ID: 976593308

View in Genome Browser
Species Human (GRCh38)
Location 4:86870851-86870873
Sequence GTGGAAGCCCAGAAACAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 1, 3: 60, 4: 443}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976593303_976593308 19 Left 976593303 4:86870809-86870831 CCCAAAACATCCTGCTGACGCTT 0: 1
1: 0
2: 1
3: 12
4: 128
Right 976593308 4:86870851-86870873 GTGGAAGCCCAGAAACAGGAAGG 0: 1
1: 0
2: 1
3: 60
4: 443
976593305_976593308 9 Left 976593305 4:86870819-86870841 CCTGCTGACGCTTACTTCAAGAA 0: 1
1: 0
2: 0
3: 8
4: 90
Right 976593308 4:86870851-86870873 GTGGAAGCCCAGAAACAGGAAGG 0: 1
1: 0
2: 1
3: 60
4: 443
976593304_976593308 18 Left 976593304 4:86870810-86870832 CCAAAACATCCTGCTGACGCTTA 0: 1
1: 0
2: 2
3: 17
4: 62
Right 976593308 4:86870851-86870873 GTGGAAGCCCAGAAACAGGAAGG 0: 1
1: 0
2: 1
3: 60
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976593308 Original CRISPR GTGGAAGCCCAGAAACAGGA AGG Intergenic
900243687 1:1628310-1628332 GTGGACGCCAAGAAGGAGGACGG + Exonic
902286846 1:15412623-15412645 GTGGAAGCCCAGGAGAAGGCAGG - Intronic
902459617 1:16563836-16563858 TTGGAAGCCCAGACATAGGATGG - Exonic
902459784 1:16565456-16565478 CTGGAAGCCCAGACATGGGATGG - Intronic
902802457 1:18838911-18838933 GGGGACGTCCAAAAACAGGAAGG + Intergenic
902955915 1:19924007-19924029 GTGGAAACTCTGAAACAGGACGG - Intergenic
902983283 1:20140320-20140342 GCAGAAGCCCAGAGACAGGAAGG - Intronic
903152809 1:21424513-21424535 TTGGAAGCCCAGTCATAGGATGG - Intergenic
903160321 1:21483471-21483493 TTGGAAGCCCAGTCATAGGATGG + Exonic
903238050 1:21963580-21963602 GTGGAAGCACAAAGGCAGGAAGG + Intergenic
903930345 1:26858359-26858381 ATTGAAGCCCAGAGGCAGGAAGG + Intergenic
904443735 1:30550918-30550940 GTGGATGCCCAAAATCTGGAAGG - Intergenic
905248409 1:36630423-36630445 ATGAAAGCCCAGAAAGAGGTAGG - Intergenic
905350576 1:37343632-37343654 ATGGAAGCTCAGAGAGAGGAAGG + Intergenic
906510437 1:46407627-46407649 GTTGAAGGCCAGAAACAGCCAGG + Intronic
907705006 1:56825406-56825428 GTGGAAGCCAAGAGAAAGGAAGG - Intergenic
907953358 1:59205264-59205286 ATGGAAGCTGAGAATCAGGAAGG + Intergenic
913176244 1:116275717-116275739 CTGCAAGCTCAGAAACGGGAAGG - Intergenic
913207929 1:116558277-116558299 GTGCAAGCCCAGAGATAGCAGGG + Intronic
913605446 1:120461580-120461602 TTGGAAGCCCAGACAAGGGATGG + Intergenic
913605807 1:120464703-120464725 CTGGAAGCCCAGACAAGGGATGG + Intergenic
913605971 1:120466306-120466328 TTGGAAGCCCAGACATAGGATGG + Intergenic
913642312 1:120824300-120824322 TTGGAAGCCCAGACAAGGGATGG + Intronic
913642491 1:120825840-120825862 TTGGAAGCCCAGACAAGGGATGG + Intronic
913642671 1:120827380-120827402 TTGGAAGCCCAGACAAGGGATGG + Intronic
913642787 1:120828427-120828449 TTGGAAGCCCAGACAAGGGATGG + Intronic
913643225 1:120832315-120832337 CTGGAAGCCCAGACAAGGGATGG + Intronic
913643402 1:120833929-120833951 TTGGAAGCCCAGACAAGGGATGG + Intronic
913643526 1:120834957-120834979 CTGGAAGCCCAGACAAGGGATGG + Intronic
913643992 1:120839072-120839094 CTGGAAGCCCAGACAAGGGATGG + Intronic
913644159 1:120840678-120840700 TTGGAAGCCCAGACATAGGATGG + Intronic
913989557 1:143598177-143598199 TTGGAAGCCCAGACACGGGATGG - Intergenic
914082585 1:144422906-144422928 TTGGAAGCCCAGACATAGGATGG - Exonic
914082743 1:144424513-144424535 CTGGAAGCCCAGACAAGGGATGG - Intronic
914083094 1:144427642-144427664 TTGGAAGCCCAGACAAGGGATGG - Intronic
914177485 1:145291419-145291441 TTGGAAGCCCAGACATAGGATGG - Exonic
914178018 1:145296162-145296184 TTGGAAGCCCAGACAAGGGATGG - Intronic
914178563 1:145300924-145300946 TTGGAAGCCCAGACAAGGGATGG - Intronic
914179860 1:145312032-145312054 TTGGAAGCCCAGACAAGGGATGG - Intronic
914180406 1:145316802-145316824 TTGGAAGCCCAGACAAGGGATGG - Intronic
914180949 1:145321564-145321586 TTGGAAGCCCAGACAAGGGATGG - Intronic
914181492 1:145326314-145326336 TTGGAAGCCCAGACAAGGGATGG - Intronic
914182037 1:145331081-145331103 TTGGAAGCCCAGACAAGGGATGG - Intronic
914182582 1:145335837-145335859 TTGGAAGCCCAGACAAGGGATGG - Intronic
914183127 1:145340591-145340613 TTGGAAGCCCAGACAAGGGATGG - Intronic
914183672 1:145345345-145345367 TTGGAAGCCCAGACAAGGGATGG - Intronic
914184215 1:145350115-145350137 TTGGAAGCCCAGACAAGGGATGG - Intronic
914184759 1:145354879-145354901 TTGGAAGCCCAGACAAGGGATGG - Intronic
914185304 1:145359626-145359648 TTGGAAGCCCAGACAAGGGATGG - Intronic
914185849 1:145364380-145364402 TTGGAAGCCCAGACAAGGGATGG - Intronic
914186396 1:145369140-145369162 TTGGAAGCCCAGACAAGGGATGG - Intronic
