ID: 976589809

View in Genome Browser
Species Human (GRCh38)
Location 4:86837880-86837902
Sequence CTCCCTCTCCTTTGTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976589809_976589812 -2 Left 976589809 4:86837880-86837902 CCTGCTCTACAAAGGAGAGGGAG 0: 1
1: 0
2: 0
3: 19
4: 186
Right 976589812 4:86837901-86837923 AGGAGGCCCTTCATACGTCAAGG 0: 1
1: 0
2: 0
3: 1
4: 70
976589809_976589815 18 Left 976589809 4:86837880-86837902 CCTGCTCTACAAAGGAGAGGGAG 0: 1
1: 0
2: 0
3: 19
4: 186
Right 976589815 4:86837921-86837943 AGGTCTTCTGCATAGACAGAAGG 0: 1
1: 0
2: 0
3: 19
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976589809 Original CRISPR CTCCCTCTCCTTTGTAGAGC AGG (reversed) Intronic
900252044 1:1675990-1676012 GTCCCTCTCGTTACTAGAGCGGG - Intronic
900262455 1:1738848-1738870 GTCCCTCTCGTTACTAGAGCGGG - Intronic
900352368 1:2241363-2241385 CTCCCTCTCCTATTTTGAGGGGG + Intronic
901873437 1:12152174-12152196 CTCCCAGACCTTTGTACAGCAGG - Intergenic
908419472 1:63945901-63945923 GTCCCTCTACTTTGGAGAACTGG + Intronic
909162494 1:72171136-72171158 TTCCCTCCCCTTTCCAGAGCAGG + Intronic
911264951 1:95732410-95732432 CTCCCTCTCTCTTCTTGAGCTGG + Intergenic
912322601 1:108728201-108728223 CTGCCTCTCCTTCGTACAACGGG - Intronic
913196514 1:116460812-116460834 CTCCCTCTACCTTGTAGGGTGGG - Intergenic
913227316 1:116711565-116711587 TTCTCTCTCCCTTCTAGAGCAGG + Intergenic
915496136 1:156284089-156284111 CTCCCTCTGCTTTCCTGAGCTGG + Intronic
915535343 1:156532024-156532046 CTCCCTCACTTTTGTAGAACTGG + Intronic
915969806 1:160346533-160346555 CTCCCAGTGCTTTGTATAGCAGG - Intronic
916568493 1:166004369-166004391 CTAGCTCTTCTTTGTAGAACTGG + Intergenic
917660208 1:177170776-177170798 CGCTCTCTCCTTTGGTGAGCTGG - Intergenic
919272162 1:195361242-195361264 TTCCCTCTCCTTTCTAAAGGTGG - Intergenic
922299833 1:224288665-224288687 CAGCCTCTACTTTATAGAGCAGG - Intronic
922862805 1:228833954-228833976 CTCCATCGCGTTTGGAGAGCCGG + Intergenic
923212489 1:231816971-231816993 CTCCCTCTCCTTCTTTGAGGTGG + Intronic
1063162827 10:3431953-3431975 CTCCCTCTCATCTGTGGAGATGG + Intergenic
1064160658 10:12942809-12942831 CTCTCTCTCCTTTGGAGAGAGGG - Intronic
1068072567 10:52214157-52214179 TTCACACTCCTTTGTAGAGTAGG - Intronic
1068329745 10:55547448-55547470 TTCCCTCTCCTTTGTTAATCTGG - Intronic
1068423633 10:56827175-56827197 CTAGCTCTCCTTTGTACATCTGG - Intergenic
1069166512 10:65167039-65167061 CTCACTCTCCTGAGTAGCGCTGG - Intergenic
1069932368 10:71891405-71891427 GTCTCTCTCCCTAGTAGAGCTGG - Intergenic
