ID: 976586955

View in Genome Browser
Species Human (GRCh38)
Location 4:86809304-86809326
Sequence TCTATTAAGAAAAACATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 571
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 531}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976586955 Original CRISPR TCTATTAAGAAAAACATGGA AGG (reversed) Intronic
900199189 1:1395714-1395736 TCTATAAGGAAAAGCAGGGAGGG - Intronic
901010849 1:6201139-6201161 TCTATTAAAAACAACAAGAAAGG - Intronic
901167888 1:7232725-7232747 ACTATTAAGAGAAAGATGGGCGG - Intronic
901275292 1:7986529-7986551 TCTATGAAGAAAATTAAGGAGGG + Intergenic
903463859 1:23538520-23538542 ACTATTAAGAAAAAAAAGGCTGG - Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
905044076 1:34982798-34982820 TCTACTAAGATTAAGATGGAGGG + Intronic
906840099 1:49128404-49128426 ACTATTATGAAAAACAAGGTTGG + Intronic
908759680 1:67500202-67500224 TCTATTAAGACACACATTAAAGG + Intergenic
908816230 1:68038090-68038112 TCCATTAAGGAAAGCAAGGAAGG + Intergenic
909250573 1:73349052-73349074 TCTTTTAAGAAATAGTTGGAGGG + Intergenic
909401595 1:75238322-75238344 TTCATTAAGAAGAACATGTAAGG - Intronic
909832697 1:80212977-80212999 TCTATTAAGAAAAAGCTGATTGG + Intergenic
910031927 1:82736490-82736512 TCTAAAAAGAGAAAGATGGAAGG - Intergenic
910424255 1:87102748-87102770 ACTATTAAAAAAAACAAAGAGGG - Intronic
910534926 1:88286769-88286791 TATATTAAGAGAAAAAAGGATGG - Intergenic
910574611 1:88746583-88746605 GCTATTATCAAAAAAATGGAAGG + Intronic
910854379 1:91680140-91680162 TCTTCTCAGAAAAACATGGCAGG - Intergenic
911308418 1:96260834-96260856 TCTTAAAAGAAAGACATGGATGG + Intergenic
911686464 1:100782315-100782337 GCTATGAAGAAAAACAAGGCAGG - Intergenic
912876696 1:113366980-113367002 TCTAAGAAGAAAAAAATTGAGGG - Intergenic
913700099 1:121366038-121366060 TATAATTAGAAAAACATGGCTGG - Intronic
914040647 1:144046491-144046513 TATAATTAGAAAAACATGGGTGG - Intergenic
914137439 1:144913988-144914010 TATAATTAGAAAAACATGGCTGG + Intronic
915237861 1:154498694-154498716 TCTATTAAAAAATGCAAGGATGG - Intronic
915381597 1:155446208-155446230 TAAATTTAGAAAAACATGTACGG - Intronic
915863267 1:159470446-159470468 TTTATTTAGAAAAACAGGCAGGG - Intergenic
916856989 1:168760549-168760571 TCTAATGAGAGAAACAGGGAAGG - Intergenic
917369032 1:174268575-174268597 TCCATGAAGATAAAAATGGAAGG - Intronic
917673397 1:177296112-177296134 TTAATTAAGAAAAACAAAGAAGG - Intergenic
918102942 1:181392206-181392228 TCCAGTTAGAGAAACATGGAAGG - Intergenic
918212935 1:182367588-182367610 TGAATTCAGAAAAACAGGGAAGG + Intergenic
918637984 1:186802528-186802550 TCTACTAATAAAAACTTGGGTGG + Intergenic
918949429 1:191116687-191116709 GCATTTAAAAAAAACATGGAGGG + Intergenic
919319422 1:196015969-196015991 TATATAAAGAAAAAAATGAAAGG + Intergenic
920079997 1:203366093-203366115 TCTATAAAGAAAAAAAAGGCAGG - Intergenic
920317680 1:205090428-205090450 TCTATTCAGAAAAACAAGGACGG - Intronic
920487515 1:206384757-206384779 TATAATTAGAAAAACATGGCTGG - Intronic
923181175 1:231521430-231521452 TGATTTAAAAAAAACATGGAAGG + Intergenic
923329274 1:232907573-232907595 TCAAATAACAAAAGCATGGAAGG - Intergenic
923394884 1:233552014-233552036 GCCCTTAAGAAAAACATTGATGG + Intergenic
923450029 1:234107820-234107842 TCCATTAATAAAAGAATGGAAGG - Intronic
923749444 1:236734074-236734096 TCTATTACTACACACATGGAGGG - Intronic
923876580 1:238055983-238056005 TCTATTTAGGAAAAAATGGGAGG - Intergenic
924035400 1:239931164-239931186 TTAAATCAGAAAAACATGGAGGG - Intergenic
924110023 1:240689856-240689878 TCTGGTGAGAAAAACATGGGTGG - Intergenic
924611895 1:245580412-245580434 ACTATTTAGAAAAGTATGGATGG + Intronic
924673759 1:246154494-246154516 TCTATTAAAAGAAACTAGGAGGG - Intronic
924717705 1:246593264-246593286 TCTACTAAGAAAAAGATACAGGG - Intronic
1062779573 10:189727-189749 TCTATGAAGAAAAACATACAAGG + Intronic
1062962404 10:1582493-1582515 TATATCAAGAAAAAAATGCATGG - Intronic
1063900474 10:10727478-10727500 ACTATAAAGAAAAACAGGGCCGG + Intergenic
1064531798 10:16317978-16318000 CCTATTAAAAAAAAAATGGCAGG + Intergenic
1065327315 10:24560432-24560454 TATATTAAAGCAAACATGGAAGG - Intergenic
1066354812 10:34672515-34672537 TGTATTAATAAACACATGAACGG + Intronic
1069228839 10:65980497-65980519 TCTAGTAACAAAACCAGGGAAGG + Intronic
1070036110 10:72726021-72726043 AGTATGAAGAAAAATATGGAAGG - Intronic
1070207022 10:74274263-74274285 GTTATTAAGAAAATCATGGCCGG + Intronic
1070869138 10:79732986-79733008 TCTCTTAAAAAAAAAATGGCTGG - Intergenic
1071470504 10:85980794-85980816 TCTATTAAGAAGCAGATGCAGGG - Intronic
1071584283 10:86804531-86804553 TCTATAAAGAAAATCATGTGTGG - Intronic
1071636051 10:87255164-87255186 TCTCTTAAAAAAAAAATGGCCGG - Intergenic
1071659190 10:87482780-87482802 TCTCTTAAAAAAAAAATGGCTGG + Intergenic
1071806700 10:89129915-89129937 TCTCTTTAGAACAACATGGCAGG + Intergenic
1072105272 10:92267748-92267770 TTGATTAACAAAATCATGGAAGG + Intronic
1072266420 10:93732622-93732644 ACTGTTAAGAAAATCATTGAGGG - Intergenic
1072420599 10:95288005-95288027 ACTATGAAGAAAAGCAAGGAAGG + Intronic
1072598558 10:96900695-96900717 TCCATTAAGAAAAATATGATTGG - Intronic