914186940 1:145373888-145373910 TTGGAAGCCCAGACAAGGGATGG - Intronic
914187483 1:145378638-145378660 TTGGAAGCCCAGACAAGGGATGG - Intronic
914188028 1:145383394-145383416 TTGGAAGCCCAGACAAGGGATGG - Intronic
914188571 1:145388142-145388164 TTGGAAGCCCAGACAAGGGATGG - Intronic
914189113 1:145392898-145392920 TTGGAAGCCCAGACAAGGGATGG - Intronic
914210455 1:145573858-145573880 TTGGAAGCCCAGACATAGGATGG - Intergenic
914210618 1:145575470-145575492 CTGGAAGCCCAGACATGGGATGG - Intergenic
914210967 1:145578607-145578629 TTGGAAGCCCAGACAAGGGATGG - Intergenic
914269381 1:146066211-146066233 TTGGAAGCCCAGACATAGGATGG - Exonic
914269727 1:146069367-146069389 TTGGAAGCCCAGACAAGGGATGG - Intronic
914269905 1:146070970-146070992 CTGGAAGCCCAGACAAGGGATGG - Intronic
914270268 1:146074095-146074117 TTGGAAGCCCAGACAAGGGATGG - Intronic
914270446 1:146075692-146075714 CTGGAAGCCCAGACAAGGGATGG - Intronic
914270805 1:146078831-146078853 TTGGAAGCCCAGACAAGGGATGG - Intronic
914270982 1:146080428-146080450 CTGGAAGCCCAGACAAGGGATGG - Intronic
914271342 1:146083561-146083583 TTGGAAGCCCAGACAAGGGATGG - Intronic
914271520 1:146085164-146085186 CTGGAAGCCCAGACAAGGGATGG - Intronic
914271877 1:146088288-146088310 TTGGAAGCCCAGACAAGGGATGG - Intronic
914272055 1:146089885-146089907 CTGGAAGCCCAGACAAGGGATGG - Intronic
914272414 1:146093006-146093028 TTGGAAGCCCAGACAAGGGATGG - Intronic
914272591 1:146094603-146094625 CTGGAAGCCCAGACAAGGGATGG - Intronic
914272952 1:146097728-146097750 TTGGAAGCCCAGACAAGGGATGG - Intronic
914273129 1:146099325-146099347 CTGGAAGCCCAGACAAGGGATGG - Intronic
914273490 1:146102450-146102472 TTGGAAGCCCAGACAAGGGATGG - Intronic
914273668 1:146104047-146104069 CTGGAAGCCCAGACAAGGGATGG - Intronic
914274029 1:146107168-146107190 TTGGAAGCCCAGACAAGGGATGG - Intronic
914274206 1:146108765-146108787 CTGGAAGCCCAGACAAGGGATGG - Intronic
914274566 1:146111878-146111900 TTGGAAGCCCAGACAAGGGATGG - Intronic
914274742 1:146113475-146113497 CTGGAAGCCCAGACAAGGGATGG - Intronic
914275099 1:146116596-146116618 TTGGAAGCCCAGACAAGGGATGG - Intronic
914275275 1:146118193-146118215 CTGGAAGCCCAGACAAGGGATGG - Intronic
914275636 1:146121322-146121344 TTGGAAGCCCAGACAAGGGATGG - Intronic
914275812 1:146122929-146122951 CTGGAAGCCCAGACAAGGGATGG - Intronic
914276167 1:146126060-146126082 TTGGAAGCCCAGACAAGGGATGG - Intronic
914366654 1:146985139-146985161 TTGGAAGCCCAGACAAGGGATGG + Intronic
914367014 1:146988281-146988303 CTGGAAGCCCAGACATGGGATGG + Intronic
914367190 1:146989900-146989922 TTGGAAGCCCAGACAAGGGATGG + Intronic
914367550 1:146993039-146993061 CTGGAAGCCCAGACATGGGATGG + Intronic
914367714 1:146994660-146994682 TTGGAAGCCCAGACATAGGATGG + Exonic
914380500 1:147111714-147111736 TTGGAAGCCCAGACATAGGATGG - Intergenic
914380679 1:147113266-147113288 TTGGAAGCCCAGACATAGGATGG - Intergenic
914485265 1:148103562-148103584 TTGGAAGCCCAGACATAGGATGG - Exonic
914485433 1:148105183-148105205 CTGGAAGCCCAGACATGGGATGG - Intronic
914485792 1:148108306-148108328 TTGGAAGCCCAGACAAGGGATGG - Intronic
914532214 1:148532898-148532920 TTGGAAGCCCAGACATAGGATGG - Exonic
914532564 1:148536048-148536070 TTGGAAGCCCAGACAAGGGATGG - Intronic
914532743 1:148537657-148537679 CTGGAAGCCCAGACAAGGGATGG - Intronic
914533100 1:148540774-148540796 TTGGAAGCCCAGACAAGGGATGG - Intronic
914533278 1:148542377-148542399 CTGGAAGCCCAGACAAGGGATGG - Intronic
914533635 1:148545488-148545510 TTGGAAGCCCAGACAAGGGATGG - Intronic
914533813 1:148547091-148547113 CTGGAAGCCCAGACAAGGGATGG - Intronic
914534171 1:148550196-148550218 TTGGAAGCCCAGACAAGGGATGG - Intronic
914534349 1:148551799-148551821 CTGGAAGCCCAGACAAGGGATGG - Intronic
914534707 1:148554904-148554926 TTGGAAGCCCAGACAAGGGATGG - Intronic
914534885 1:148556513-148556535 CTGGAAGCCCAGACAAGGGATGG - Intronic
914535243 1:148559617-148559639 TTGGAAGCCCAGACAAGGGATGG - Intronic
914535420 1:148561230-148561252 CTGGAAGCCCAGACAAGGGATGG - Intronic
914535779 1:148564363-148564385 TTGGAAGCCCAGACAAGGGATGG - Intronic
914535957 1:148565966-148565988 CTGGAAGCCCAGACAAGGGATGG - Intronic
914536314 1:148569079-148569101 TTGGAAGCCCAGACAAGGGATGG - Intronic
914536851 1:148573876-148573898 CTGGAAGCCCAGACAAGGGATGG - Intronic
914537211 1:148577007-148577029 TTGGAAGCCCAGACAAGGGATGG - Intronic
914585229 1:149055549-149055571 TTGGAAGCCCAGACATAGGATGG - Exonic
914585397 1:149057158-149057180 CTGGAAGCCCAGACAAGGGATGG - Intronic
914586126 1:149063457-149063479 TTGGAAGCCCAGACAAGGGATGG - Intronic
914629068 1:149491466-149491488 CTGGAAGCCCAGACAAGGGATGG + Intergenic
