TTTTGGAGAAAGAATGGGCTTGG - Intronic
946723619 2:222638672-222638694 TTATGTGTATGGGATGGGCTAGG - Intronic
948321538 2:237073655-237073677 CTATGCAAAAAGGCTGGGCGTGG + Intergenic
1169990702 20:11499478-11499500 TTATGCATAAATGTAGGTCTGGG - Intergenic
1173562445 20:44015796-44015818 TTAAGCATGAGGGATGGGATGGG - Intronic
1173904753 20:46618248-46618270 ATATGAACCAAGGATGGGCTAGG - Intronic
1174407639 20:50312544-50312566 TTGTGGACAAAGGATGGCCTGGG + Intergenic
1177049078 21:16209227-16209249 TTATATATAAAGTATGGACTGGG + Intergenic
1178470298 21:32886418-32886440 TTATTCATGAAGGATGGGAATGG - Intergenic
1181293972 22:21820049-21820071 TTAAGAATAAAGAATAGGCTGGG - Intronic
1181890806 22:26061848-26061870 TCATGGAAAAATGATGGGCTAGG - Intergenic
1182364514 22:29769209-29769231 TTATGCATGAAGGCTCGGCGCGG + Intronic
1182622281 22:31624762-31624784 GGATGCAGAAAGGAGGGGCTTGG - Intronic
949869992 3:8580283-8580305 GTGTGCAGAAAGGCTGGGCTGGG - Intergenic
950052395 3:10002579-10002601 TTAAGCATAAAGGCAAGGCTTGG - Intronic
953783706 3:45894553-45894575 TAATGTAGAAAGGATGAGCTGGG + Intronic
954072196 3:48151105-48151127 TCAAGTATAAAGGATGAGCTTGG - Intergenic
957512331 3:81205305-81205327 TTATGCATGATGGATGGTGTTGG - Intergenic
959237179 3:103739608-103739630 TTATGCAGAGAGGCTGGGCATGG - Intergenic
962198616 3:133383580-133383602 TTATACATAACAGAAGGGCTGGG - Intronic
962894901 3:139705293-139705315 TCATACATAAGTGATGGGCTTGG - Intergenic
965748818 3:171955675-171955697 TGATGCATAAAGGTTGGAATAGG - Intergenic
966971156 3:185046682-185046704 TTAGACATAATGTATGGGCTTGG - Intronic
969543012 4:7805527-7805549 CTGAGCATAAATGATGGGCTAGG + Intronic
971379490 4:26083867-26083889 TTTTACAAAAAGGATGGTCTTGG + Intergenic
973827151 4:54719839-54719861 TAATGCATAAAGAATGAGCCAGG - Intronic
975701627 4:77072932-77072954 TGATACAGAAAGCATGGGCTTGG + Intronic
976577168 4:86686481-86686503 TTATGCATAAAGGATGGGCTGGG + Intronic
978075794 4:104528077-104528099 TTAGACATAAAGGATGTTCTTGG + Intergenic
979548648 4:121965236-121965258 TCATGCATAATGGCTGGGGTAGG - Intergenic
980013745 4:127624041-127624063 TTTTGCATAAAGGATAAGGTTGG - Intronic
987337629 5:16911049-16911071 TGATCCATAAAGAATGGGCCAGG + Intronic
989076563 5:37569833-37569855 TTAGGCCTAAAGGATGGATTGGG + Intronic
991494851 5:67216723-67216745 TTTAGCATAAACTATGGGCTGGG + Intergenic
994385194 5:99122695-99122717 TTATGCTTTAACGATAGGCTCGG + Intergenic
1001754277 5:174156084-174156106 TTTTGCAGAAAGTATGGGCAAGG + Intronic
1002804732 6:561875-561897 TTAAGAAAAAAGGATAGGCTGGG - Intronic
1006954214 6:37852869-37852891 ATATACATAAAGGCTGGGCATGG - Intronic
1011282488 6:85690591-85690613 TTATGCAGAGGGGATGGGTTAGG + Intergenic
1013470417 6:110459197-110459219 TTACTCCTAAAGGGTGGGCTAGG + Intronic
1013622342 6:111901892-111901914 ATGTGGGTAAAGGATGGGCTTGG + Intergenic
1014249605 6:119101758-119101780 TAAAGAATAAAGGATAGGCTGGG + Intronic
1018906074 6:168076809-168076831 TTATTCGAAAGGGATGGGCTGGG - Intronic
1020160076 7:5763861-5763883 TTATTGATACAGGCTGGGCTTGG - Intronic
1020933143 7:14426263-14426285 TTATGTATAAAGGATAAGATTGG + Intronic
1021322954 7:19234092-19234114 TTATGCATTACGGAAGTGCTGGG + Intergenic
1024311930 7:47977594-47977616 TTATGAAGAAAAGCTGGGCTGGG + Intronic
1024440817 7:49415638-49415660 TTATTAATAAAGGATGGCCTGGG - Intergenic
1025062901 7:55826500-55826522 TTAAGAATAAAGGATGGGCTGGG + Intronic
1026233214 7:68503687-68503709 TGAAGGATAAAGGATGGGCAAGG - Intergenic
1028352567 7:89867076-89867098 TTATGCAAAATGGCTGGGCATGG - Intergenic
1033415567 7:141158551-141158573 TTATAGATAAAGGATGGCTTTGG - Intronic
1033683041 7:143615150-143615172 ATAAGCATAAAGGCTGGGCGCGG + Intergenic
1033701571 7:143842488-143842510 ATAAGCATAAAGGCTGGGCGCGG - Intergenic
1034910931 7:154998073-154998095 GCAGGCATAAAGGATGGCCTAGG + Intronic
1036236354 8:7042714-7042736 TTATGCAAAAACTATGGACTTGG - Intergenic
1039025872 8:33257256-33257278 TTAGGCATACATGATGAGCTGGG - Intergenic
1041829643 8:62139434-62139456 TTTTGTATAAAGGTGGGGCTGGG - Intergenic
1044250392 8:89999124-89999146 TTGTCCTTAAAAGATGGGCTGGG + Intronic
1046625783 8:116575687-116575709 TTATGGAGCCAGGATGGGCTGGG - Intergenic
1051086284 9:13352724-13352746 TTATGCATAATTGAAGGGCTAGG + Intergenic
1052740956 9:32392707-32392729 TTATGAAAGCAGGATGGGCTGGG - Intronic
1053430752 9:38040387-38040409 TTATCCCTAAAGGGGGGGCTTGG + Intronic
1055382966 9:75729221-75729243 TTATGCATGAATGAAGGACTGGG - Intergenic
1058376474 9:104327989-104328011 TTAAGCATAAAGGATGCAGTTGG + Intergenic
1059687665 9:116652993-116653015 TTATTCAGAAAAGAAGGGCTGGG - Intronic
1186328449 X:8506262-8506284 TTTTGCATTATGGATGGGCATGG - Intergenic
1193428647 X:81372451-81372473 TTAAGAATAATGGATGGGATGGG - Intergenic
1194667923 X:96696084-96696106 TTATTTAAAAAGGTTGGGCTGGG + Intronic
1195890486 X:109688301-109688323 TAATGCATAAATGAAGGGGTTGG - Intronic
1197292112 X:124671329-124671351 TTATATATAAATGCTGGGCTTGG + Intronic
1198390492 X:136169148-136169170 TTATTCAGAAAGGACTGGCTGGG - Intronic
1199852097 X:151732028-151732050 TTTTCTATCAAGGATGGGCTGGG + Intergenic
1201691552 Y:16771650-16771672 TGATAGATAATGGATGGGCTGGG - Intergenic