ID: 976598296

View in Genome Browser
Species Human (GRCh38)
Location 4:86914751-86914773
Sequence CTGGGTATGATCCCTGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 2, 2: 2, 3: 6, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976598289_976598296 27 Left 976598289 4:86914701-86914723 CCGTTCTTCTTATAGATGTGCAC 0: 3
1: 0
2: 1
3: 14
4: 184
Right 976598296 4:86914751-86914773 CTGGGTATGATCCCTGTTCCAGG 0: 1
1: 2
2: 2
3: 6
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976598296 Original CRISPR CTGGGTATGATCCCTGTTCC AGG Intronic
900453229 1:2760985-2761007 CTGGGTGTGAGCGCTGCTCCAGG - Intronic
902143436 1:14376208-14376230 CTGGGTATGATGCATGTACAGGG - Intergenic
903544863 1:24117748-24117770 CTGGGTCCGATCCCATTTCCAGG - Intergenic
906668065 1:47635623-47635645 CTGGCTATGATACTTGTCCCTGG + Intergenic
922532315 1:226353884-226353906 CTGGAGATGATCCCTGCCCCGGG + Intergenic
923995797 1:239492764-239492786 CTGGGTAGGTTCCCTCTGCCAGG - Intronic
924515447 1:244761640-244761662 GCGGGTCTGAGCCCTGTTCCTGG - Intergenic
1064563276 10:16613637-16613659 CTGGGAATGTTCCCTTTTCAGGG + Intronic
1068899821 10:62255288-62255310 CTAGGTATGCTCACGGTTCCTGG - Intronic
1069207403 10:65708290-65708312 CTAGGTATGCTCACTGTTACTGG + Intergenic
1071110715 10:82151998-82152020 CTGAGTATTCTCCCTGTCCCAGG - Intronic
1071692882 10:87841197-87841219 CTGTGAATGAACCTTGTTCCTGG + Intronic
1073380105 10:103071909-103071931 CTGGGTCTGCTCCCTTTACCTGG + Intronic
1074649335 10:115501380-115501402 CAGGTTATGAACCCTGTTACAGG + Intronic
1080155801 11:29109281-29109303 GTGGGTATCTTCCCTGTGCCTGG - Intergenic
1083323240 11:61860372-61860394 CTGGCAAGGTTCCCTGTTCCCGG + Intronic
1083852536 11:65376691-65376713 CTGGGTCTGACCCCTGCTCTGGG - Intronic
1083923215 11:65791472-65791494 CTGGGCATGAGGCCTGTCCCTGG - Intronic
1084893802 11:72250821-72250843 CTGGGAAGGATCCCAGTTCTGGG - Intergenic
1086330666 11:85750639-85750661 TTGGGTATCAGCTCTGTTCCAGG - Intronic
1086378155 11:86222361-86222383 TTGGTTATTGTCCCTGTTCCTGG - Intergenic
1088636412 11:111825265-111825287 CTGTGTATAATCCCTATGCCAGG + Intronic
1089138725 11:116269845-116269867 CTGGGAATGTTCCCTGCTGCTGG + Intergenic
1093558707 12:20511250-20511272 CTGGGTATGATCCTTGCTGCTGG - Intronic
1098033530 12:66279199-66279221 CTGGGCATAGTCCATGTTCCAGG - Intergenic
1107732807 13:43365547-43365569 CTGGGTCTGAACCCTGGACCAGG - Intronic
1108446833 13:50517962-50517984 CTGGGTATGAGCCCTGTCCCTGG + Intronic
1114570416 14:23663373-23663395 CTTGGTGAGATCCCTCTTCCTGG - Intergenic
1117656571 14:57961969-57961991 CTGGGCATGTACCCTGCTCCAGG - Intronic
1118574723 14:67230943-67230965 AAGGGGATGATTCCTGTTCCAGG - Intergenic
1119332087 14:73802520-73802542 TAGGGTATGAGCCCTGTTTCCGG + Intergenic
1121684917 14:95828804-95828826 CTGGGTATCAGCTCTGATCCAGG + Intergenic
1122120063 14:99548180-99548202 CTGGGTATGATCCTTTATCTGGG - Intronic
1122338522 14:101009180-101009202 CTGGGTCTTCTCCCTGTGCCGGG - Intergenic
1122407553 14:101509290-101509312 CTGGCTATGACCCCTATTGCTGG + Intergenic
1124057428 15:26254836-26254858 CTGAGTATCATCTCTGTGCCTGG - Intergenic
1125372003 15:38987811-38987833 CTTGGTGTGACCCTTGTTCCAGG - Intergenic
1126386947 15:48103272-48103294 CTGGGTCTTATCCCAGATCCAGG + Intergenic
1132341622 15:101082318-101082340 CTGGGTATGCAGCCTGTCCCAGG - Intergenic
1138817935 16:60223917-60223939 CTGGGTTTGATTCCTGGTCAGGG - Intergenic
1142140353 16:88470036-88470058 CTGGATCTGCTCCCTGTGCCTGG + Intronic