914629601 1:149496229-149496251 CTGGAAGCCCAGACAAGGGATGG + Intergenic
914630136 1:149500984-149501006 CTGGAAGCCCAGACAAGGGATGG + Intergenic
914630670 1:149505745-149505767 CTGGAAGCCCAGACAAGGGATGG + Intergenic
914631201 1:149510506-149510528 CTGGAAGCCCAGACAAGGGATGG + Intergenic
914631733 1:149515262-149515284 CTGGAAGCCCAGACAAGGGATGG + Intergenic
914632269 1:149520015-149520037 CTGGAAGCCCAGACAAGGGATGG + Intergenic
914632806 1:149524772-149524794 CTGGAAGCCCAGACATGGGATGG + Intergenic
914633340 1:149529501-149529523 CTGGAAGCCCAGACAAGGGATGG + Intergenic
914633876 1:149534252-149534274 CTGGAAGCCCAGACAAGGGATGG + Intergenic
914634412 1:149539003-149539025 CTGGAAGCCCAGACATGGGATGG + Intergenic
914634945 1:149543740-149543762 CTGGAAGCCCAGACATGGGATGG + Intergenic
914635480 1:149548477-149548499 CTGGAAGCCCAGACATGGGATGG + Intergenic
914636015 1:149553214-149553236 CTGGAAGCCCAGACATGGGATGG + Intergenic
914636180 1:149554823-149554845 TTGGAAGCCCAGACATAGGATGG + Intergenic
914847851 1:151292715-151292737 ATGGAAGGCAAGAAACACGAAGG - Exonic
914948300 1:152086411-152086433 CTGGAAACCCAAACACAGGATGG - Exonic
915163273 1:153934047-153934069 GGGGAAGACCAGAAACAGAGTGG - Intronic
916174873 1:162030025-162030047 GTGGAGGCCCACTGACAGGATGG + Intergenic
916325748 1:163558000-163558022 GGGGAACCTCAGAGACAGGAAGG - Intergenic
916676495 1:167068297-167068319 GATGAAGCCCAGAGAAAGGAAGG - Intronic
917469583 1:175314983-175315005 ATGAAAGCACAGAAACAGGGCGG + Intergenic
919178221 1:194047272-194047294 GTGGGAAAACAGAAACAGGAGGG + Intergenic
919196306 1:194290994-194291016 GTGGAAGACTAGAAACAAGGTGG + Intergenic
919533214 1:198751607-198751629 GTGAAAGCTGGGAAACAGGATGG + Intronic
919546314 1:198923930-198923952 GAGGAAACTTAGAAACAGGATGG - Intergenic
919741742 1:200985027-200985049 GTGGAAGCCCAGCACCAAGTAGG - Intronic
920048243 1:203147434-203147456 GAGGAAGCCCAGAAAAAGAAAGG - Intronic
920217788 1:204373924-204373946 GAGGAAGCCAATAAAAAGGAAGG + Intronic
921179673 1:212622139-212622161 GTGGAAGGCAAGAGAGAGGAGGG - Intergenic
921379881 1:214513645-214513667 TTGGAAGCCCAGGCACAAGATGG - Intronic
922056101 1:222043847-222043869 GTGGCAGCCCAGCTACAGCAGGG + Intergenic
923940816 1:238823671-238823693 GTGAAAACCCAGAATTAGGAAGG - Intergenic
924721531 1:246627478-246627500 GAGTAAACCAAGAAACAGGAAGG + Intronic
1063842156 10:10084181-10084203 GTCGAGGCCGAGACACAGGAGGG - Intergenic
1063932629 10:11044258-11044280 ATGGGAGCCCCGAAACAGCAGGG + Intronic
1064034073 10:11901382-11901404 AAGGCAGCCCAGAAACAGCAGGG + Intergenic
1066436527 10:35401052-35401074 GTGGAGGCCCAGCAACTGGCCGG + Intronic
1067517393 10:46963419-46963441 ATGGAAGCCCAGAGATAGGAAGG + Intronic
1067550337 10:47229835-47229857 TTGGAAACTCAGAATCAGGAAGG - Intergenic
1067553806 10:47253918-47253940 GCTGGAGCCCAGAAACAGCAGGG - Intergenic
1067644855 10:48088410-48088432 ATGGAAGCCCAGAGATAGGAAGG - Intergenic
1068933191 10:62612294-62612316 GTGGAAGCAAAGAAATAGGTGGG + Intronic
1069772011 10:70906097-70906119 GTGGGAGCACAGAGAGAGGAGGG + Intergenic
1069950610 10:72015797-72015819 GAGGAAGCCAAGAACCAGGGAGG - Intergenic
1070687948 10:78503734-78503756 GTGGAAACCAAGAAGCAGAAAGG + Intergenic
1070725847 10:78789479-78789501 CTGCAAGCCCAGAAACAGACTGG - Intergenic
1072619416 10:97069680-97069702 GCAGAAACCCAGAGACAGGAAGG + Intronic
1073114367 10:101082981-101083003 GCTGAAGCCTAGAAACGGGATGG - Intergenic
1073980169 10:109145117-109145139 GTGGAAACCCACAAAAAGGAGGG - Intergenic
1075549739 10:123383435-123383457 CTGGAAGCCCAGAAACCCCAAGG + Intergenic
1076490336 10:130857091-130857113 GTGGAAGAACAGAAACATGAAGG - Intergenic
1076672137 10:132128504-132128526 TTGGAATCCCAGAAAGAGAAAGG - Intronic
1076705051 10:132296955-132296977 GAGGCAGCCCAGAGACAGGGAGG + Intronic
1076991643 11:279009-279031 GTGGAAGGACAGAAGCAGAAAGG + Intronic
1078367282 11:10717201-10717223 TTGGAAGGCCAGAGACAGGTTGG - Intergenic
1079245989 11:18752695-18752717 GTGGAGGCCCAGAAGTACGAGGG + Intronic
1079325316 11:19486219-19486241 CTGGCTGCCCGGAAACAGGAAGG + Intronic
1079389560 11:20009772-20009794 TTGGAAGGCAAGAAAAAGGATGG - Intronic
1080046796 11:27817364-27817386 GTGGAAGCAAAGAACCAGGTGGG - Intergenic
1080639150 11:34148745-34148767 GTGGAAGCACTGAAGCAGGCCGG - Intergenic
1081115403 11:39193047-39193069 GTGGGAGCCCAGGCAGAGGAGGG + Intergenic
1081639700 11:44744407-44744429 TGGGAAGGCCAGAAACATGACGG - Intronic
1081751150 11:45512084-45512106 GCTGAGGCCCAGAAAAAGGAAGG + Intergenic
1081776689 11:45680570-45680592 TTGGAAGGACAGAAACAGGGAGG + Intergenic
