ID: 976607801

View in Genome Browser
Species Human (GRCh38)
Location 4:86998855-86998877
Sequence CTTGAGATACTGAAAGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976607801_976607808 29 Left 976607801 4:86998855-86998877 CCCTCTACTTTCAGTATCTCAAG 0: 1
1: 0
2: 1
3: 16
4: 235
Right 976607808 4:86998907-86998929 GTGGAGAACAAGCCAGGAAAAGG 0: 1
1: 1
2: 5
3: 31
4: 386
976607801_976607807 23 Left 976607801 4:86998855-86998877 CCCTCTACTTTCAGTATCTCAAG 0: 1
1: 0
2: 1
3: 16
4: 235
Right 976607807 4:86998901-86998923 ATATGTGTGGAGAACAAGCCAGG 0: 1
1: 1
2: 0
3: 12
4: 135
976607801_976607806 10 Left 976607801 4:86998855-86998877 CCCTCTACTTTCAGTATCTCAAG 0: 1
1: 0
2: 1
3: 16
4: 235
Right 976607806 4:86998888-86998910 GATTTTGGTAGCAATATGTGTGG 0: 1
1: 0
2: 0
3: 20
4: 157
976607801_976607805 -5 Left 976607801 4:86998855-86998877 CCCTCTACTTTCAGTATCTCAAG 0: 1
1: 0
2: 1
3: 16
4: 235
Right 976607805 4:86998873-86998895 TCAAGAAATCTCTGGGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976607801 Original CRISPR CTTGAGATACTGAAAGTAGA GGG (reversed) Intronic
901257116 1:7839236-7839258 CTTCAGTAACTGAAAGAAGATGG - Intronic
903728223 1:25468689-25468711 CTTGAGAGCCTGAAAGGAAATGG + Intronic
906892634 1:49734105-49734127 CTTGATATACTATGAGTAGAAGG + Intronic
908760457 1:67506939-67506961 CTAAAGATACTGAAATGAGAAGG + Intergenic
908957355 1:69649541-69649563 CTTTAGATAATGAAATTGGAAGG + Intronic
910286413 1:85559536-85559558 ATGGAGATAATGAAATTAGAAGG + Intronic
910778262 1:90898199-90898221 CTTGAGATCCTAATAGTAAAGGG + Intergenic
911950543 1:104168483-104168505 CAAGAGACACTGAAAATAGACGG + Intergenic
912023643 1:105138973-105138995 CTTGAGAGACAGCAGGTAGATGG - Intergenic
913071877 1:115306746-115306768 CTTGAGAAGCTAAAAGAAGATGG - Intronic
915021549 1:152784735-152784757 CTTCATCTACTGAAAGTAGAGGG + Intronic
916339976 1:163722381-163722403 CTTGAGACACTGTAAGAGGAAGG + Intergenic
917155116 1:171988839-171988861 GTTCAGATACACAAAGTAGAAGG + Intronic
918163710 1:181924717-181924739 CTTGAGATACTGAATTTTGTCGG + Intergenic
918823267 1:189287083-189287105 CTACAGAGACTGAAACTAGATGG - Intergenic
918879967 1:190105259-190105281 CTTGAGAGACTCAAAGTTGAGGG - Intronic
918967021 1:191364009-191364031 CTTAAGATACTGGAATTAGAAGG - Intergenic
924061735 1:240181982-240182004 CTTGAAATTCTGAAAGCTGATGG - Intronic
924146574 1:241082194-241082216 CTTGAGATATTGTAAGTCAATGG + Intronic
924340691 1:243027767-243027789 CTTTAGATACTGACAGCAAAGGG + Intergenic
924811167 1:247403595-247403617 ATTGAGACACAAAAAGTAGAAGG - Intergenic
1063779666 10:9306930-9306952 ATTGAGGTATGGAAAGTAGAAGG - Intergenic
1065284360 10:24173275-24173297 CTTGTTTTACTGAAACTAGATGG - Intronic
1065539469 10:26746976-26746998 CTTGAAAAATGGAAAGTAGAAGG + Exonic
1066056521 10:31686074-31686096 CTTGATCCACTGAAGGTAGAGGG + Intergenic