1072844476 10:98814618-98814640 TCAATTAAGAAACACATTAAGGG + Intronic
1073243920 10:102076087-102076109 TCTATTAAAAAAAAAAAGGCTGG + Intergenic
1073848899 10:107591654-107591676 TGTAAAAAGAAAAATATGGATGG + Intergenic
1074000225 10:109364764-109364786 TCTAAAAAGAAAAACAAGGCTGG - Intergenic
1074354354 10:112769072-112769094 TCTTGAAAGAAAAACTTGGAAGG + Intronic
1074562921 10:114550286-114550308 ACTATAAAGATAAAAATGGAAGG + Intronic
1075109176 10:119563860-119563882 TCTACTAAGAAAATAATGGCTGG + Intergenic
1076490195 10:130855334-130855356 TCTGTTAAGAAGAACATGTTTGG + Intergenic
1077600520 11:3571573-3571595 TCAAAAAAGAAAAACATGAATGG + Intergenic
1077627451 11:3785460-3785482 TCTATTAACAATAACAAGGCTGG + Intronic
1078081392 11:8207104-8207126 TCTATTAGGGAATACATAGAGGG + Intergenic
1079362864 11:19784018-19784040 TATATTAAGAAAAATATAGCAGG + Intronic
1080020543 11:27555288-27555310 AATATTCAGAAAAAAATGGATGG - Intergenic
1080629378 11:34059566-34059588 CCAATTTAGAAAAACATGTAAGG - Intronic
1081029845 11:38065606-38065628 TCAATTAAGACAAGCATTGAAGG + Intergenic
1081064885 11:38529583-38529605 TGTATTATGAAAAAAATGCATGG + Intergenic
1081335550 11:41861679-41861701 TCTAGAAAAAAAAAAATGGAGGG - Intergenic
1081380545 11:42409287-42409309 TCTATCAAGCACATCATGGAAGG - Intergenic
1081485994 11:43529638-43529660 TCTTGTAAGAAAGAGATGGATGG - Intergenic
1082935597 11:58653603-58653625 TGTATAAAGAAAAACGTGGAGGG + Intronic
1082993416 11:59229040-59229062 TCCATTAAGAAATTCATGGCGGG + Intergenic
1083907070 11:65679845-65679867 TCAATTAAGAGAAATAGGGAAGG - Intergenic
1084256430 11:67946178-67946200 TCAAAAAAGAAAAACATGAATGG + Intergenic
1084816345 11:71649157-71649179 TCAAAAAAGAAAAACATGAATGG - Intergenic
1085647802 11:78239090-78239112 TCTATTAAGAAAAAAAAAAAAGG + Intronic
1086357126 11:86013672-86013694 TATATTAAGAAAAATATGCATGG + Intronic
1086517409 11:87628611-87628633 AATAGTAAGAAAAGCATGGATGG + Intergenic
1086842947 11:91710960-91710982 TTATTTAAGAAAAACAGGGAAGG - Intergenic
1086942733 11:92815223-92815245 TGTATTAAGAAAAACAATAAGGG + Intronic
1087090278 11:94263284-94263306 GCTATTATGAAAAACAGGAAGGG - Intergenic
1087146530 11:94818788-94818810 TAAATCAAGAAAAAAATGGAGGG - Intronic
1087985251 11:104670813-104670835 CCTATAAGGAAAAACACGGATGG - Intergenic
1088049429 11:105493432-105493454 TCTTTTATCAGAAACATGGAAGG - Intergenic
1088402915 11:109440972-109440994 TCTATTAGTAAATCCATGGAAGG + Intergenic
1088574472 11:111256955-111256977 ACTATTTATAAAGACATGGATGG - Intronic
1089029230 11:115306344-115306366 TCTATTTACATAAACATAGATGG - Intronic
1089186821 11:116622993-116623015 TATATTTAGAAAAACCTTGATGG - Intergenic
1089194074 11:116681932-116681954 TTTATTTAGAAAAATATGGCTGG + Intergenic
1090550151 11:127810538-127810560 TCTGTTAAGTAAAAAAGGGATGG - Intergenic
1091212778 11:133877307-133877329 TATATTCAGAAAAAAATGGATGG - Intergenic
1092297455 12:7211747-7211769 TGTATTATGAATTACATGGAAGG + Intronic
1092426655 12:8380888-8380910 TCAAAAAAGAAAAACATGAATGG + Intergenic
1092655135 12:10676175-10676197 TATACTAAGTAACACATGGATGG - Intergenic
1093115875 12:15210470-15210492 TCTCTTAAGAAAAATATGATTGG - Intronic
1093126739 12:15338884-15338906 TGTATTAAGGTAAACATGTAAGG + Intronic
1093363321 12:18259566-18259588 CCTATTTAGAAAAAAATAGAAGG + Intronic
1094529039 12:31255150-31255172 TCTAAGAAGAAAAACATTTAAGG - Intergenic
1095043423 12:37470549-37470571 TGTTTTAAGAAATAAATGGAGGG - Intergenic
1097614894 12:61872149-61872171 TCTATAAACAAAAACCTGGAAGG + Intronic
1098073838 12:66705171-66705193 TCTATTAAGAATAACAGCAATGG + Intronic
1098245152 12:68509281-68509303 TGTAATAATAAAATCATGGATGG - Intergenic
1098451723 12:70626493-70626515 CATATTAGGAAAAAAATGGATGG + Intronic
1099492629 12:83306047-83306069 TCAGTTAAGAAAGACAAGGAAGG - Intergenic
1099849106 12:88069494-88069516 TAGACAAAGAAAAACATGGAGGG + Intronic
1099883378 12:88496988-88497010 TCTATAAAGAAGAACTTGCATGG - Exonic
1099916904 12:88906231-88906253 TCTCTTATGAATTACATGGAAGG + Intergenic
1100810347 12:98331091-98331113 TATAATAAGAAATACATGGCCGG - Intergenic
1100900138 12:99229981-99230003 TCTTTTAAGAAAATAATAGATGG + Intronic
1100904488 12:99282063-99282085 GCAATTAAGAAAAATATAGAAGG + Intronic
1102095707 12:110239339-110239361 TCTATTGAGAAGATCATAGATGG + Intergenic
1102331890 12:112040349-112040371 TCAATTAACAAAAACAGGGATGG + Intronic
1102680893 12:114689746-114689768 GCTAATAAGAATAATATGGAGGG - Intergenic
1102892833 12:116574319-116574341 TATATTAAGAAAAACAGTGCAGG + Intergenic
1103110951 12:118277758-118277780 TCTTTTAAAAAATACATGGTGGG - Intronic
1104512466 12:129392926-129392948 TCAATTATGATAAACTTGGAGGG + Intronic
1105063379 12:133173929-133173951 GCTATAAAGAAATACATGGCTGG - Intronic
1106300236 13:28457747-28457769 TCTTTTAAGAAAAATAAGCAAGG - Intronic
1106659606 13:31784813-31784835 TGTATTAAGAGAAAGTTGGAGGG - Intronic
1106868744 13:33996150-33996172 TATATGAAGGAAAATATGGATGG + Intergenic
1107064687 13:36200622-36200644 TCTATTAAGTATTTCATGGAAGG + Intronic
1108900629 13:55402949-55402971 TTTATTAGGAAACACTTGGAAGG + Intergenic