1081906346 11:46672758-46672780 GTGGAGTCGCAGAAAGAGGAAGG + Intronic
1082873611 11:57966496-57966518 AGGGAATCCAAGAAACAGGAGGG + Intergenic
1084303679 11:68267519-68267541 GTGGTGGCCCATGAACAGGATGG - Intronic
1085065449 11:73491229-73491251 GGGGAAGACCACAAACAGAAAGG + Intronic
1087199863 11:95334630-95334652 GTGTAAGCCCAGAAACAGTCTGG + Intergenic
1087383288 11:97436605-97436627 GTGGAAGCCCAGCAAGATGGAGG + Intergenic
1088418105 11:109612151-109612173 GGGGAATCCCAGAAATAGGAAGG + Intergenic
1088675761 11:112191064-112191086 CTTCAAGTCCAGAAACAGGAAGG + Intronic
1088812173 11:113399329-113399351 GTGGATGCCCAGGAACGTGAAGG + Exonic
1089003482 11:115071199-115071221 GGGGAAGCTGAGAACCAGGAAGG - Intergenic
1090262022 11:125328090-125328112 CTGGAACCCCAGCACCAGGAGGG + Intronic
1090269615 11:125376962-125376984 ATAGAGGCCCAGAAAGAGGAGGG - Intronic
1092727577 12:11500251-11500273 CTGGACGCCAAGAGACAGGAAGG + Intronic
1092741009 12:11629556-11629578 GGAGAAGGCCAGAAACAGGATGG - Intergenic
1093250528 12:16798017-16798039 TAGCAAACCCAGAAACAGGAAGG - Intergenic
1093405798 12:18802425-18802447 ATGGAAGCAGAGAAAAAGGAAGG + Intergenic
1093987306 12:25550501-25550523 GTGGACCCCCAGAAAGGGGATGG - Intronic
1094354824 12:29566234-29566256 GCAGAACCCCTGAAACAGGAAGG + Intronic
1096915961 12:55034168-55034190 GTGGAGGCAGAGAAACAGGAAGG + Intergenic
1099905955 12:88770176-88770198 GTGGAAGCCTATAAATACGAAGG + Intergenic
1100593207 12:96048610-96048632 GTATAAGCGCAGAAGCAGGAAGG - Intergenic
1100892170 12:99137745-99137767 ATGGAAGCACAGAAAAAGCATGG - Intronic
1100912339 12:99379295-99379317 GTGCAAGCCCTGAATCAGAATGG + Intronic
1101341124 12:103842002-103842024 GTGGAACCACAGGCACAGGACGG - Intronic
1101866586 12:108524873-108524895 GTGAAGGCACAGAAACACGAGGG - Intronic
1102955282 12:117054801-117054823 GAGGATGGCCAGAAAGAGGAAGG - Intronic
1104205843 12:126637572-126637594 GAGGAAGACCAGAAAACGGAGGG + Intergenic
1104750860 12:131237488-131237510 GTGGAAGAGCACAAACAGCACGG - Intergenic
1104970975 12:132530570-132530592 GTGGAGACCCAGAAGCAGAAGGG - Intronic
1105736694 13:23278813-23278835 GGGGAAGGGCAAAAACAGGAAGG + Intronic
1105898796 13:24740023-24740045 GTGGAAGCCCCAAAAGAGGTGGG - Intergenic
1107731981 13:43357853-43357875 GCTGGAGCCCACAAACAGGAGGG + Intronic
1107844760 13:44500345-44500367 TTGGAGGCCCAGAAACAGACTGG - Intronic
1107938219 13:45362862-45362884 GAGGAAGCCAATAAACAGAAAGG - Intergenic
1108037816 13:46310024-46310046 GAGTAAGCCAAGAAAGAGGAAGG - Intergenic
1110453208 13:75660488-75660510 GTGAAAACCAAGAAACAAGAAGG - Intronic
1111500151 13:89108176-89108198 GTGGGAGCCAAGAAAAATGATGG - Intergenic
1111655172 13:91142764-91142786 ACGGAAGCACAGAAACATGAGGG - Intergenic
1112998604 13:105604585-105604607 GTGAAGGCCCAGCAAGAGGAAGG - Intergenic
1113382610 13:109817569-109817591 GTGGATGCCATGAAACGGGATGG + Intergenic
1113668154 13:112154996-112155018 GGGGAAGCCCAGCAACAGGAAGG + Intergenic
1114590455 14:23860004-23860026 GAGGGAGCCCAGAAAATGGAGGG - Intergenic
1115756848 14:36536725-36536747 ATTGAAGCCCAAAAACAGAAGGG - Intergenic
1116989930 14:51264762-51264784 GATGAAGCCAATAAACAGGATGG + Intergenic
1117997546 14:61492081-61492103 ATAGATGCCCAGTAACAGGAAGG + Intronic
1119331816 14:73800571-73800593 ATGGAAAACCAGAACCAGGAAGG - Intergenic
1119586682 14:75842394-75842416 GAGGAGGCCGAGAAGCAGGAGGG + Intronic
1119978978 14:79058280-79058302 CAGGAAGTCCAGGAACAGGAAGG + Intronic
1121286900 14:92743097-92743119 GTGAAGGCCCAGAGAGAGGAAGG - Intronic
1121452843 14:94020356-94020378 GTGGAAGCAGAAAACCAGGAAGG - Intergenic
1122964695 14:105117112-105117134 GTTGGACCCCAGAATCAGGAGGG - Intergenic
1124253211 15:28121195-28121217 CAGGAAGCCCACAAAAAGGAAGG + Intronic
1126242592 15:46462158-46462180 GTGGAAGGCAAGAGACAGGTAGG - Intergenic
1127668721 15:61174034-61174056 GTGAATGGCCAGGAACAGGATGG - Intronic
1128621248 15:69152027-69152049 GTGGAAGCCCAGCACCTAGATGG - Intergenic
1128671663 15:69578426-69578448 GTGGAAGCCACAAAACTGGATGG + Intergenic
1129018139 15:72487739-72487761 CTGGAAGCCCAGAGACAAGGAGG - Intronic
1129191818 15:73941913-73941935 GTGGAGGGGCAGGAACAGGACGG + Intronic
1129313369 15:74726867-74726889 CTGGAAACCCTGTAACAGGAAGG - Intergenic
1129719516 15:77870488-77870510 GCGGATGCCCAGAGAAAGGAGGG - Intergenic
1129726411 15:77903851-77903873 GTGGCAGCCCAGGGCCAGGAAGG + Intergenic
1129831927 15:78676284-78676306 GTGGAGGAAGAGAAACAGGAGGG + Intronic
1130306265 15:82713995-82714017 GTTGAGGCCCAGAGAGAGGAAGG - Intergenic