1069989875 10:72308648-72308670 CTCCCTTCCCTCTGTGGAGCTGG - Intergenic
1071386013 10:85122015-85122037 CTCACACTCCTTTGTACAACAGG + Intergenic
1071731490 10:88253135-88253157 CTGGGTCTACTTTGTAGAGCGGG + Intergenic
1072467868 10:95683503-95683525 CTCAGTATCCTTTTTAGAGCTGG - Exonic
1072798334 10:98373999-98374021 CTGACTCTACTTTGTAGATCTGG + Intergenic
1075075542 10:119347958-119347980 CTGCCCCTCCTTTGTGGAGAAGG - Intronic
1077939654 11:6827240-6827262 CTACCTCTACATTGTAGAGAAGG - Intergenic
1079368225 11:19827948-19827970 CTTCCTCCCCTTGGTAGAGACGG - Intronic
1079422878 11:20310873-20310895 CTCCCTCGCCTTTGTGAAGCAGG - Intergenic
1081677043 11:44976091-44976113 CTCCCTGTCCTCTGTAGCCCAGG - Intergenic
1082720077 11:56663877-56663899 CAACCTCTCCTTTGTTGACCTGG + Exonic
1083779794 11:64911902-64911924 CTCCCTCTCCGATGTAGACCTGG - Exonic
1084346234 11:68551409-68551431 CACCATCTCCTTTCTAGAGCCGG + Intronic
1085348762 11:75784819-75784841 TTCCCTCACCCCTGTAGAGCAGG - Intronic
1086928591 11:92667781-92667803 CACTCACTCCTTTGTGGAGCTGG + Intronic
1087637185 11:100715310-100715332 GTCCTTGTCCTTTGTAGAACAGG + Intronic
1092879923 12:12880148-12880170 CTCCCTATCTTCTGTAGTGCAGG - Intergenic
1095480269 12:42627327-42627349 CTTCCTGTCCTTTGGAGAGTAGG - Intergenic
1098146087 12:67499155-67499177 CTCCCTCTCATTTCCTGAGCAGG - Intergenic
1100016329 12:90015277-90015299 CTCCTCCTCCTATGTAGAGTGGG + Intergenic
1100909176 12:99338569-99338591 TTCCCTCTCCTTTCTTAAGCAGG + Intronic
1101814679 12:108136826-108136848 CTCCCTCTCATTTGTTAACCTGG + Intronic
1103698799 12:122836662-122836684 CTCCCACTCCTGTCTAAAGCAGG + Intronic
1105588656 13:21769800-21769822 TTCCCTCTCCTTTTTCGATCTGG + Intergenic
1106978149 13:35247028-35247050 CTGCCTCTCCTGTGTCAAGCAGG + Intronic
1109189339 13:59306750-59306772 CTCCCTCTCACTTGCAGACCTGG - Intergenic
1111468764 13:88648868-88648890 CTCTTTCTCCTTTCTAGAACTGG + Intergenic
1112367066 13:98764304-98764326 CTCCATCTCCTATGGAAAGCAGG + Intergenic
1114416509 14:22548436-22548458 CTCCCTGCCCTTGGTAGGGCTGG - Intergenic
1116105322 14:40495294-40495316 CTCTCTCTCTTTTCTTGAGCTGG + Intergenic
1118074354 14:62282042-62282064 CTCCATCCCCTTTATAGAGGAGG + Intergenic
1119272737 14:73323982-73324004 CTCCTTCTCCCCTGAAGAGCAGG + Intronic
1119975355 14:79018599-79018621 CTCACTCTCCTTTACAGAGTAGG + Intronic
1120209985 14:81624439-81624461 CTCCCTCACCATTCTAGGGCTGG - Intergenic
1128033199 15:64499880-64499902 CTCCTTCTCCTTTTTGGAACCGG - Exonic
1129233526 15:74209721-74209743 CTCCCTCCCCTTCCTAGAGGGGG + Intronic