1109570272 13:64179518-64179540 TCATTTAAGAAATACATTGATGG + Intergenic
1110008542 13:70302744-70302766 TCTATTAAGCAAGATATTGAAGG + Intergenic
1110181554 13:72623943-72623965 GGCACTAAGAAAAACATGGATGG - Intergenic
1110669735 13:78162980-78163002 TATATAAACAAAAACAGGGAGGG - Intergenic
1111169492 13:84507318-84507340 TCTTTTGTGAAAAAAATGGATGG - Intergenic
1112884284 13:104149139-104149161 TTTATCAAGAAAAAAATAGAGGG + Intergenic
1112981642 13:105392151-105392173 TCTTTAAATAAAAACATGGTAGG + Intergenic
1113716748 13:112514829-112514851 TGTATTTATAAAAACATGCATGG + Intronic
1113746564 13:112749279-112749301 TCTATTAAGAAATAGAAGGCTGG - Intronic
1113863134 13:113503131-113503153 GCTATTAAGAAAAAGAAGGAAGG - Intronic
1114373351 14:22114419-22114441 TGTATATAGAAAAATATGGATGG + Intergenic
1115940962 14:38609183-38609205 TCTATGCAGAAAAGCATTGAAGG - Intergenic
1115941111 14:38610685-38610707 ACTATTAAGAAAAACACATAGGG + Intergenic
1116049565 14:39786683-39786705 TCATTTAAGAAAAATATGAAAGG - Intergenic
1116126193 14:40788713-40788735 TCTATAAAGATAGACAAGGAAGG + Intergenic
1116542973 14:46121947-46121969 TCAATTAAGAAACTCATAGAAGG - Intergenic
1116753574 14:48917603-48917625 TCTATTAAGAAGAACATATGGGG - Intergenic
1117141343 14:52793365-52793387 TCTGATAAGAAAAACGGGGAGGG - Intergenic
1117901240 14:60535685-60535707 ACTATTAGGAAAAACAGGTAGGG - Intergenic
1117904588 14:60571326-60571348 TCTATTAAAAAATAGATGGCAGG + Intergenic
1118228173 14:63922486-63922508 TATCTTAAGAAACACTTGGAGGG - Intronic
1118707452 14:68493337-68493359 CCTTTTAAGAAAAATCTGGATGG + Intronic
1118789913 14:69081133-69081155 TCTATTGAGAAGAACAGGGCGGG + Intronic
1118850865 14:69582307-69582329 TCCATTAAGAAGAAAAAGGAGGG - Intergenic
1118860392 14:69658563-69658585 TCTTTTTAAAAAAACTTGGACGG + Exonic
1118960162 14:70522707-70522729 CCTCCTAAGAACAACATGGAAGG - Exonic
1119747572 14:77055135-77055157 TCTATTTAGAGAAATATGGTGGG + Intergenic
1119941838 14:78649450-78649472 TTTCTTAAAAAAAAAATGGAAGG + Intronic
1120806461 14:88756256-88756278 TCTATTGAGATAAACATATATGG - Intronic
1121090669 14:91179776-91179798 TCAATTAAGCAAACCATCGAGGG + Intronic
1122680586 14:103458533-103458555 TTTATTTACAAAAACAGGGATGG + Intronic
1122683117 14:103482060-103482082 ACTATTAAGAAATACCTGGCTGG - Intronic
1202941969 14_KI270725v1_random:158161-158183 TGTTTTAAGAAATAAATGGAGGG - Intergenic
1123992780 15:25695773-25695795 ACTATCAAGAAGTACATGGAGGG - Intronic
1124614267 15:31230304-31230326 TCTATTTAGAAAAATATACACGG - Intergenic
1124824728 15:33082480-33082502 TCTATAAACAAAGACATGGGTGG - Intronic
1124992415 15:34688723-34688745 TCTATTAAAAAAAATCTGGAAGG - Intergenic
1126039458 15:44576213-44576235 TCTATTAGGAAAAAAAAGTAAGG + Intronic
1126303353 15:47225175-47225197 TCTGCTAAGAAGCACATGGAGGG - Intronic
1127137639 15:55941249-55941271 TCTTTAAAGAAAAAGAAGGAAGG - Intronic
1127964357 15:63912606-63912628 TCCATTAAAAAATAAATGGAAGG + Intronic
1130319075 15:82824764-82824786 TCTAATAAGAAAAATATAGTAGG - Intronic
1131247375 15:90806735-90806757 TTTATGAAGAAGAATATGGAAGG - Intronic
1131975473 15:97941743-97941765 TCTAATAAATAAAACATGGCAGG + Intergenic
1132968276 16:2672043-2672065 TCTGTTGAGAAAAAGTTGGAGGG - Intergenic
1133479480 16:6156166-6156188 TCTATTAGGAAAAACATAAAGGG - Intronic
1135971819 16:27077693-27077715 TCTATTAAAAAAAAGAAAGAAGG - Intergenic
1136872179 16:33817317-33817339 TCTATTAAAAAAAAAATAGCTGG + Intergenic
1136987444 16:35122420-35122442 TGTATTAAGAAGGAAATGGAGGG + Intergenic
1138274337 16:55721361-55721383 TCTATTAAGAAGGACAAAGAAGG + Intergenic
1138592069 16:58006055-58006077 TCTATGAAGAAAAACACGCTGGG + Intronic
1138986973 16:62341383-62341405 TATAGTAATAAAAACATGTATGG - Intergenic
1139267983 16:65657469-65657491 CCTATTAAGAAAGAACTGGAAGG + Intergenic
1139667180 16:68465624-68465646 TCTAATAAGAAAAAAATAAAGGG + Intergenic
1139727895 16:68916604-68916626 TCTAGTAAGTAAAGAATGGAGGG - Intronic
1139758729 16:69166887-69166909 TCTATTCAGAAAAACTAGGGGGG - Intronic
1140161079 16:72495332-72495354 AATATTCAGAAAAAAATGGATGG - Intergenic
1140189326 16:72801772-72801794 TCTATTAAAAAGAAAATAGATGG - Intronic
1140718695 16:77750746-77750768 TTTTTTATGAAAAAGATGGATGG + Intergenic
1140826878 16:78715113-78715135 TCTATTAAGAAAAAAGAGAATGG + Intronic
1140878304 16:79173844-79173866 TATATTAAAAGAAAGATGGATGG + Intronic
1142235334 16:88919724-88919746 TCTAAAAAGAAAGACAAGGATGG + Intronic
1203099993 16_KI270728v1_random:1298751-1298773 TCTATTAAAAAAAAAATAGCTGG - Intergenic
1142550662 17:736955-736977 TCCATTAAGAAAAACAGGTCTGG - Intronic
1144415937 17:15046493-15046515 TATATTAAGAAAAACAGGCCAGG - Intergenic
1144537388 17:16104019-16104041 TTTGTTAAGGAAACCATGGAAGG - Intronic
1145124814 17:20291546-20291568 TCTTTTAAAAAAAAAATGGTGGG - Intronic
1145854304 17:28138263-28138285 TCTATGAAGACGAACATGGGTGG + Intronic
1146096283 17:29932756-29932778 ACTATTAAGAAAAAGAATGATGG - Intronic
1146325815 17:31885042-31885064 TCTCAAAAAAAAAACATGGAAGG + Intronic
1146479327 17:33192054-33192076 TTTATTAAGAAGAAAATGGAGGG - Intronic