1145787401 17:27603186-27603208 CTGGGGCTGATCCCTGAGCCTGG - Intronic
1151611812 17:75181733-75181755 CTGAGTATTACCGCTGTTCCGGG - Intergenic
1152767673 17:82149854-82149876 CTGGGTGTGCTCCTGGTTCCGGG - Intronic
1157984742 18:52424319-52424341 CTGGTTCTGATCCCTGCTCTGGG - Intronic
1162729689 19:12710848-12710870 CTGAGCATGATCTCTGATCCTGG - Intronic
1163067569 19:14810238-14810260 CTGGAAATGACCCCTCTTCCAGG + Intronic
1164638698 19:29810222-29810244 CTGTTTATGATACCTGTTACTGG + Intergenic
1164845876 19:31432234-31432256 CTGGGGATGATGCCTGGCCCTGG + Intergenic
1165968825 19:39607841-39607863 CTGTGTATGAACACTGTGCCCGG + Intergenic
1167499513 19:49837216-49837238 CTGGGTCAGATGCCTCTTCCAGG - Intronic
1167947923 19:53004083-53004105 CTGGGTACGATCCCTGTTCCAGG - Intergenic
1168301774 19:55408793-55408815 CTGGAGATGGTCCCTTTTCCAGG - Intergenic
925899273 2:8496752-8496774 TTGGTTATGATCCCTGGTCAGGG - Intergenic
932499007 2:72164887-72164909 CTGGGTATGCTCATTGCTCCTGG - Intergenic
933731366 2:85458703-85458725 CTGGGTAGGCTCCCTTTTCTAGG + Intergenic
934066445 2:88346237-88346259 CTGGCTATGTCCCCGGTTCCAGG + Intergenic
934246971 2:90315855-90315877 CTGGGGCTGATTCCTGCTCCGGG + Intergenic
935126439 2:100227623-100227645 CTGGGCAGGATCCCTCTTGCTGG - Intergenic
936375496 2:111937614-111937636 CTGGGGCTGATGCCTGTTGCCGG + Intronic
936632332 2:114216772-114216794 CTGGGTTTCATTCCTGTTCTTGG + Intergenic
937085950 2:119171922-119171944 CTGGGGAAGCTCCCTGTACCTGG - Intergenic
940704564 2:157087729-157087751 CTGAGTAGGAGCCCTGTGCCAGG - Intergenic
943729015 2:191282138-191282160 ATGGGTATAATCTCTGTTCCTGG + Intronic
944822760 2:203447297-203447319 CTGGGTATTCTCATTGTTCCTGG + Exonic
944950987 2:204748357-204748379 CTGGATATGAGCCCTAATCCAGG - Intronic
946732196 2:222720542-222720564 CAGGGTATAGTCCCTGCTCCTGG + Intergenic
948154312 2:235769115-235769137 CTGGGTATTTTCCCTCTTCTGGG + Intronic
948514005 2:238491553-238491575 CTGGGTAGAATCCCTTTTCCTGG - Intergenic
948735719 2:240003730-240003752 CTGGATATGAGGCCTGTACCAGG + Intronic
948847123 2:240688394-240688416 CTGGCTTTGATCTTTGTTCCAGG + Intergenic
1173287841 20:41689118-41689140 CTGGCTATTGTCCTTGTTCCAGG - Intergenic
1180655896 22:17420310-17420332 CTGGGGATAATCCGTGTTCAAGG - Intronic
1181962206 22:26630340-26630362 CTGGGTTTGCTCCCAGTTTCCGG + Exonic
1185207521 22:49548668-49548690 CTGGGAATGAACCCTCATCCTGG + Intronic
954093286 3:48301810-48301832 CTGGGCATCAACCATGTTCCAGG - Intergenic
960784496 3:121357034-121357056 TTGGGTATGATCCCTGTTCCAGG - Intronic
961798688 3:129428017-129428039 CTGGGTGTCATCCCTGGGCCCGG + Intronic
963080839 3:141392457-141392479 TTGTGTATCCTCCCTGTTCCAGG + Intronic
964358833 3:155873135-155873157 CTGGTTTTGATTCCTGTTTCTGG + Intronic
966259396 3:177956932-177956954 CTAGGTATCCTCCCTGTTTCTGG + Intergenic
968044141 3:195614283-195614305 CTGGGTTTCATTCCTGGTCCTGG - Intergenic
970253711 4:14144957-14144979 TTGGGTCTGATCTCTCTTCCTGG - Intergenic
976598296 4:86914751-86914773 CTGGGTATGATCCCTGTTCCAGG + Intronic
981570777 4:146148462-146148484 CTGGGTAGGGTCCTGGTTCCAGG + Intergenic
981933619 4:150215981-150216003 CTGGTTTTCATCCATGTTCCTGG - Intronic
983600867 4:169525874-169525896 CTGGGTTTGCACCCTGTTTCTGG + Intronic
984905181 4:184619873-184619895 CTGGTTTTTGTCCCTGTTCCTGG + Intergenic
985865102 5:2508613-2508635 CTGGGTCCCATCCTTGTTCCAGG + Intergenic
987225037 5:15831371-15831393 CTGGGTTTGCCTCCTGTTCCAGG - Intronic