1132614276 16:832439-832461 CTCTCTCTTTTTTTTAGAGCTGG + Intergenic
1133802086 16:9092257-9092279 CGGCCTCACCTTTGTAGAGCTGG - Exonic
1135061226 16:19272827-19272849 CTCTCTCTCCTTTCCAGAGTGGG - Intergenic
1136297711 16:29313114-29313136 TTCCCTCCCCTCTGAAGAGCGGG + Intergenic
1136399319 16:30009323-30009345 CTCCATCCCTCTTGTAGAGCTGG + Intronic
1137552636 16:49450970-49450992 CTCCCACTTCTTTGCACAGCTGG + Intergenic
1137584094 16:49653666-49653688 CTCTCTCTCCTTTGCAGGGAGGG + Intronic
1139665039 16:68449075-68449097 CTCCCTCACCTTTGCTGGGCAGG - Intergenic
1140807327 16:78545003-78545025 CTCTCTCTCTTTTGTAAAGCTGG - Intronic
1141608161 16:85167319-85167341 CTCCCTTTCCTCTCTAGAGCAGG - Intergenic
1141676649 16:85521309-85521331 CGCGCTCACCTTTGTAGAGGAGG + Intergenic
1142059265 16:88019192-88019214 CTCCGTCCCCTCTGAAGAGCGGG + Intronic
1142073278 16:88103146-88103168 CCCCCTCCCCTGGGTAGAGCAGG + Intronic
1143849227 17:9797172-9797194 CTCCCTATTTTTTGTAGAGAGGG + Intronic
1146455710 17:33008211-33008233 CTCCTTCCCTTTTGTAGAGGAGG + Intergenic
1147306745 17:39569362-39569384 TTCCCTCTTCTCTGCAGAGCAGG - Intergenic
1147384094 17:40071629-40071651 CTCCCTCGCCTCTGCAGAGGAGG + Intronic
1148804224 17:50256215-50256237 CTCACTCTCCCTTGCTGAGCTGG + Intergenic
1149584994 17:57780455-57780477 CTCCCTCTCTCTTGAAGAGCTGG - Intergenic
1151223489 17:72631386-72631408 CTTCCTGTCCTTTGTAGCTCAGG - Intergenic
1151642796 17:75408398-75408420 CTCCCTCTCCTCTGCAAAGATGG - Intergenic
1151813102 17:76456632-76456654 CTCCCTCTCCTGTAGAGACCTGG + Intronic
1152731677 17:81975130-81975152 CTCCTTCTCCTTTTTTGAGACGG + Intergenic
1158386666 18:57001035-57001057 CTCTCTCTCTTTTGTAGAGATGG - Intronic
1158516192 18:58132041-58132063 CTCCTTCTCCTTTCTGAAGCAGG + Intronic
1161040430 19:2108292-2108314 CTCCCTCTCCTGAGTACTGCAGG - Intronic
1165017309 19:32890578-32890600 CTCCCTCTCCTTCATTGCGCGGG - Intronic
1165063391 19:33215836-33215858 CTCCCTCTGCTATGCAGAGCTGG - Exonic
1165945276 19:39437960-39437982 CCCCCTCACCCTTTTAGAGCTGG - Intronic
1166717260 19:44976489-44976511 CTCCCTATCTTTTTTAGAGATGG - Intronic
1167163028 19:47779972-47779994 TTGCCTCTGCTTTGTCGAGCAGG - Intronic
925805851 2:7646944-7646966 CACCCTCTCCCGTGTAGATCTGG - Intergenic
925988119 2:9232171-9232193 GTCCTTCTCCTTTGTTGACCTGG + Intronic
926681063 2:15664729-15664751 GGCCGCCTCCTTTGTAGAGCAGG + Intergenic
927297016 2:21466378-21466400 CTCCCAGTCCTTTATAGAACAGG - Intergenic
932506391 2:72236141-72236163 GTTCCTCTCCTTACTAGAGCAGG + Intronic