1146544271 17:33724878-33724900 TTTTTTAAGAAAAAAATGAACGG - Intronic
1146694689 17:34899543-34899565 TGTATTATGAAAAACATACAGGG + Intergenic
1148134882 17:45285788-45285810 TCTATTAAAAAAAATATAGCTGG + Intronic
1148510465 17:48164815-48164837 TCTATTAAGGAAATCAGTGAGGG + Intronic
1148520649 17:48271937-48271959 TCTTTTAAAAAAAACATGGAAGG + Intronic
1149900826 17:60476210-60476232 TCTATTAAGAAAGGCTAGGAAGG + Intronic
1150181474 17:63125701-63125723 TCTTTTAAATAAAACAAGGAAGG - Intronic
1150574684 17:66419868-66419890 TAAATGAAGAAATACATGGATGG - Intronic
1150875986 17:68970808-68970830 CCTATTAAAAAAAAAAAGGATGG - Intergenic
1153289044 18:3482275-3482297 TCAAATAAGATAAACATGTAGGG + Intergenic
1153323246 18:3793498-3793520 TCTATCAAGAAGAAATTGGAAGG - Intronic
1153815860 18:8789550-8789572 TCTATTGGGGAAGACATGGACGG + Intronic
1155846980 18:30720370-30720392 TCAATTATGAAAAATATGGTTGG + Intergenic
1155981380 18:32183979-32184001 GCTATCAAGAAAAAAATGCAAGG - Intronic
1158424189 18:57324282-57324304 TGTTTAAAAAAAAACATGGAAGG + Intergenic
1158584928 18:58724456-58724478 TTTCATAAGAAAAAAATGGATGG - Intronic
1159468492 18:68817064-68817086 ACTAGTAAGAAAAACATAAATGG - Intronic
1161833929 19:6631913-6631935 CTTATTAAGAAAATCATGGCTGG - Intergenic
1162314802 19:9932161-9932183 GCTATAAAGAAAAATATGGCCGG + Intronic
1166063091 19:40339669-40339691 ACTATAAAGAAAAGCAAGGAAGG + Intronic
1167929972 19:52856218-52856240 TCAATCAAGAAATACATGGGTGG + Intronic
1168303972 19:55424281-55424303 TCTATTAAAAAAAAAAAGTAGGG + Intergenic
925153422 2:1632974-1632996 TGTATTTAGAGAAAAATGGAAGG + Exonic
926535584 2:14107296-14107318 TCAATTAAAAAAATGATGGAGGG + Intergenic
926601139 2:14847081-14847103 CCTATAAAGACAAACATAGACGG + Intergenic
927123788 2:19994712-19994734 TAAATTTAGAAAAACATGGTTGG + Intronic
928613255 2:33011257-33011279 TCAATTCAAAAATACATGGAGGG - Intronic
928613985 2:33018239-33018261 TGTTTTAAGGAAGACATGGATGG - Intronic
930002938 2:46873461-46873483 TCTTTTCAGAAATCCATGGATGG - Intergenic
931100082 2:58988625-58988647 ACTATTAAGAGAAAGATTGATGG - Intergenic
931741234 2:65247290-65247312 ACTGTTAAGAAAATCATGGCCGG + Intronic
931902280 2:66803137-66803159 TCTAATATGAAAAAAATGCATGG - Intergenic
932499970 2:72174608-72174630 TCTTTCCAGAAAAAAATGGATGG + Intergenic
932858997 2:75268801-75268823 TTTAAAAAGAAAAAAATGGATGG - Intergenic
933147370 2:78871036-78871058 TCTAAAAAAAAAAACATGAAGGG + Intergenic
933806795 2:86004079-86004101 TCTATTAATACAAAGAAGGAAGG - Intergenic
934682480 2:96294908-96294930 TATATAAAGAATAACATGGCAGG + Intronic
935049820 2:99515376-99515398 CCTATTTAGAATAACAGGGAAGG + Intergenic
935085800 2:99843538-99843560 TCTGTTAGGAAAAATAGGGATGG - Intronic
937471319 2:122176303-122176325 TTTATTTACAAAAACATGGTGGG + Intergenic
937784633 2:125881493-125881515 TCTCATAAGAAAAACATGTATGG - Intergenic
937926697 2:127173355-127173377 TCTTTTAAGAAAAGAATGGAAGG - Intergenic
938550118 2:132372485-132372507 TCTTTTAAGAAGAACATGCAGGG - Intergenic
938584775 2:132679416-132679438 TTGTTTGAGAAAAACATGGAAGG - Intronic
939694041 2:145301765-145301787 ACTAATAAACAAAACATGGATGG - Intergenic
940084292 2:149840343-149840365 TCTCTTAAAGAAAAAATGGAAGG + Intergenic
940502142 2:154506069-154506091 TCTATAAACAAAGACAAGGACGG + Intergenic
940905073 2:159161691-159161713 TCTATTTAAAAACACAAGGAAGG + Intronic
941351103 2:164438122-164438144 TGGATGAAGAAAAAAATGGAAGG + Intergenic
941402816 2:165052339-165052361 TCTACTAAGAGTAACATGAATGG - Intergenic
941976891 2:171415317-171415339 TATATTAAGAAGAAAATGCAAGG - Intronic
942499458 2:176573596-176573618 TCTATTAATGAAAAAATGTAAGG - Intergenic
943047302 2:182873934-182873956 TCTGTTCATAAAAATATGGAAGG - Intergenic
943296954 2:186153116-186153138 TCTATGAAGAAAAATAAAGATGG + Intergenic
943336235 2:186618616-186618638 TTTGTTAAGAAAAACATTCATGG + Intronic
943867706 2:192949371-192949393 TATATTTACACAAACATGGATGG + Intergenic
944043614 2:195383386-195383408 TCTATTAAATAAAACACTGAAGG - Intergenic
944225441 2:197344693-197344715 TTTGTTAAAAAAAAAATGGAAGG + Intergenic
944664386 2:201947617-201947639 GCTTTTAAGAAACAGATGGAAGG - Intergenic
945529074 2:210927403-210927425 TGTATTTACAAAAACATTGATGG + Intergenic
945569497 2:211447900-211447922 CCTGTTAAGAGAAACATGGCTGG + Intronic
945855245 2:215061385-215061407 TCTATTAAAAGAAACATGGCAGG + Intronic
946610590 2:221453878-221453900 GATATTAAGAAATACATGGCCGG + Intronic
947462441 2:230315024-230315046 TCTATGAAGACAGACATGCATGG + Intergenic
948156323 2:235785902-235785924 CCTTTTAAAAAAAACGTGGATGG + Intronic
948165556 2:235859198-235859220 TGTATTAAAAAAAAAATGCAAGG - Intronic
948260685 2:236602274-236602296 TTTATTGAGAAACACATGGCAGG + Intergenic
948925982 2:241098289-241098311 TCTGTTAAGAAAAATATACAAGG + Intronic
1169977944 20:11351988-11352010 TCTATGCAGGAAAACATGGCTGG - Intergenic
1170542230 20:17401053-17401075 TCTATCAAAATAAACATGAATGG - Intronic
1170909733 20:20553819-20553841 TCTACAAAGAAAAACTTGGCTGG + Intronic
1171537880 20:25913307-25913329 TGTTTTAAGAAATAAATGGAGGG - Intergenic