1130550877 15:84889253-84889275 GTAGAAGCCCAGAGAGGGGAAGG + Intronic
1131358888 15:91771696-91771718 GTGGAAGCGATGAAACAGAAGGG + Intergenic
1131401094 15:92126196-92126218 GTCGCAGCCCAGGAAGAGGAAGG - Exonic
1132097636 15:98999918-98999940 GTGGGAGCCCAGGCACAGGAGGG - Intronic
1132167952 15:99614805-99614827 ATGAAAGCCCTGAAACAGAAAGG + Intronic
1132781162 16:1626471-1626493 GGGAAAGCCCTGAAACAAGAGGG - Intronic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1134516274 16:14889677-14889699 GGGGAAGCCCAGAATCCAGAAGG - Intronic
1134703946 16:16288329-16288351 GGGGAAGCCCAGAATCCAGAAGG - Intronic
1134963597 16:18423785-18423807 GGGGAAGCCCAGAATCCAGAAGG + Intronic
1134967892 16:18506384-18506406 GGGGAAGCCCAGAATCCAGAAGG + Intronic
1135942757 16:26836546-26836568 GTGGGAGCCCAGGCAGAGGAGGG + Intergenic
1136076343 16:27819951-27819973 GTGGAGGCAGAGAAAAAGGAAGG + Intronic
1136588575 16:31202988-31203010 GTGCAAGCCCAGAGACAAGCAGG - Exonic
1137251335 16:46743081-46743103 GAGGAAGCACAGAAACGGCAGGG - Intronic
1138262898 16:55638200-55638222 GGGGAGGGCCAGAGACAGGATGG - Intergenic
1138878229 16:60979177-60979199 GCGGGAGCCCAGGAGCAGGATGG + Intergenic
1139282645 16:65783907-65783929 GTGGAGGCCCGGAGAGAGGAAGG - Intergenic
1139410302 16:66753260-66753282 GTGGATGACCTGAAGCAGGAAGG + Intergenic
1141082708 16:81066744-81066766 ATGGAAGCCAAGAAATGGGATGG - Intronic
1141279063 16:82614180-82614202 ATAGAAGCCCAGGAACAGGATGG - Intergenic
1141422924 16:83928560-83928582 GTGCAAGCACAGACACAGGCTGG + Intronic
1141890457 16:86923283-86923305 GTGGAAATCCAGACCCAGGAGGG - Intergenic
1143208160 17:5161319-5161341 CTGTAAGCCCAGATAGAGGATGG + Intronic
1143241622 17:5447853-5447875 CTGAAAGCCCAGCCACAGGAAGG + Intronic
1143475824 17:7203507-7203529 GTGGAAGCCCTCAAAGAGGCAGG - Exonic
1145772922 17:27506502-27506524 GTGCAACCCCAGACACAGGTTGG - Intronic
1146588767 17:34109331-34109353 GTGGCAGCCCAGAAGCAGAATGG - Intronic
1146701496 17:34964500-34964522 GTGGAAGAAGAAAAACAGGAGGG + Intronic
1146832583 17:36082509-36082531 GAGGAGGCCCAGGAACAGGGGGG + Intergenic
1146847063 17:36188821-36188843 GAGGAGGCCCAGGAACAGGGGGG + Intronic
1147339567 17:39745589-39745611 GTGGGATCCCTGAAATAGGAGGG + Intronic
1149872241 17:60193117-60193139 CTGTAAGCCCAGATAGAGGATGG - Intronic
1151455053 17:74221151-74221173 GGGGCAGCCCAGAAAAAGGCAGG - Intronic
1151601357 17:75108245-75108267 ATAGGAGCCCAGAAACAGGGAGG - Intergenic
1152464631 17:80458826-80458848 GTGGAAGCCCAGGGTCAGGGAGG + Intergenic
1152521240 17:80858150-80858172 GGGGAAGGCCAGGGACAGGACGG - Intronic
1153051182 18:904836-904858 GTAGACGCGCAGAACCAGGAGGG - Intergenic
1153287125 18:3467099-3467121 GAGCAAGCATAGAAACAGGAAGG - Intergenic
1153490228 18:5639780-5639802 CAGGAATCCCAGAAACATGAAGG + Intergenic
1154966638 18:21364410-21364432 GTGAAAGACAAGGAACAGGAAGG + Intronic
1155409283 18:25524520-25524542 GTATAAGCCCAGCAATAGGATGG + Intergenic
1156675167 18:39519402-39519424 GGGGAAGTACAGAAACAGAAAGG + Intergenic
1158274466 18:55751749-55751771 GTGGTAGCCAAGAAGCAGGGAGG - Intergenic
1158581158 18:58684222-58684244 GTGGTAACACAGAAACAGGGCGG - Intronic
1159005171 18:63004663-63004685 GTGGAGACCCAGAGCCAGGAGGG + Intergenic
1160467198 18:79089351-79089373 GTGCAGGCCAAGCAACAGGAAGG - Intronic
1160673724 19:377740-377762 CTGGGAGCCCAGAAAGGGGAGGG - Intergenic
1161254319 19:3298538-3298560 GTGGACCCACAGAGACAGGAAGG - Intergenic
1161429789 19:4224825-4224847 GTGGAAGCCCAGCAACGAGACGG - Intergenic
1163517239 19:17772443-17772465 TTGGAAGCGCTGAAGCAGGAGGG - Exonic
1163813111 19:19447089-19447111 GTGGAAGCCCACAAACAGAGAGG + Intronic
1163817260 19:19474411-19474433 GGGGAAGCACCAAAACAGGAAGG - Intronic
1163832200 19:19552480-19552502 GTGGAACCCCAGGGAAAGGAGGG - Intergenic
1164540604 19:29119019-29119041 GAGGAGGCCCAGAGAAAGGATGG - Intergenic
1164578339 19:29419032-29419054 GGGGAAGGCCAGACACAGGAAGG - Intergenic
1167298051 19:48663378-48663400 GTGGAAGGCCAGAAAGGGGGTGG + Intronic
1168077383 19:53988731-53988753 GGGGAAGCCCAGGGCCAGGAGGG + Exonic
1168137658 19:54361931-54361953 TTTGACGCCCTGAAACAGGAAGG + Intronic
1168160412 19:54507147-54507169 TTTGACGCCCTGAAACAGGAAGG - Intronic
1168485696 19:56760169-56760191 TTGGATGCTCAGAGACAGGATGG + Intergenic
1202675861 1_KI270711v1_random:6020-6042 TTGGAAGCCCAGACATAGGATGG - Intergenic
1202676028 1_KI270711v1_random:7640-7662 CTGGAAGCCCAGACATGGGATGG - Intergenic
925133276 2:1509491-1509513 GTGGTTTCCCAGAAACAAGAGGG - Intronic
925177208 2:1794106-1794128 GGGGAAGGCCAGCAGCAGGATGG + Intronic