1066735786 10:38477635-38477657 CTTTAGATACTGACAGCAAAGGG - Intergenic
1068417796 10:56746612-56746634 CTTGAGCTACTGAAAATTGGAGG + Intergenic
1069017578 10:63447718-63447740 GTTGACATACTGCAACTAGATGG - Intronic
1069865701 10:71501628-71501650 TTTGAGAGACTGAAGGCAGAAGG + Intronic
1071064694 10:81616765-81616787 CTCGATAGACTGAAAGTAAAAGG + Intergenic
1071233097 10:83611898-83611920 CTGGAAGTACTGAAAGTAGCTGG + Intergenic
1071597321 10:86937763-86937785 CTTGAGATACTCAGGGGAGAGGG + Intronic
1073254987 10:102145205-102145227 CTTGAGATACTCACAGTCTAGGG + Intronic
1075558692 10:123451932-123451954 CGTCAGATTCTGAAAGTTGATGG + Intergenic
1076204127 10:128581753-128581775 CTTTAGGTCCTGAAAGTGGAAGG - Intergenic
1079204149 11:18399291-18399313 ATCGAGATATTCAAAGTAGAGGG - Intronic
1083479013 11:62931735-62931757 CCTGAGCTACTGAAAGGACAGGG - Intergenic
1085046702 11:73357706-73357728 CTTGAGTTACTGCAAGCAAAGGG + Intronic
1086700047 11:89891269-89891291 CTAGAGATAATTAAAGTACATGG - Intergenic
1086706123 11:89953247-89953269 CTAGAGATAATTAAAGTACATGG + Intergenic
1087524615 11:99294252-99294274 CTTTAGATTTTGTAAGTAGAAGG - Intronic
1092654324 12:10668730-10668752 CTGGAGAAAGTGAAAGTAGAAGG - Intronic
1093497272 12:19772696-19772718 CTTGAGATAATGTAGGTAAAAGG - Intergenic
1093582628 12:20801178-20801200 TTTGAGATAATGTAAGTATAAGG + Intergenic
1094185487 12:27638012-27638034 TTTTAGAGACAGAAAGTAGAAGG + Intronic
1096284784 12:50289715-50289737 CTTTATATACTAAAAGAAGAAGG - Intergenic
1096550781 12:52370284-52370306 GGTGAGACACTGAAAGGAGATGG - Intergenic
1100021705 12:90076730-90076752 CATGTGATACTAAAAGGAGAAGG - Intergenic
1100470917 12:94892096-94892118 CTGGAGCTACTCAAAGGAGAGGG - Intergenic
1102131616 12:110534721-110534743 CCAGTGATACTGAAAGTAGTGGG - Exonic
1102185378 12:110943598-110943620 CTTGAGATCCTCAAATGAGAAGG + Intergenic
1102736393 12:115164587-115164609 ATGGATATAGTGAAAGTAGATGG + Intergenic
1105770774 13:23609943-23609965 TTTTAGAAACTGAAAGTTGAGGG + Intronic
1110507700 13:76307547-76307569 CTTGAAATACTGAAAGATTAAGG - Intergenic
1112032959 13:95474141-95474163 CTTGTTTTACTGAAACTAGACGG + Intronic
1114215337 14:20653785-20653807 CTTAGGATACTGTAGGTAGAAGG - Intergenic
1114549726 14:23525823-23525845 CTTGAGATCGTGGAGGTAGAAGG + Exonic
1114726626 14:24944561-24944583 CTGGAGATGCTGGAATTAGAAGG + Intronic
1114814266 14:25938024-25938046 CTTTTGATACTGAAAGGAGAAGG - Intergenic
1114866638 14:26602347-26602369 CTTGAAGTACTGAAAAAAGAAGG + Intergenic
1114908226 14:27157946-27157968 CTTTTGATTCTGAAAGTTGATGG - Intergenic
1115367274 14:32572387-32572409 CTTGTGGAACTGAAAGTCGAAGG - Intronic
1115374618 14:32660716-32660738 CGTGAGATTCTGAGAGTATATGG + Intronic
1115484628 14:33898404-33898426 ATTGAGATACTGCAATAAGAAGG - Intergenic
1115499506 14:34036843-34036865 CTTGTGATACTAAAATTAGTCGG + Intronic