932572112 2:72943531-72943553 CTCCCTCCCATTTGCAGACCAGG - Exonic
932736691 2:74259474-74259496 CTCCCACTCCTTTGTAGGAGTGG + Intronic
935340275 2:102053484-102053506 CTCCCTCCTCTTTGTGGAGAGGG + Intergenic
937199066 2:120185425-120185447 CTTCCTCTCCTGTGCAGGGCCGG + Intergenic
937221906 2:120346686-120346708 CTCCCTCTCCTTGCTAGCTCCGG + Intronic
937463727 2:122111359-122111381 CTCCCTTTCCTTTCCAGTGCTGG + Intergenic
938692551 2:133805576-133805598 CACCCTCTCCTTTGTATTGAAGG + Intergenic
938982593 2:136540575-136540597 CTCCCTCTCCCTTCTTGAGCTGG - Intergenic
939440135 2:142237252-142237274 CTGCCTATATTTTGTAGAGCAGG - Intergenic
940598456 2:155825870-155825892 TTTCCTCTCCATTCTAGAGCTGG + Intergenic
940840275 2:158571860-158571882 CTCCCGCTCCTTTGATGAGCAGG - Intronic
941203682 2:162545451-162545473 CTCCCTCTCCTTAGGTGACCTGG - Intronic
941418575 2:165253250-165253272 TTCTATCTCCTTTCTAGAGCTGG + Intronic
944329406 2:198447674-198447696 CTCCAGCTCTTTTGTAGAGCAGG + Intronic
944383524 2:199139427-199139449 ATCACTCTCCTTTGTAGAGTAGG + Intergenic
944825996 2:203483777-203483799 CTCCCTATCCTTCCTAGAGGTGG + Intronic
944920814 2:204411313-204411335 CTCCTTCTTCTTTGTACACCTGG - Intergenic
945051071 2:205824952-205824974 CTCCCTCCCTCTTGTAGAGATGG - Intergenic
945971509 2:216235738-216235760 CTCCCTCTTTGTTGAAGAGCAGG + Intergenic
1168873546 20:1152618-1152640 CTCTGGCTCCTTTGTAGAGATGG + Intronic
1170575412 20:17658965-17658987 CTCCCTCTCCTTTTTGGCCCTGG + Intronic
1173904094 20:46613418-46613440 CTGCCTCTCCGCTGTAGGGCTGG + Intronic
1174330036 20:49810781-49810803 CTCTCAATCCTTTGTAGACCAGG + Intergenic
1174461685 20:50687506-50687528 CTCACTTTCCCTTGGAGAGCTGG - Intronic
1174528877 20:51195272-51195294 CTTCCTCTCCTTCATAGAGCTGG + Intergenic
1175819120 20:61898992-61899014 CTCCCTCTTCTTTTAACAGCTGG - Intronic
1175987726 20:62772245-62772267 CTCTCCCTACTTTGTAGACCTGG + Intergenic
1176070545 20:63224059-63224081 CTCCCTCTGCTGCGTGGAGCTGG + Intergenic
1179186027 21:39085847-39085869 CTTCTTCACCTTTGGAGAGCAGG - Intergenic
1179633880 21:42695158-42695180 CTTCCACTCCCTTTTAGAGCTGG + Intronic
1179795215 21:43778542-43778564 CTCACTCTCCTTGCTGGAGCTGG + Intergenic
1183483073 22:38075395-38075417 CTCCCTCTCCTTCCTAAGGCAGG - Exonic
1183508522 22:38222158-38222180 CTCCCTCTACTCTGGAGATCAGG + Intronic
951036463 3:17938325-17938347 CTCCACCCCCTTGGTAGAGCAGG - Intronic
952353451 3:32562821-32562843 CTCCCTATCCTTTGAAGTGGTGG - Intronic
954148107 3:48644236-48644258 CTCCCTCTGCCCTGTGGAGCAGG + Exonic