1171726937 20:28632262-28632284 TCTATTTGTGAAAACATGGATGG + Intergenic
1171791011 20:29525527-29525549 TCTATTTGTGAAAACATGGATGG + Intergenic
1171803308 20:29648496-29648518 TGTTTTAAGAAATAAATGGAGGG + Intergenic
1171840813 20:30208618-30208640 TGTTTTAAGAAATAAATGGAGGG - Intergenic
1171856692 20:30351308-30351330 TCTATTTGTGAAAACATGGATGG - Intergenic
1172788057 20:37482524-37482546 TGTAAAAAGAAATACATGGATGG + Intergenic
1173520791 20:43698841-43698863 TCTAATAAAAAAAAAAGGGAGGG - Intronic
1174600073 20:51717344-51717366 TCTATTAAGGAAATCAGCGATGG + Intronic
1174903842 20:54528794-54528816 TATATAAAGAAGAAAATGGAAGG - Intronic
1175178662 20:57129413-57129435 TCTGAGAAGAAAAACAAGGAAGG - Intergenic
1175439254 20:58979451-58979473 TCTATAAAGAAAAAAAAGAAAGG - Intergenic
1175472755 20:59243615-59243637 TCTAGTCAGAGAAACAAGGAGGG - Intronic
1176581199 21:8528773-8528795 TGTTTTAAGAAATAAATGGAGGG + Intergenic
1177556031 21:22689931-22689953 TATATTAAGAATACCATGAATGG + Intergenic
1177882712 21:26713446-26713468 ACTAATAAGGAAAACATGCATGG + Intergenic
1178038681 21:28614580-28614602 GCTATTAAGAAAAACATGGTAGG + Intergenic
1178217393 21:30615188-30615210 TCTATCCAGAAAAACAGGGATGG - Intergenic
1179119488 21:38529662-38529684 TCCATTAAGATACACATGGCTGG + Intronic
1180581050 22:16838514-16838536 TTAATTAAGAAAAACATTTATGG - Intergenic
1182574071 22:31261143-31261165 TTAATTAAGAAAAACAGAGACGG - Intronic
1183809502 22:40242724-40242746 TATATTAAGAATAATAGGGACGG - Intronic
1183954953 22:41374107-41374129 GTTATTAAGAAAATCATGGCCGG + Intronic
1184979931 22:48089055-48089077 GCTATTTACAACAACATGGACGG + Intergenic
1185222373 22:49635590-49635612 TCTAATCAGAAAAACATTGGGGG - Intronic
949482526 3:4507463-4507485 TCTGTTCAGAAAAAAATGCATGG + Intronic
951596634 3:24325746-24325768 TCAATGAAGAAAAACAGGCAGGG - Intronic
952586230 3:34895869-34895891 TCATTGAAGAAAAACTTGGAGGG - Intergenic
956113224 3:65892018-65892040 TCTATTTAGAACAATATGGGAGG - Intronic
956126812 3:66018456-66018478 TCTATTAAAAAAAAAATGCCTGG - Intronic
957071336 3:75570206-75570228 TCAAAAAAGAAAAACATGAATGG + Intergenic
957320682 3:78626200-78626222 TCTAATAAGAGTAGCATGGATGG + Intronic
958461857 3:94407971-94407993 TCTATCAAGAAAATCTTGGAGGG + Intergenic
959734153 3:109638714-109638736 TCTATAAAGAATATCATTGACGG + Intergenic
960083568 3:113567044-113567066 ACTAATAAAAAAAACTTGGAAGG + Intronic
961161421 3:124730054-124730076 TCTATTTGGAGAAACATGGGGGG + Intergenic
961552133 3:127675573-127675595 ACTATTAAGAAAAACAAGCCTGG - Intronic
962734472 3:138313088-138313110 ACTATTAAGAAAAAAAAGGGAGG + Intronic
962922443 3:139963254-139963276 TCTTCCAAGAAAAACAGGGAGGG - Intronic
963726161 3:148923882-148923904 GCTATTATGAAAAACATAAAAGG + Intergenic
963941613 3:151101613-151101635 TCTCATAAGAAAAAGCTGGAAGG + Intronic
964016572 3:151954455-151954477 TGTAGTAATAAAAACTTGGAGGG + Intergenic
964169284 3:153749780-153749802 TCTATAATGAAAAACAAGAAAGG - Intergenic
964231708 3:154477768-154477790 TTTATTATGAAATCCATGGAGGG + Intergenic
964947078 3:162238813-162238835 TCTATTAAAAAAAACAATGTGGG + Intergenic
965144595 3:164884944-164884966 CCAATGAAGAAAAAGATGGATGG - Intergenic
965155580 3:165048915-165048937 TTTATTAAGAATGACATGGTAGG - Intronic
965379577 3:167971492-167971514 TATAGTAAAAAGAACATGGATGG + Intergenic
965392830 3:168126613-168126635 TCCATAAAGAAAAACAAGGATGG + Intergenic
965593143 3:170381224-170381246 TGTCTGCAGAAAAACATGGAAGG - Exonic
966213815 3:177480533-177480555 TGTATTAACACAAACATGGAAGG - Intergenic
967368560 3:188716367-188716389 TCAATTAAGATGAAAATGGAGGG + Intronic
967698388 3:192562450-192562472 AATAATAAGAAAAACATGAAGGG + Intronic
968211377 3:196851584-196851606 TGTATGAAGAAAATCATGGCTGG + Intergenic
969014945 4:4097867-4097889 TCAAAAAAGAAAAACATGAATGG + Intergenic
969738983 4:9010409-9010431 TCAAAAAAGAAAAACATGAATGG - Intergenic
969798182 4:9542031-9542053 TCAAAAAAGAAAAACATGAATGG - Intergenic
970095385 4:12458172-12458194 CCTATTAAGAAAGCCATTGAGGG - Intergenic
970279546 4:14439236-14439258 TTTATGTAGAAAAACAAGGAAGG + Intergenic
970457920 4:16244100-16244122 TCTTTTAACAAAAACAAGTAGGG + Intergenic
970942670 4:21653531-21653553 TCTATATAGAAATAGATGGATGG - Intronic
972859721 4:43152630-43152652 TCTATGAAGAAAGACATTGGTGG - Intergenic
972912566 4:43836114-43836136 TCTATTAAGAAGCAAATGCAGGG + Intergenic
973046946 4:45545859-45545881 TCTTTTGGGGAAAACATGGATGG + Intergenic
974178394 4:58355153-58355175 TCTAGAAAGAAAAAGAAGGATGG + Intergenic
974436866 4:61867817-61867839 TCTATTAACAAGAAGATGAAAGG - Intronic
974835409 4:67242742-67242764 TCTATTAAGAATAACATTATTGG - Intergenic
975504357 4:75122189-75122211 TATATTTAGAAAAGCATAGATGG - Intergenic
975735458 4:77376802-77376824 TCTAGTTAGAAAAACATTGCTGG - Intronic
976020519 4:80618504-80618526 TGTATTAGGAAAAAAATGAAGGG + Intronic
976405279 4:84655614-84655636 TGTATTGTGAAAAAGATGGAGGG - Intergenic
976586955 4:86809304-86809326 TCTATTAAGAAAAACATGGAAGG - Intronic
976615498 4:87071806-87071828 TCTATATAGAAAAGTATGGAGGG + Intronic
976620731 4:87124703-87124725 TCTATTTAGAAAAACATCAGTGG + Intronic