1120234811 14:81877772-81877794 ATTGAAATACTAAAAGGAGAAGG + Intergenic
1122283832 14:100639353-100639375 CCTGAGAAACTGAAAGTCCAAGG + Intergenic
1124842870 15:33260878-33260900 CTTGGGATCCAGAAAATAGACGG + Intergenic
1126499649 15:49331144-49331166 CTTGACATGCTGAAAGTAAAAGG + Intronic
1127402748 15:58606610-58606632 CTTGATATGTTGAAAATAGAAGG - Intronic
1128711029 15:69872135-69872157 CTTGAGGCACTGAAAGTTAAAGG + Intergenic
1129835021 15:78697795-78697817 CTTGAAAAACTGAGAATAGAAGG - Intronic
1130731488 15:86497879-86497901 ATTGAGAGACTGAAAGCAGATGG - Intronic
1131117284 15:89803175-89803197 CTTGAGATGCTGAAGGTACCTGG - Intronic
1132116413 15:99139258-99139280 CTTGAGATTCTGAATGGAAAGGG + Intronic
1132477302 16:147050-147072 CATGAGAGAGTGAAAGAAGATGG + Intergenic
1133589753 16:7230663-7230685 GTTGAGATACTAAATATAGAAGG + Intronic
1135400837 16:22165401-22165423 CTTGAGATTCTGAAAGGGGCAGG + Intergenic
1135827632 16:25743665-25743687 CTAGAAATACAGAAATTAGATGG - Intronic
1136001236 16:27295405-27295427 CTATAGAGACAGAAAGTAGATGG - Intergenic
1136518249 16:30780738-30780760 CTTGCGAAACTGCAAGTAGCAGG - Exonic
1139271395 16:65686827-65686849 CTTGAGAAAATGAAGGTATATGG + Intergenic
1140182971 16:72738726-72738748 CTGGAGATACTGAAAGGACCTGG + Intergenic
1140339851 16:74146773-74146795 CTGGAGGTACTGAAAGAAGCTGG + Intergenic
1141544222 16:84753340-84753362 CTTGGGATGCTGAAAGTTGTTGG + Intronic
1142683983 17:1566697-1566719 CTTGAGAAACTGAGAGAGGACGG - Intergenic
1146828458 17:36045655-36045677 TTTCAGCTACTGAAGGTAGAGGG - Intergenic
1148661016 17:49332852-49332874 CTGGAGAAACTGAAAGAAAAGGG - Intronic
1151015894 17:70552342-70552364 CTTAATTTAATGAAAGTAGAAGG + Intergenic
1151252235 17:72845144-72845166 CTTTAGATACTGAATTGAGATGG - Intronic
1153403687 18:4710564-4710586 ATTGAGATACTAAAAGCAAATGG + Intergenic
1153736181 18:8070463-8070485 CTTGAGAAACTGTAAGTTGGTGG + Intronic
1155350236 18:24899136-24899158 CTAGAGACACTGAAAGTAGCTGG - Intergenic
1155691651 18:28632156-28632178 CTTGAGAAAGTGAGAGTGGATGG + Intergenic
1155931308 18:31711757-31711779 CTTAAAATAGTGAAAGAAGATGG - Intergenic
1157260335 18:46171356-46171378 CTAGAGATGATGAAAGTAGGGGG - Intergenic
1159426916 18:68301127-68301149 CATGATATACTGAACCTAGAGGG - Intergenic
1160199080 18:76781360-76781382 CTTGAGATACTCCATGAAGAAGG - Intergenic
1162316217 19:9939758-9939780 CTAGAGACACTCAAAGTGGAGGG - Intergenic
1166184591 19:41131577-41131599 CTGGAGACACTGAAAAGAGATGG + Intergenic
1166233815 19:41441755-41441777 ATTGAGAAACTAAAAGCAGACGG + Intergenic
1166264590 19:41671137-41671159 CATCAAATCCTGAAAGTAGAGGG + Intronic
1166987931 19:46673311-46673333 CTTGAAAGACTGAAGGCAGAGGG - Intergenic
1167705918 19:51081176-51081198 CCTGAGTTTCTGAATGTAGACGG + Intronic
1167990579 19:53357541-53357563 CTAGAGATACAGAAATTAGTTGG - Intergenic
926781918 2:16480822-16480844 CTGGAGATGTTGAAAGTAGTTGG - Intergenic