925507352 2:4583346-4583368 GAGGAAGCACAGAACCAGAAAGG + Intergenic
926143482 2:10382842-10382864 GTGGCTGGGCAGAAACAGGAAGG - Intronic
927310193 2:21621909-21621931 TTGAAATCCCAGAAACAGGCTGG - Intergenic
927869658 2:26615503-26615525 GTTGAGGCCCAGGAAGAGGAAGG + Intronic
927941521 2:27106103-27106125 GTCACAGCCCAGAAAAAGGATGG + Intronic
927972995 2:27317295-27317317 GTGGAAGCCCAGCAGCGGGAGGG + Intronic
931103782 2:59031902-59031924 GTGGGAGACGAGAAACAGAAAGG + Intergenic
933242844 2:79942263-79942285 CAGGAAGCCGAGAACCAGGAAGG + Intronic
933632248 2:84671651-84671673 CTGGAAGCCAAGCAGCAGGAAGG - Intronic
934476541 2:94597282-94597304 TTGGAACCTCAGAAGCAGGAGGG + Intronic
934868544 2:97837891-97837913 GTGGTTGCCTAGAAATAGGAAGG - Intronic
935091487 2:99898932-99898954 GTGGAGGACAGGAAACAGGAAGG - Intronic
935983975 2:108654546-108654568 GTGGAAGCCCAGGTCCAGGCAGG + Intronic
936058690 2:109280432-109280454 GTGGACGCTCAGCAATAGGAAGG + Intronic
936136410 2:109898199-109898221 GTGGAAGCCCAGGTCCAGGCAGG + Intergenic
936208287 2:110473286-110473308 GTGGAAGCCCAGGTCCAGGCAGG - Intergenic
936452304 2:112642937-112642959 GTGGAAGACCAGACAAAAGAAGG - Intergenic
937108340 2:119340269-119340291 GTGGAAACAGAGAAGCAGGACGG + Exonic
937400225 2:121576084-121576106 GTGGAATACCATGAACAGGAAGG + Intronic
937624431 2:124026689-124026711 GAGCAAGCCCAGAAACTTGAGGG - Intronic
938320220 2:130357257-130357279 GTGCAAGCCCAGCATTAGGAAGG + Intronic
938341688 2:130540307-130540329 TTAGAAGCCCAGACCCAGGAGGG + Intronic
938348141 2:130580402-130580424 TTAGAAGCCCAGACCCAGGAGGG - Intronic
938949079 2:136240795-136240817 GTGGAAGCCCACTGACAGGTGGG - Intergenic
940669861 2:156654081-156654103 CTGGAAGGCAAGAAAGAGGAAGG - Intergenic
945742325 2:213678756-213678778 GTGGAAGCCCAAGGACAGAAAGG + Intronic
946362031 2:219224672-219224694 GCGGAAGCGCAGAGGCAGGAGGG + Exonic
946640022 2:221773983-221774005 ATGGAGGACCAGAAACAGGTAGG - Intergenic
947007501 2:225529207-225529229 GTTGAAGTCTAGAAACATGAAGG - Intronic
947165314 2:227255663-227255685 AAGGAAGCCTAGAAAAAGGAAGG - Intronic
1168849194 20:965184-965206 GTGGGAGCCCAGAAGCAGCATGG + Intronic
1169232957 20:3905026-3905048 CTGGAGCCCCAGAATCAGGATGG - Intronic
1169284360 20:4295512-4295534 GGGGAAGCCCAGGGCCAGGAAGG - Intergenic
1169789337 20:9392945-9392967 ATGGAAGACTAGATACAGGACGG + Intronic
1169939808 20:10924778-10924800 GTGAAAGCTCAGAGTCAGGAGGG - Intergenic
1171309606 20:24135622-24135644 GTGAAAGCCCGGTAACAGGCAGG - Intergenic
1172107695 20:32526625-32526647 GGGGAAGCCCAGCCACAGAAGGG + Intronic
1172526527 20:35603104-35603126 CTGGAAGCCCAGAAACTGGTGGG - Intergenic
1173173816 20:40748815-40748837 GTGTAAACCCAGAAAAAAGAAGG + Intergenic
1173526098 20:43733859-43733881 GTGGAAGCCCAATAAAGGGAGGG - Intergenic
1173871343 20:46343993-46344015 GGGGCAGCCCAGGAACAGGATGG + Intergenic
1174158217 20:48531062-48531084 ATGGCAGCCCAGAAGAAGGACGG + Intergenic
1174386168 20:50189827-50189849 GTGGAGGCCCAGAGAGAGCATGG - Intergenic
1176216651 20:63951281-63951303 GTGCCAGCCCACACACAGGAGGG - Intronic
1179247941 21:39649595-39649617 GGTGCAGCCCAGAAACAGGGTGG + Intronic
1179958574 21:44755363-44755385 ATGGAAGCCAAGAGACAGTAGGG + Intergenic
1180541508 22:16452840-16452862 GTGTATGCCCAGTAATAGGATGG - Intergenic
1180904567 22:19400041-19400063 GTGGGAGCCCAGAAAGGAGAAGG + Intronic
1181349943 22:22247717-22247739 ATGGAATCCCAGAATCATGAAGG - Intergenic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1182351539 22:29702737-29702759 ATGGAAGCCCAGAGAGTGGAAGG - Intergenic
1183013017 22:34962884-34962906 GTGGAGGCCCAGAGACGGGAGGG - Intergenic
1184468328 22:44681893-44681915 GAGGAAGCCCAGCCACAGGGAGG + Intronic
1185163967 22:49246522-49246544 GTGGCTGCCCAGAAATGGGAAGG - Intergenic
949724088 3:7023669-7023691 GTGCAAGCCCAGGAACACCAAGG - Intronic
950211101 3:11124263-11124285 GTGGAAGCCCCATAAGAGGAGGG + Intergenic
950248339 3:11442210-11442232 GTGTGGGCCCAGAAACAGGGTGG + Intronic
951812453 3:26715756-26715778 GTGGGAGCCCAGGAACTGGCAGG - Intergenic
952603940 3:35121073-35121095 CTGGAAGACAAGCAACAGGAAGG + Intergenic
954431993 3:50475791-50475813 GTGGGAGCCCAGGCCCAGGAGGG - Intronic
954632582 3:52055449-52055471 CTGGAAGGCCAGGATCAGGAAGG - Intronic
955420748 3:58734685-58734707 ATGGAGGCCAAGAGACAGGAAGG - Intronic
957325298 3:78684598-78684620 GGAGAAGACCAGAAACAGGATGG + Intronic
957969874 3:87368982-87369004 ATGGAAGATCAGAATCAGGAGGG - Intergenic
958664857 3:97124109-97124131 TTGGAAGCAAGGAAACAGGATGG + Intronic
958772680 3:98444606-98444628 GGGGAAGCCGAGAAATAGAAGGG - Intergenic