976637712 4:87304011-87304033 TCTATTAAAAAAAAAAAGGCTGG + Exonic
977857961 4:101918097-101918119 TCTAAGATGAAAAATATGGAGGG + Exonic
978277021 4:106964193-106964215 GCTATTGAAAACAACATGGATGG + Intronic
978848620 4:113306553-113306575 TTTATTGAGAAGAACCTGGAAGG + Intronic
979010331 4:115358735-115358757 TATATAAAGAATAACATGTATGG + Intergenic
979656346 4:123198773-123198795 TATATTAAGAAATACATTGCAGG - Intronic
981574564 4:146191186-146191208 TCTTTTAAGGAGAAAATGGATGG + Intronic
981912559 4:149998511-149998533 AATATTAAGAAAAACATTGGTGG + Intergenic
982306653 4:153939285-153939307 TCGATTAATAAACAAATGGATGG - Intergenic
982684320 4:158469781-158469803 TATGCAAAGAAAAACATGGATGG + Intronic
982732834 4:158974692-158974714 TTTATTCAGTAAAACATTGATGG + Intronic
983161528 4:164421783-164421805 TCTATCAATACAAACCTGGAGGG + Intergenic
984243342 4:177244533-177244555 TCTATTAAAAATACCCTGGAGGG + Intronic
984693847 4:182759110-182759132 TGTACCAAGAAAAACATGTAAGG - Intronic
985309117 4:188577815-188577837 TATATTAAAAATAAAATGGAAGG - Intergenic
985433688 4:189906713-189906735 TCTATTTGTGAAAACATGGATGG - Intergenic
987228765 5:15870544-15870566 TTTAGTAAGAAAAAGATGGTGGG + Intronic
987839475 5:23204440-23204462 GCTATTGAGAAAAACAAAGAAGG - Intergenic
988358560 5:30206971-30206993 ACTACCAAGAAGAACATGGATGG + Intergenic
988695386 5:33616555-33616577 TTCATTAAGAAAATCCTGGAGGG + Intronic
988816279 5:34838191-34838213 TCTCTTAAGTAAAACCTGTATGG - Intergenic
988962351 5:36382897-36382919 TCTATTAAGAAGAAAAAAGAAGG - Intergenic
989015131 5:36922188-36922210 ATTTTTAAGAAAAACATTGAAGG - Intronic
989028545 5:37092842-37092864 TCCCATAAGGAAAACATGGATGG - Intergenic
989202588 5:38779206-38779228 TCTATTAAAAAGTACATAGAGGG - Intergenic
989239541 5:39188404-39188426 TCTTTTAAGAAAAATATCTATGG + Intronic
989274978 5:39577867-39577889 GCTATACAGAATAACATGGATGG + Intergenic
989462521 5:41716916-41716938 GCCATTAAGAAAATCATTGAGGG - Intergenic
989627969 5:43450290-43450312 TCTATTAATAAAAAAATCAAAGG - Intronic
989945936 5:50229979-50230001 TCAAATAAAAACAACATGGAAGG - Intergenic
990049413 5:51478529-51478551 TCTAGTAATAAAAAAAAGGATGG - Intergenic
990620238 5:57550862-57550884 TCTAATAAGAATCACCTGGAGGG - Intergenic
990819671 5:59823787-59823809 TATCTTAAAAAAAAAATGGAAGG - Intronic
991330371 5:65486468-65486490 TTTATGAAGAAAAAAATGAATGG - Intergenic
991481369 5:67084171-67084193 TATAGAAAGAAAAACATGTAGGG - Intronic
992001985 5:72444842-72444864 TCTATTAAAAAATATTTGGAAGG + Intronic
992808073 5:80358355-80358377 TCTCTTGAAAAAAACAAGGAAGG - Intergenic
993262587 5:85678875-85678897 TATATTTACAATAACATGGATGG + Intergenic
993322769 5:86494465-86494487 TCTTTTGTGAAAAACATGAATGG - Intergenic
993558946 5:89379491-89379513 TCAATTAAAAAATACAAGGATGG + Intergenic
994555299 5:101292088-101292110 CCTAATATGAAAAACAGGGAAGG - Intergenic
995043347 5:107615372-107615394 TCTATTTAAAAAAACATTCAGGG + Intronic
995139856 5:108723167-108723189 AATATTAAGAAAAAGATCGAAGG + Intergenic
995336571 5:111006069-111006091 TCGATTCAGAAAAAAAGGGAAGG - Intergenic
995669109 5:114580208-114580230 TTTATAAAAAAATACATGGATGG + Intergenic
996020947 5:118589955-118589977 TCTATTAGCAAAGACATGGTGGG + Intergenic
996094636 5:119385266-119385288 CCAATTAAGAACAGCATGGATGG - Intronic
996614072 5:125418904-125418926 TCTATTAAGAAGAAAATTGGGGG + Intergenic
997873216 5:137523300-137523322 GCTATTAAGAAAAAAATTGCAGG + Intronic
997947533 5:138215582-138215604 ACTATAAAGAAAAATATGGGAGG + Intergenic
998031020 5:138868046-138868068 GTTATTAAGAAAATCATGGTGGG - Intronic
998360780 5:141584867-141584889 TGAATTGAGAAAAATATGGATGG + Intronic
998839575 5:146239086-146239108 TCCATTGACAAAAACAGGGATGG - Intronic
999105958 5:149071454-149071476 TATAATAAGAAATACATGGTGGG + Intergenic
999614104 5:153404151-153404173 TCTAAAAAGAACAATATGGACGG + Intergenic
999988605 5:157028329-157028351 TCTATTAAGAAAAAAATTTAAGG - Intergenic
1000476538 5:161715206-161715228 GATATTAAAAAAAACATGGCCGG + Intergenic
1000497050 5:161997425-161997447 GTTATTTACAAAAACATGGATGG + Intergenic
1000705908 5:164511760-164511782 TCTCATCAGAAAAACATGTAGGG + Intergenic
1000707951 5:164534792-164534814 TCTATTAAGTAAATTATGCATGG - Intergenic
1000874142 5:166614980-166615002 TCTATTAGTAAAAACAAGCATGG + Intergenic
1001464402 5:171950587-171950609 TCTATTCAAAAAAAAATGGCTGG + Intronic
1003214188 6:4094115-4094137 GTTATTAAGAAAATCATGGCCGG - Intronic
1003363847 6:5454191-5454213 TCTAAAAAAAAAAAAATGGAGGG - Intronic
1003408784 6:5845193-5845215 TCTATTAACAAGGAAATGGAGGG + Intergenic
1003521181 6:6860058-6860080 TTTAAGAAGGAAAACATGGAAGG - Intergenic
1003556950 6:7148483-7148505 TCAATTGAGAAAAACAAGCATGG + Intronic
1003577414 6:7310391-7310413 CCCATTAAAAATAACATGGAAGG - Intronic
1003635670 6:7829358-7829380 TATATGAAGAAAAACCTTGATGG + Intronic
1003765576 6:9232889-9232911 GCCATTAAGAAAATCATTGAGGG + Intergenic
1003794126 6:9580997-9581019 TTTATAAAGAAAAACATGAAAGG - Intergenic
1004683551 6:17919924-17919946 TCTATTAAAATACTCATGGAAGG + Intronic
1006704184 6:36003252-36003274 TCTATAAAGAAAAACATTTCAGG - Intronic