988515473 5:31900457-31900479 CTGGAGCTGATCCTTGTTCCAGG - Intronic
989269535 5:39516143-39516165 CTGGGTACATTCCCTGTTCTGGG + Intergenic
990666388 5:58077229-58077251 CTTGGAATTATCTCTGTTCCAGG - Intergenic
992243999 5:74799037-74799059 CTGGGTACGATCCCTGTTTCAGG - Intronic
992632932 5:78699469-78699491 CTGGGTATCATCTCAGTTCAGGG - Intronic
996647234 5:125830737-125830759 ATGGATATGATCCCTATTCTTGG - Intergenic
997568459 5:134906989-134907011 CTGGGTGTGGTCCCTGCTGCTGG + Intronic
1000226026 5:159262980-159263002 CTGGGTGTGCTGCCTTTTCCAGG - Intergenic
1001407430 5:171485797-171485819 CTGGGTAGGATCCTGGGTCCTGG + Intergenic
1003499597 6:6693753-6693775 CTGGGTTTTATCTCTGGTCCTGG + Intergenic
1004132482 6:12933815-12933837 CAGGGTATGAGCCCTGTTCAAGG + Intronic
1005868900 6:29958515-29958537 CTGGGTACTGTCCCTGTTTCGGG - Intergenic
1006420674 6:33931841-33931863 CTGGGGCTGATCCCTGAACCTGG + Intergenic
1008319700 6:50094211-50094233 TTGGTTATTATCCCTGTTCAGGG + Intergenic
1009531957 6:64829403-64829425 GTGGCTATGGTCTCTGTTCCTGG - Intronic
1011390890 6:86851967-86851989 ATGGGTATGACCCCACTTCCGGG + Intergenic
1014745707 6:125198038-125198060 CAGGGTATAATCCTAGTTCCTGG - Intronic
1014806642 6:125837701-125837723 CTGGGTTTGTTTCCTTTTCCTGG - Intronic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1016649014 6:146442258-146442280 ATGGGTTTAATCCCTGCTCCAGG - Intergenic
1016796848 6:148127036-148127058 CTAGGTATTAGCCCTGTACCTGG + Intergenic
1016941452 6:149485698-149485720 CTGGGTCTGTTGCCTGTACCTGG - Intergenic
1018826948 6:167415588-167415610 CTGGGTGTGAGCCCTGGACCGGG - Intergenic
1021000693 7:15327143-15327165 CAGGTTATGATGCCTGTTCTGGG - Intronic
1022493691 7:30839855-30839877 CTGGGTATAAGCCATGTTCTAGG - Intronic
1023924420 7:44655499-44655521 CTGGGTATGCTCCCTGTACTGGG - Intronic
1024322023 7:48080009-48080031 CTGGTTCTGATCCATGGTCCAGG - Intergenic
1025633613 7:63302414-63302436 CTGGGTATGTTCCCAATTGCGGG - Intergenic
1026140761 7:67704313-67704335 CTGGCCATGTTCCCTGTTACGGG + Intergenic
1026629203 7:72023325-72023347 CTGTGTTTGACCCCAGTTCCGGG - Intronic
1029265197 7:99333397-99333419 ACGAGTACGATCCCTGTTCCAGG - Exonic
1030800545 7:113845000-113845022 CTGGGTGTGGACCCTCTTCCTGG - Intergenic
1031792873 7:126132711-126132733 CTGGGTATGTTCATTGTTACTGG - Intergenic
1035003050 7:155631535-155631557 CTAGGTATGGTCGCTGCTCCTGG + Intronic
1040703153 8:50092163-50092185 CTGGTTAAGCTCCCCGTTCCTGG + Intronic
1045789960 8:105971833-105971855 CTGGGTATATTCCCTATTACTGG + Intergenic
1048161403 8:132024942-132024964 CTGGGAATGATCCCTCTGCCAGG + Intronic
1048553216 8:135453311-135453333 CTGGGTAGCATTGCTGTTCCGGG + Intergenic
1055041162 9:71874676-71874698 CTGGATATGGTGCCAGTTCCGGG - Exonic
1055259868 9:74421104-74421126 CTGGGAATAATCCCAGTACCAGG - Intergenic
1057240643 9:93405509-93405531 CTGGATAGGATCCCTTTTTCTGG - Intergenic
1059989545 9:119852387-119852409 CTGGGTATGTTCTGTGTTTCTGG + Intergenic
1060756433 9:126217734-126217756 CTGGGTGTCATCCCTGAACCAGG - Intergenic
1062251427 9:135597502-135597524 CTGGGTTTGATTCCTGGTCAGGG + Intergenic
1193018721 X:76766273-76766295 CTGGGTATTTGCCCTCTTCCTGG - Intergenic
1196718552 X:118832575-118832597 CTGAGAATGAGCTCTGTTCCAGG - Intergenic
1199851705 X:151728459-151728481 CTGGACATGATCCCTAATCCTGG + Intergenic
1200003221 X:153072597-153072619 GTGGGTCTGATACCTTTTCCCGG - Exonic
1200004502 X:153077412-153077434 GTGGGTCTGATACCTTTTCCCGG + Intergenic