959584859 3:108016454-108016476 GCAGAATCCCAGGAACAGGAAGG - Intergenic
959614014 3:108326920-108326942 GTGGAAGCTCAAATTCAGGAAGG - Intronic
959847392 3:111049705-111049727 ATGAAAGGCCAGAGACAGGAGGG + Intergenic
960284179 3:115809048-115809070 GTAAATCCCCAGAAACAGGAAGG - Exonic
961455366 3:127021204-127021226 CAGCAAGCCCAGGAACAGGATGG - Intronic
962278373 3:134032071-134032093 GTGGAAGACAGGAAACAGGAAGG + Intronic
963091072 3:141484642-141484664 GAGGAAGGCCAGAATCAGGCTGG + Intergenic
964336322 3:155658435-155658457 GCGGAAGCCCAGACACGGGAAGG + Intronic
964515604 3:157504516-157504538 GCTGATGCCCATAAACAGGATGG + Intronic
965809449 3:172576994-172577016 GTGCAACCCCAGAATCACGATGG - Intergenic
966151964 3:176875364-176875386 CTGGAAGCCCAGTTACAGGGAGG + Intergenic
967188817 3:186967764-186967786 ATGGAGGCCCAGAAAGGGGAAGG + Intronic
967463347 3:189773809-189773831 GTGAAAGGCCAGAGACAGCATGG - Intronic
968067129 3:195764886-195764908 GTGGAGGCCCAGAGAGGGGAAGG + Intronic
968181676 3:196599528-196599550 GTGGAAGCCCAGGCAGAGGCGGG + Intergenic
969497724 4:7535488-7535510 GAGGAAGCCCAGAACAAGGGCGG - Intronic
969705440 4:8788997-8789019 GTGGAAGCCCACAGACCGGGAGG + Intergenic
971875737 4:32306116-32306138 GAGGAAGCCCAGTCTCAGGAGGG - Intergenic
972189378 4:36571587-36571609 GTGGAATACCAGGAACAGGAGGG + Intergenic
972332513 4:38076975-38076997 GTGGCAGCCAGGAAACAGGAAGG - Intronic
973539087 4:51917627-51917649 GTGGATGGCCAGAAAATGGAAGG + Intergenic
976593308 4:86870851-86870873 GTGGAAGCCCAGAAACAGGAAGG + Intergenic
981428616 4:144634166-144634188 GTGGAATCCCAGGAAAAAGATGG - Intergenic
982641623 4:157968925-157968947 GTGGAAGCCCAGACAACAGATGG - Intergenic
982937247 4:161496436-161496458 GAGGAAGCCCATAAACATTATGG - Intronic
983249327 4:165327158-165327180 ATGGTAGACCAGAAAAAGGAAGG + Intergenic
983909285 4:173218843-173218865 GAGGAAACCCAGAACCAGCAGGG - Intronic
984098425 4:175460072-175460094 GTGAAATCCCAGAATCAGGAAGG + Intergenic
985095678 4:186410580-186410602 GTGAAAGTCAAGAAACAAGACGG + Intergenic
985571360 5:647302-647324 CTGGAAATCCAGAAACAGGCAGG + Intronic
986685266 5:10270841-10270863 ATGAAGGGCCAGAAACAGGAGGG - Intergenic
987146326 5:14994296-14994318 GTGGGAGCCCAGGCAGAGGAGGG + Intergenic
987257715 5:16173606-16173628 GTGGGATCCCAGAAAAAGCAGGG + Intronic
987984399 5:25127432-25127454 GTGGAAGGGCAGAAAATGGATGG + Intergenic
988931826 5:36042706-36042728 GTGGAAACCAAGAAAAAAGAAGG + Intronic
989418760 5:41210872-41210894 GTAGATACCCAGTAACAGGATGG - Intronic
992207190 5:74442448-74442470 TTTGGAGCCCAGAAGCAGGAAGG + Intergenic
992550547 5:77855608-77855630 GAGGAAGCCCACAAACTGCAGGG - Intronic
993044467 5:82851956-82851978 GTGTAAGGCAAGAAACAAGAAGG - Intergenic
994486686 5:100391189-100391211 GCTGAGGCCCAGAAACATGAGGG - Intergenic
994921245 5:106046801-106046823 CTGTAAGCCAAGAAACAGCAAGG + Intergenic
995197677 5:109391524-109391546 GTGGAAGCCAGGAAACAATAGGG - Intronic
995969626 5:117952449-117952471 ATGGAAGCCCAGAGAAGGGATGG + Intergenic
997615278 5:135241986-135242008 GTGGAAGCACAGGGAGAGGAAGG - Intronic
999371259 5:151056681-151056703 GTGGATTCCCAGGAGCAGGAAGG + Intronic
999467519 5:151821849-151821871 GTTGAAGCACAGAAGCAAGAGGG + Intergenic
1000174316 5:158735843-158735865 GTTGAAGCCCATAAAGAGAAAGG - Intronic
1000971582 5:167720784-167720806 GTGGAAGCCCAGAGGAAGGAAGG + Intronic
1000992171 5:167922555-167922577 GTGCAAGCACAGAGAGAGGAAGG - Intronic
1001489637 5:172146322-172146344 GTGGAATGCCAGACACAGGTAGG + Intronic
1002559190 5:180070076-180070098 GTGGAAGGGTAGAAAGAGGAAGG - Intronic
1002576956 5:180179337-180179359 CAGGAAGCCCAGGGACAGGAGGG + Intronic
1002662179 5:180798795-180798817 GTGGAAGATCAGAAGCAGCATGG - Intronic
1003136167 6:3436121-3436143 CTGGAAGTCCAGAGACAGGACGG - Intronic
1003264251 6:4551619-4551641 GTGACAGCCCAGGAAGAGGAAGG - Intergenic
1004275206 6:14230029-14230051 GTTGAACCCCAGAGACAGAAAGG - Intergenic
1005850081 6:29814511-29814533 GTGGGAACCCAGAAAAAGCACGG + Intergenic
1006576565 6:35050803-35050825 GTGGAAGCTCAGGGCCAGGAGGG - Intronic
1007458254 6:41997587-41997609 GTGGGAGCTCAAAACCAGGAAGG + Intronic
1007811182 6:44486861-44486883 ATGGGAGCCCAGAACAAGGAGGG - Intergenic
1010715277 6:79221799-79221821 ATGGAAGACAAGAAAGAGGAGGG + Intronic
1011357750 6:86489941-86489963 TTGGAAGACCAGAGACATGAAGG + Intergenic
1013802979 6:113968867-113968889 ATGGAACCCTAGAACCAGGAGGG - Intronic
1018131743 6:160738393-160738415 CTGCAAGCCCAGCATCAGGATGG - Intronic
1018318379 6:162580745-162580767 GTGGAAGCACACAAACAGCAAGG + Intronic