927633593 2:24795012-24795034 CTTTAGATAATAAAAGTATATGG + Intronic
928542969 2:32300470-32300492 CTTCTGAAACTGAAAATAGAAGG - Intronic
928978159 2:37110503-37110525 CAGGAGATACTGAAAGCAGCAGG + Intronic
929661937 2:43795340-43795362 CTTAAGATACTAAAATTAGCTGG + Intronic
930333212 2:50013079-50013101 CTTGAGTGACTGTTAGTAGAGGG - Intronic
930482724 2:51969858-51969880 CTAGTGAAACTGCAAGTAGAAGG - Intergenic
932386998 2:71344159-71344181 ATTTGGATACTAAAAGTAGAGGG - Intronic
933004288 2:76970968-76970990 CTGGAGATACTTTGAGTAGAGGG - Intronic
935207458 2:100908789-100908811 GTTGAGAGACGGAGAGTAGAAGG + Intronic
935728098 2:106041400-106041422 TATGAGATACTGAGAGAAGATGG + Intergenic
936414842 2:112297081-112297103 CTTGAGAAATTGAAAGTAGCTGG + Intronic
936446576 2:112600626-112600648 CTTGAGGTACAAAAATTAGAAGG + Intergenic
936625160 2:114140937-114140959 CATGAGATAATGCAAGTAGACGG + Intergenic
938698383 2:133854861-133854883 CATTAGATACTGAAAAGAGAGGG + Intergenic
940132846 2:150403738-150403760 CTTTAGAAACTGAAAGTAAGTGG - Intergenic
941483379 2:166046530-166046552 CTTAAGATTCTCAAAGTAAAGGG - Intronic
945100488 2:206258238-206258260 CTTGAGAAACTGAGAGGAGGTGG + Intergenic
945830656 2:214780666-214780688 CTTGAACTACTTAATGTAGAAGG + Exonic
946531797 2:220578320-220578342 CTTGAGAAAGGGAAAGGAGATGG + Intergenic
946642042 2:221794430-221794452 CTGGAGATACTGAACCTAGATGG - Intergenic
1169663630 20:8008354-8008376 CTTGAAATATTAAAAGAAGAAGG - Intronic
1170552152 20:17487330-17487352 CATGAGCTACTCAAACTAGATGG + Intergenic
1174464416 20:50706263-50706285 CTAGAGAGACAGAATGTAGAGGG + Intergenic
1174601459 20:51728268-51728290 CTTGAGGTACTGAGAGTTGGGGG + Intronic
1174963049 20:55179419-55179441 AATGAGAAACTGAAAGTAAAGGG - Intergenic
1176732230 21:10511174-10511196 CTAAAGATACTGAAACCAGAGGG - Intergenic
1176897333 21:14396495-14396517 TTTGAAATTCTTAAAGTAGATGG - Intergenic
1178031911 21:28537679-28537701 ATTGACATACTGATAGTAAATGG + Intergenic
1178585939 21:33870868-33870890 CTTGAGAGACAGCAGGTAGATGG + Intronic
1178857955 21:36265974-36265996 CTTGAGATCCTGCAGGTTGAGGG + Intronic
1178978762 21:37243602-37243624 CCAGAGACACTGAAAGGAGACGG + Intronic
1181262957 22:21611870-21611892 CTTGAGAGGCTGCAAGTGGAGGG + Intronic
1182420075 22:30244722-30244744 CCTGGGATACTGACAGGAGATGG - Intronic
949432108 3:3988523-3988545 TTTGAGATACTGAAGGAAAAAGG - Intronic
951046878 3:18049862-18049884 TTTGAGAAACTGAAAGGAGGCGG - Intronic
951595212 3:24311446-24311468 CTGGAAATTCTGAAAATAGATGG - Intronic
951778051 3:26332136-26332158 CTGGAGATACTGAGAGAGGAGGG + Intergenic
952366808 3:32682144-32682166 CTGCTGATACGGAAAGTAGAGGG + Intergenic
955662969 3:61320928-61320950 CTTAAGATACTAATAATAGAAGG - Intergenic
957530763 3:81438341-81438363 CTTGACATACTGTCAGAAGATGG + Intergenic