954358019 3:50098877-50098899 CTCCCTGTCCTTTGTTCTGCAGG - Intronic
957843659 3:85702323-85702345 CTCCCTCAAATTTGTACAGCTGG + Intronic
959728540 3:109573758-109573780 TTCTCTCTCCCTTTTAGAGCAGG + Intergenic
960839794 3:121945446-121945468 CTCTCTCTCTTTTTTAGAGATGG - Intergenic
963008498 3:140748508-140748530 CTCCCTCTCCCCTGTCCAGCAGG - Intergenic
963065672 3:141261806-141261828 TTCCATCTGCTTTTTAGAGCAGG - Intronic
969615410 4:8249597-8249619 CTCCCTGTCTGCTGTAGAGCTGG - Intergenic
972686471 4:41358516-41358538 CTCCCTCTGTTTTGGACAGCAGG + Intergenic
976589809 4:86837880-86837902 CTCCCTCTCCTTTGTAGAGCAGG - Intronic
976748202 4:88427151-88427173 TTATCTCTCCTTTGGAGAGCAGG - Intronic
976875163 4:89845330-89845352 CGCTCTCTCCATTGTAGAGAGGG + Intergenic
982490059 4:156018982-156019004 CACCACATCCTTTGTAGAGCAGG - Intergenic
987168032 5:15221172-15221194 GTCACTCTCCATTGTAAAGCAGG - Intergenic
988377333 5:30454202-30454224 TTGCCTCTTCCTTGTAGAGCTGG - Intergenic
991330457 5:65487461-65487483 ATCCCTATCCTTTGTAAAGCTGG + Intergenic
994783377 5:104121490-104121512 CTCCCTGTATTTTGCAGAGCAGG - Intergenic
995477316 5:112561335-112561357 CTCTCTTTCCTTTGGAGTGCAGG + Intergenic
996884322 5:128338080-128338102 AACCCTCTCCTTTGTAGGGGTGG - Exonic
998157156 5:139793512-139793534 CCCCCTGTCCTTTGTAGCTCTGG - Intergenic
1002302246 5:178263648-178263670 CCCCCTCTTCTTTCTAGAACGGG + Intronic
1002879971 6:1242568-1242590 CTCCCTCTGGTTTGCAGAGGTGG + Intergenic
1003042999 6:2705319-2705341 CTCCCTTCCCTTTGTAGAAAGGG - Intronic
1004933223 6:20481928-20481950 CTCCATTTCGTCTGTAGAGCAGG + Intronic
1006615222 6:35321483-35321505 CTCCCTCTCCTAGTAAGAGCTGG - Exonic
1007696643 6:43737878-43737900 CTCTCTCTCCTTTGCACAGAAGG - Intergenic
1014477350 6:121889887-121889909 TTCCCTTTCCCTTGTATAGCAGG + Intergenic
1015274764 6:131372800-131372822 CTCAGTCACCTTTGTAGATCCGG + Intergenic
1015841288 6:137479923-137479945 CTCCCTCTCCTTTCTCTAGGTGG - Intergenic
1018755172 6:166842509-166842531 CTCCCTCACCGTTCTGGAGCTGG - Intronic
1019066083 6:169299197-169299219 CTCCTTCTGCTTTGTTGAACTGG - Intergenic
1019384235 7:745315-745337 CTCCCTCTCCGGTGCACAGCGGG - Intronic
1019660025 7:2219092-2219114 CTCCCCCTCCTTCTTAGAGAGGG - Intronic
1019746449 7:2702876-2702898 CTCACTCACCTGTGTGGAGCTGG - Exonic
1021657879 7:22890070-22890092 CTCTCTCTCCTTTTTTGAGATGG + Intergenic
1022265923 7:28754766-28754788 ATCCCTCTCTATTGTAAAGCAGG - Intronic
1023036521 7:36135937-36135959 CTGCCTCTCCTGAGGAGAGCTGG - Intergenic