1019670813 7:2277299-2277321 CGGGATGCCCAGCAACAGGAGGG + Intronic
1022830369 7:34059584-34059606 AAGGAAGCCTAGAAACAGAAAGG - Intronic
1023359615 7:39401665-39401687 GTGGATGCCTAGAAACAGCAGGG - Intronic
1024308556 7:47948263-47948285 GTGGAGGCCCTGTACCAGGAGGG - Intronic
1024686395 7:51750673-51750695 GTGCAAGGCCGGAAGCAGGAAGG - Intergenic
1026145424 7:67742441-67742463 GTGTAAGCCCTGGTACAGGATGG + Intergenic
1027162382 7:75812041-75812063 GTGGACGCCCAGAGACAGTAAGG + Intronic
1028264079 7:88701746-88701768 GTGAAAACTCAGAAACAGAAAGG - Intergenic
1033018964 7:137702379-137702401 CTAGAAGCACAGAAATAGGAAGG - Intronic
1033457055 7:141512082-141512104 GGGAAAGCGGAGAAACAGGAGGG - Intergenic
1034502925 7:151462615-151462637 GTGTAACCCCAGAAACATAATGG - Intergenic
1034896578 7:154880171-154880193 GTTGAGGTCCAGAAACCGGAAGG + Intronic
1035073812 7:156164092-156164114 GGGGAAGCCCTGAAACAGTCTGG + Intergenic
1035563722 8:627838-627860 TGGGGAGCCCAGGAACAGGAGGG + Intronic
1035712899 8:1731960-1731982 GTGGAAGTCCTGAAACTGGTTGG - Intergenic
1036089021 8:5644931-5644953 GTGGAAATGCAGACACAGGAAGG - Intergenic
1036378194 8:8218763-8218785 GTGGGAGCCCAGGCAGAGGAGGG - Intergenic
1036492898 8:9244303-9244325 TTGGGAGCCCAAGAACAGGATGG - Intergenic
1038693114 8:29781209-29781231 GAGGAAGCCCTGAACCAGGATGG + Intergenic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1044918079 8:97137376-97137398 GTGGATGTCAGGAAACAGGAAGG - Intronic
1045051102 8:98326798-98326820 GCTGAAGCCCAGAATCATGAAGG + Intergenic
1046574931 8:116016169-116016191 CTGGAATCCCAAAAACAGAAGGG - Intergenic
1047628953 8:126684812-126684834 GTGGGAGAACAGAAACAGGATGG - Intergenic
1048206603 8:132420409-132420431 GTGGCAGCCCAGAAGGTGGATGG - Intronic
1048428537 8:134344939-134344961 GGGGAAGCCCAGAAGCAGGGAGG + Intergenic
1049291470 8:141805187-141805209 GTGGAAGCCCAGGCACAGGCTGG - Intergenic
1050334151 9:4574569-4574591 TTGGAAGCCATTAAACAGGAAGG + Intronic
1051215751 9:14795566-14795588 GAGGAAGCACAGAAAAGGGAGGG + Intronic
1053320097 9:37090412-37090434 GGGGAAGAGCAGGAACAGGATGG - Intergenic
1053324853 9:37134606-37134628 GGGGAAGGGCAGGAACAGGATGG - Intronic
1053498183 9:38563736-38563758 GTGGAAGCCCTCACACAGGGAGG - Intronic
1055373995 9:75628965-75628987 GTGTAAGGCAAGAAACAGAATGG + Intergenic
1055933295 9:81581567-81581589 GTGCAAGCCCAGCTACAGAAGGG - Intergenic
1056543219 9:87592236-87592258 GAGGAAACCCAGCAAGAGGAAGG + Intronic
1060069563 9:120534277-120534299 GTGGAAGTCCAGAGGCAAGAAGG - Intronic
1060982933 9:127803841-127803863 GTGGAACCCCAGAGTCATGAGGG + Intronic
1061224264 9:129271637-129271659 GAGGAAGCCCAGGAACTGAATGG - Intergenic
1061307358 9:129739806-129739828 GACGAAGCCCAGGAAAAGGAAGG + Exonic
1186174078 X:6906886-6906908 GGGGAAGCCAAGAAGCAGGAAGG - Intergenic
1186483435 X:9914028-9914050 GTGGAGGCGGAGAAACAGAAAGG - Intronic
1186919490 X:14262449-14262471 GAGGATGCCCAGAGTCAGGATGG + Intergenic
1186927547 X:14351889-14351911 GTGGAAATGCAGAAGCAGGAGGG + Intergenic
1187850091 X:23583168-23583190 GAGGATGCCCAGAGTCAGGATGG - Intergenic
1187852381 X:23604009-23604031 GAGGAGGCCCAGAGTCAGGATGG - Intergenic
1188259010 X:28000373-28000395 GTTGAAGCACAGGAACAGGTAGG - Intergenic
1188295106 X:28437566-28437588 GTGGAAGTCCAGAGGTAGGAAGG - Intergenic
1188867492 X:35331516-35331538 GAGAAAGCACAGACACAGGATGG - Intergenic
1189280517 X:39817554-39817576 CTGGTTTCCCAGAAACAGGAGGG + Intergenic
1189922723 X:45918704-45918726 GAGGAATCCCAGAAACAGACTGG - Intergenic
1192081299 X:68050351-68050373 CTGGAAGCCCAGACATAGGGTGG + Intronic
1192263068 X:69520129-69520151 GTGGAAGCCTAGAAAGTGGATGG - Intronic
1192430540 X:71108567-71108589 GGAGAAGCCCAGAAAAATGAGGG - Intronic
1192543032 X:71991099-71991121 CACGAAGCCCAGAAAGAGGAAGG - Intergenic
1193468348 X:81872634-81872656 GAGGAAGTCCAGAAAAGGGAGGG - Intergenic
1193908801 X:87277389-87277411 GTATATGCCCAGTAACAGGATGG + Intergenic
1195577672 X:106468727-106468749 GTGGAAGCCCCGGAACACGAAGG + Intergenic
1198316786 X:135475941-135475963 GTGGAAACCAAGAAACAGAGAGG - Intergenic
1199273294 X:145911532-145911554 GGGGAATCCCAGAAGCAGGTTGG + Intergenic
1199427025 X:147714455-147714477 GTGTAAGCAGAGAAACAGAAGGG - Intergenic
1199539145 X:148939105-148939127 GAGGAAGACAAGAAAGAGGAAGG + Intronic
1199749048 X:150797746-150797768 TAGGAAGCCCAGAAATAGGCCGG + Intronic
1200003606 X:153074068-153074090 GTGAGAGCCCAGACACAGGAAGG + Exonic
1200004117 X:153075941-153075963 GTGAGAGCCCAGACACAGGAAGG - Intergenic
1202107425 Y:21385459-21385481 GTGGTAGCTCAGAAACAGGCCGG + Intronic