1007033910 6:38655238-38655260 TCTAATAAGAAAAATATGAAAGG + Intergenic
1007347016 6:41238755-41238777 CCAATTAAAAAAAAAATGGAAGG + Intronic
1007863111 6:44935649-44935671 ACTATTAATACAAAAATGGAAGG - Intronic
1009043207 6:58206802-58206824 TCTGTTAAGAAAGACTAGGAAGG + Intergenic
1009191753 6:60637728-60637750 TCTATTAAAAAAAAAATGGCTGG + Intergenic
1009219048 6:60961050-60961072 TCTGTTAAGAAAGACTAGGAAGG + Intergenic
1009704570 6:67230270-67230292 TCTATCAACAAAAGAATGGATGG + Intergenic
1009981406 6:70730078-70730100 TCTAGTCAGAAAAAAAAGGAGGG - Intronic
1010728145 6:79358870-79358892 TCTATTTGGAAAAATCTGGAAGG + Intergenic
1011440951 6:87386716-87386738 CCTATTAAGAAAAAAAAGCAGGG + Intronic
1012521439 6:100126107-100126129 TAAATTAAGAAAGAAATGGAGGG + Intergenic
1012731913 6:102893930-102893952 TGAATTGAGAAAAACAGGGAGGG - Intergenic
1012967424 6:105689637-105689659 TTTAATAATAGAAACATGGAGGG - Intergenic
1012975810 6:105779880-105779902 TCAATTAAAAAAAACCTGCAGGG + Intergenic
1013828871 6:114249270-114249292 TCGAATAAGAAAAACATGTAAGG - Intronic
1014030973 6:116703947-116703969 TCTATTTACACAAACCTGGATGG + Intronic
1014356311 6:120414989-120415011 TCTATTAAGAAAAACTTTATTGG + Intergenic
1014640147 6:123899412-123899434 TCTAAAAAGAAAAAAATAGAGGG - Intronic
1014978518 6:127919068-127919090 ACCATTTAGTAAAACATGGAAGG - Intergenic
1015029978 6:128583550-128583572 TAAATTAAGAAAAAAATGTAGGG - Intergenic
1015254925 6:131168113-131168135 TTTATTAAGAAAAATGTGGCTGG + Intronic
1015440999 6:133245946-133245968 TTTACTAATAAAAAGATGGATGG - Intronic
1015702265 6:136049399-136049421 TTTGCTTAGAAAAACATGGAGGG - Intronic
1015747349 6:136524266-136524288 ATTATTAAGAATAAAATGGATGG + Intronic
1015949232 6:138534791-138534813 TGCATTAAGGAAAAGATGGAGGG + Intronic
1016133801 6:140512478-140512500 TCTATAAAGAAAAAACTGGCTGG + Intergenic
1016807972 6:148232273-148232295 TTTATTAATAAGAATATGGAAGG + Intergenic
1016912732 6:149215124-149215146 TTTTTTAAGAAAAACAGTGAAGG - Intergenic
1017211075 6:151857167-151857189 ACTATTTGGAAAAAAATGGATGG + Intronic
1017287535 6:152693710-152693732 TCTATTGAGAAAATCGTGTATGG - Intergenic
1017404429 6:154103035-154103057 ACTATTAAGAAAAAAATTAAAGG + Intronic
1018048636 6:159988213-159988235 TCTTTTAAGAAAAGCATAGCAGG + Intronic
1018211769 6:161489144-161489166 TCTATTAAGAAAAGGAAGGAAGG - Intronic
1018272477 6:162095045-162095067 ACTATGAAGAAAAACAAAGAAGG + Intronic
1018327689 6:162691049-162691071 TCTATTTTGAAAAAGATGAATGG - Intronic
1020189074 7:5980782-5980804 TCTATTAAGAGGAACAGGGAAGG + Intronic
1020293842 7:6743971-6743993 TCTATTAAGAGGAACAGGGAAGG - Intergenic
1020491025 7:8784514-8784536 TGTATTAAAAAAATCATGGCAGG - Intergenic
1020947525 7:14631823-14631845 TATATTATGATAAAGATGGAAGG - Intronic
1021136680 7:16972881-16972903 TCTATTAAGAAAATCAAGGCTGG - Intergenic
1021300101 7:18962116-18962138 TCTAATCAGAAAAAAATGCAAGG + Intronic
1021482707 7:21135482-21135504 CCTTTTAAGAAAATCATTGAGGG + Intergenic
1021719470 7:23491643-23491665 ACTTTTAAGAATAACATGAATGG - Intergenic
1021837449 7:24693996-24694018 TCTTTAAAAAAAAAAATGGAGGG + Exonic
1022130915 7:27403653-27403675 TGGATTAAGAAAAACATTGGAGG - Intergenic
1024949720 7:54847334-54847356 TGTTTTAAGAAAATCAGGGATGG - Intergenic
1025289331 7:57700136-57700158 TGTTTTAAGAAATAAATGGAGGG - Intergenic
1025292906 7:57746932-57746954 TCTGTTAAAAAAAAAATGGCTGG - Intergenic
1026180637 7:68036461-68036483 TTTCATAAGAAAAACATTGAAGG - Intergenic
1027695973 7:81411262-81411284 TTTTTCAAGAGAAACATGGAGGG + Intergenic
1028305655 7:89260410-89260432 CCCATTAAGAAAATCATTGAGGG - Intronic
1028453834 7:91016937-91016959 CCTATTAAGAAAAAGAAGAAAGG + Intronic
1028814079 7:95124025-95124047 TCTATTAATAAGAAAATTGAGGG + Intronic
1028908458 7:96180623-96180645 TGTATTAAGAGAAATATGGCCGG - Intronic
1029073621 7:97919516-97919538 TCAAAAAAGAAAAACATGAATGG + Intergenic
1029905487 7:104088889-104088911 CAAATTAAGAAAAACATAGAAGG - Intergenic
1030546699 7:110905308-110905330 TTTATTAAGAATAACATGCTAGG + Intronic
1030662343 7:112234168-112234190 ACTTTTAAGAAATACAAGGATGG - Intronic
1030766327 7:113414196-113414218 TCTTTTAGGAAAAATATGGTGGG - Intergenic
1030963775 7:115962762-115962784 TCTCTTAAGAAATACATGATCGG - Intronic
1031429884 7:121654372-121654394 TTTATCAAGAAAAAAATGGATGG + Intergenic
1031474034 7:122201145-122201167 TCTATTGAGCAAAATAAGGAAGG + Intergenic
1032188273 7:129746474-129746496 TATATGAAGAAAAACAGGCATGG - Intronic
1032683958 7:134211625-134211647 TCTATTCAGAGAAAGAAGGAAGG - Intronic
1033930323 7:146511192-146511214 TATATTAAGAAAAACCTGGCTGG - Intronic
1033950195 7:146775505-146775527 TCTATAAATAAAAAAATGAAAGG + Intronic
1033994098 7:147323936-147323958 TCTATTAAAAATAATGTGGATGG + Intronic
1034979595 7:155467473-155467495 ATTATTAATAAAAACATGAATGG - Intergenic
1036244073 8:7101749-7101771 TCAAAAAAGAAAAACATGAATGG - Intergenic
1036897770 8:12649678-12649700 TCAAAAAAGAAAAACATGAATGG + Intergenic
1037789328 8:21922544-21922566 TATGTTAAAAAAAACATGAAAGG - Intronic
1037929621 8:22870769-22870791 TCTATTGAGAAAAAGTTGAATGG + Intronic