1023530941 7:41153538-41153560 CTCCCTCTCTTAAGTACAGCTGG - Intergenic
1024459276 7:49643442-49643464 CTCTCTCTCCTTAGCAGTGCTGG + Intergenic
1026331826 7:69358718-69358740 CTCCCTCCCCTTAGTTGATCTGG - Intergenic
1028674933 7:93448220-93448242 CTCCCTCTCATTGGTAAAACTGG + Intronic
1030680112 7:112425439-112425461 CTCCCTCTCCCTTCTGGAGCAGG + Intronic
1031457121 7:121995375-121995397 CTCCCTCTGCTTTGCAAATCTGG + Intronic
1031507620 7:122606243-122606265 GTACCTTTCCTTTGTAAAGCGGG + Intronic
1032723089 7:134566727-134566749 TTCCCTCTCCTGTGCCGAGCTGG + Intronic
1033315038 7:140290083-140290105 AACCCTCTTCTCTGTAGAGCTGG - Intergenic
1033364265 7:140659486-140659508 CTCCATCTCCTATGAAAAGCAGG + Intronic
1033637488 7:143225739-143225761 CTCCCTCTCCTCTGGAGACAAGG + Intergenic
1033718284 7:144026313-144026335 CTCTCTCTCTTTCCTAGAGCTGG + Intergenic
1034274468 7:149817991-149818013 CTCCCGCTCCTGTGGAGGGCTGG + Intergenic
1035207082 7:157300699-157300721 CTCCCGCTCCCCTGCAGAGCAGG - Intergenic
1035617554 8:1013375-1013397 CTCACGCTTGTTTGTAGAGCCGG + Intergenic
1036217371 8:6891941-6891963 CTCGCTCTCTTTTCTTGAGCTGG + Intergenic
1037422851 8:18722317-18722339 CTCAGTCTACTTTTTAGAGCTGG + Intronic
1039052038 8:33503866-33503888 CTCCATCTCCTTTCCAGTGCAGG + Exonic
1041031331 8:53738441-53738463 CTACCTCTCCTTACTAGACCAGG + Intronic
1041089288 8:54287274-54287296 ATCCCTTTCCTTTTTAGGGCTGG + Intergenic
1041313742 8:56541012-56541034 CCTCCTCTCCATTGTAGAGAAGG - Intergenic
1042137519 8:65645697-65645719 CCCCCCCCCCTTTGTAGAGATGG + Intronic
1048016530 8:130502049-130502071 TTCTCTCTCCCTTCTAGAGCTGG - Intergenic
1052282469 9:26748716-26748738 TTCTCTCTCCTTTCCAGAGCAGG + Intergenic
1052582094 9:30371324-30371346 CCACCTCTCCTTTGTTTAGCTGG + Intergenic
1059120469 9:111638062-111638084 CTGCCTCTCCTCTGTAGCACAGG + Intronic
1061643136 9:131975875-131975897 GTTCCTCTCCCTTGGAGAGCTGG - Intronic
1062207230 9:135343901-135343923 CCCCCTCCCCTCTGTGGAGCCGG - Intronic
1185919907 X:4080096-4080118 CTTCCTCCCCTTTGTTGAGAGGG - Intergenic
1186811329 X:13191538-13191560 CTCGCTCTCATTTCTGGAGCAGG + Intergenic
1187350376 X:18509412-18509434 CTCCCTCACTTTGGTAGAGATGG - Intronic
1190592374 X:52017664-52017686 CTCTCTCTCCTTTCCAGAGCAGG - Intergenic
1192589308 X:72346719-72346741 CTCCCTTTCCCTAGTAGAGAAGG - Intronic
1195325947 X:103758560-103758582 CTCCCTCCCCTTTGAAAAACTGG - Intergenic
1198372539 X:136004964-136004986 CTCTCTTTACTTTGTAGTGCTGG - Intronic
1199479025 X:148277264-148277286 CTAGCTCTTCTTTGTACAGCTGG - Intergenic