1038332260 8:26618314-26618336 TCTATTAAGAAAAAAAAAAAAGG - Intronic
1038718656 8:30013647-30013669 TCTAATAGGAAAAACAAGGCAGG + Intergenic
1038949241 8:32396163-32396185 TCTAAAAAGAAAAACATTGGGGG - Intronic
1039171839 8:34756369-34756391 TCTTTTAAGAAAGACATAGTGGG - Intergenic
1039773184 8:40709457-40709479 GCCTTTAAGAAAAAGATGGAAGG + Intronic
1042096866 8:65225790-65225812 TCTATTAAGATATAAAAGGAGGG - Intergenic
1043418502 8:80075541-80075563 TCCATTTAGAAATACCTGGAAGG - Intronic
1043695531 8:83211307-83211329 TGTATAATGAAAAACATAGATGG + Intergenic
1046350354 8:113001586-113001608 GCTATAAAGGAAAAAATGGAAGG - Intronic
1046510119 8:115191618-115191640 ACTAGTAAGAAAACAATGGAAGG + Intergenic
1046618603 8:116503659-116503681 GCTATGAAGAAAAGCATGGCAGG + Intergenic
1046864343 8:119129238-119129260 GCTAGAAACAAAAACATGGATGG + Intergenic
1047863634 8:128996385-128996407 TTTATTATGAAAAACATAGGAGG + Intergenic
1048675982 8:136780810-136780832 ACTATTAAGAAAGACTTGGGAGG - Intergenic
1049959620 9:726049-726071 TGTATTAGAAAAATCATGGAAGG - Intronic
1050228866 9:3494753-3494775 TCTATTAAGCAAGACATTAATGG - Intronic
1052058518 9:23930753-23930775 TTTATTATGAAAAACATTGCAGG + Intergenic
1052112292 9:24601451-24601473 TTTATTTTGAAAAAAATGGAAGG + Intergenic
1052769102 9:32671278-32671300 TCTGTTATGAAAAACATACATGG + Intergenic
1053557476 9:39152960-39152982 TCTTTTAAGAATAACCTGGCTGG - Intronic
1053722807 9:40964839-40964861 TCTATTTGTGAAAACATGGATGG - Intergenic
1053821586 9:41973241-41973263 TCTTTTAAGAATAACCTGGCTGG - Intronic
1054139639 9:61465989-61466011 TCTTTTAAGAATAACCTGGCTGG + Intergenic
1054343161 9:63887161-63887183 TCTATTTGTGAAAACATGGATGG + Intergenic
1054608983 9:67214172-67214194 TCTTTTAAGAATAACCTGGCTGG + Intergenic
1055033054 9:71790055-71790077 TCCATTAATGATAACATGGAAGG + Intronic
1055628550 9:78199445-78199467 TCTTTTCAGAAAAACATGGATGG + Intergenic
1056184669 9:84121941-84121963 TCTAGTTAGAGAAAGATGGATGG + Intergenic
1057510234 9:95672473-95672495 TATATTAAAAAAAAACTGGAGGG + Intergenic
1058069965 9:100591910-100591932 TCTAATATGACAGACATGGAGGG - Intergenic
1058145614 9:101407795-101407817 TCTATCAAGGAAAACAGGGTAGG - Intronic
1058306492 9:103448522-103448544 TCTAGGAAGCACAACATGGAAGG + Intergenic
1058596734 9:106623082-106623104 TCAATTAAAAAAAAAATGTATGG - Intergenic
1058977020 9:110134275-110134297 TCTCTTAAAAAAAAAAAGGAAGG + Intronic
1059080774 9:111247015-111247037 TGTATTAATAACAACATGGTTGG + Intergenic
1059505401 9:114794629-114794651 TCTATCAAGATATAGATGGAAGG + Intronic
1060132565 9:121118733-121118755 TATATTAGGAAAAAAAAGGATGG + Intronic
1203697307 Un_GL000214v1:110700-110722 TCTAATACCAAAACCATGGAAGG + Intergenic
1203452355 Un_GL000219v1:131141-131163 TCTATTTGTGAAAACATGGATGG + Intergenic
1203490845 Un_GL000224v1:103099-103121 CCTATAAACTAAAACATGGATGG - Intergenic
1203503469 Un_KI270741v1:44977-44999 CCTATAAACTAAAACATGGATGG - Intergenic
1203611218 Un_KI270749v1:6818-6840 TGTTTTAAGAAATAAATGGAGGG + Intergenic
1185797335 X:2977649-2977671 GCTATGAAGAAAATCATGGCCGG - Intergenic
1185933721 X:4232197-4232219 TCTATCATGCAAAAAATGGAGGG - Intergenic
1186751653 X:12627857-12627879 TTTATTAAGAAAAAAATGGAAGG + Intronic
1186928732 X:14363657-14363679 TTTATGAAGAAAAATATGGAAGG - Intergenic
1187052194 X:15705984-15706006 GCTATAAAGAAAAATAGGGAGGG + Intronic
1187084120 X:16023964-16023986 TCTCTTACCCAAAACATGGACGG - Intergenic
1187582869 X:20627394-20627416 TCTGTAAAGAAAATGATGGAGGG - Intergenic
1187942606 X:24396550-24396572 TTTTTTAAGAAAAATTTGGAGGG - Intergenic
1188388116 X:29586694-29586716 TCTATTAAAAAAAATAAGCAAGG - Intronic
1188561839 X:31477279-31477301 TATAGGAAGAAGAACATGGATGG + Intronic
1188710241 X:33387885-33387907 TCTTGTAAGAAAAAAAAGGAGGG + Intergenic
1188827094 X:34849095-34849117 TCTATTAAGGAAAATAGTGATGG - Intergenic
1189540753 X:41985409-41985431 ACTATTTAGAAAAACATGTATGG + Intergenic
1190608156 X:52166485-52166507 ACTATTAAGAAAATCATTGAGGG + Intergenic
1191004782 X:55699756-55699778 TCTATTAAGTAAAACAAAAATGG + Intergenic
1192505416 X:71678530-71678552 CCTATAAAGACAAACATAGATGG - Intergenic
1193401512 X:81050114-81050136 TCTATTAAGCTAAACATTAAGGG + Intergenic
1194017053 X:88635994-88636016 TCTATCAACAAAAAAATGGATGG + Intergenic
1195280164 X:103325142-103325164 TCTATACATAAAAACATGGATGG - Intergenic
1195371948 X:104184939-104184961 TCTATTAAAAAAAAAAAGAAAGG - Intronic
1196814213 X:119652218-119652240 TCCTTTAAGAAAAACTTGGCTGG - Intronic
1196978299 X:121184181-121184203 AATATTAAGAAAAAAATGTAGGG - Intergenic
1197339896 X:125254690-125254712 TCTATTGAGAAATACAGGCAAGG - Intergenic
1198010398 X:132546932-132546954 TCTGGAAACAAAAACATGGAAGG - Intergenic
1198441772 X:136670397-136670419 GATATTCAGAAAAAAATGGATGG - Intronic
1199362452 X:146938261-146938283 TCTATTCTGAAAAACAGAGAAGG - Intergenic
1201664278 Y:16431541-16431563 TCTGTGAAGAAAATCATTGATGG - Intergenic
1201939975 Y:19448903-19448925 TCTCTTAAGGAAAAGATGGCTGG - Intergenic
1202043041 Y:20706027-20706049 TCTATTCTGAAAAACAGAGAGGG + Intergenic