957725413 3:84058981-84059003 TTTAACATACTGAAAGAAGAGGG - Intergenic
959428737 3:106224958-106224980 CTACAGAGACAGAAAGTAGATGG - Intergenic
959491757 3:106998550-106998572 CTTGAGACACTGAAAGCACCTGG + Intergenic
959630578 3:108502850-108502872 CTTGAAATACAGAAAGTGAAGGG - Intronic
961754169 3:129117705-129117727 CGTGAGATTCTGAAAGTGAATGG - Intronic
962002181 3:131309475-131309497 CCTGAGCTACTGCAAGTAGGAGG - Intronic
966567855 3:181403142-181403164 CTTGAGATAAAGAATGTAAAGGG + Intergenic
966987021 3:185190148-185190170 ATTGAGATTTTGAAACTAGAGGG - Intergenic
967563014 3:190939519-190939541 CCTAAGGTTCTGAAAGTAGATGG - Intergenic
967657550 3:192069858-192069880 CTTGGAATACTAAAAGTAGTAGG + Intergenic
967907617 3:194514636-194514658 CTTGAGAAACTAAAAGAAAAGGG + Intergenic
970000647 4:11362775-11362797 CATGAGATACACAAAGGAGAGGG + Intergenic
974112407 4:57540670-57540692 CTTGAGATCTTGCAACTAGAAGG - Intergenic
974417543 4:61629371-61629393 CTTGAGATACTAATAGTTGATGG - Intronic
975402039 4:73949757-73949779 CTGGAGAGACAGAAAGTATAAGG + Intergenic
976607801 4:86998855-86998877 CTTGAGATACTGAAAGTAGAGGG - Intronic
977541921 4:98328519-98328541 CTTTATAAACTGAAACTAGATGG - Intronic
977841219 4:101708369-101708391 CTATAGAGACAGAAAGTAGATGG + Intronic
978209258 4:106115620-106115642 CTGAAGATAATGAAAATAGAAGG + Intronic
978387968 4:108194909-108194931 CTAGAGAGACTGAGAGTAAAAGG - Intergenic
980187502 4:129480521-129480543 CTTGAGATTCTAAATGTAAAAGG - Intergenic
980802110 4:137765363-137765385 CATGGGATGCTGAAAGTGGATGG + Intergenic
980974867 4:139600842-139600864 TTATAGAAACTGAAAGTAGAAGG - Intronic
981293087 4:143099501-143099523 CTTGAGCTATTGAAAGGATATGG + Intergenic
981595387 4:146415332-146415354 CTTGAGATTCAGAAAGTTCAAGG - Intronic
984514187 4:180718328-180718350 CTTCAGATACTCAAAGCATATGG - Intergenic
986011741 5:3723340-3723362 ATTGAGGTACTCAAAATAGATGG - Intergenic
987268729 5:16282665-16282687 CTAGAGATACAGGAAGAAGAAGG + Intergenic
988143901 5:27279044-27279066 ACTGAAACACTGAAAGTAGATGG + Intergenic
988326466 5:29774807-29774829 CATGAGATAATGAAACAAGAAGG + Intergenic
988657814 5:33231571-33231593 CATGAGATACTAAATGTTGATGG + Intergenic
989388182 5:40873727-40873749 CTTCTGATACTGAAAGGAGGAGG + Intergenic
991565675 5:68001795-68001817 CTGGAGGTACTGAGAGTGGAAGG - Intergenic
992167436 5:74068612-74068634 CTTCAGATACTGATATTTGAGGG - Intergenic
993071325 5:83167378-83167400 CATGAGATTCTGACAGTACAAGG + Intronic
993447816 5:88036304-88036326 CTAGAGAGATTGAAAGTATATGG - Intergenic
995189436 5:109304739-109304761 CATGAGAGACTGAAAACAGAAGG + Intergenic
995212980 5:109561617-109561639 CTTGAGCTCATGGAAGTAGAGGG - Intergenic
995536504 5:113141867-113141889 CTTGAGAAAGTGAAAGCAAATGG - Intronic
995949906 5:117698780-117698802 ATTGAGATAGAGAAAGTACAAGG + Intergenic
996269390 5:121584756-121584778 GTAGAGATACAGTAAGTAGATGG - Intergenic
998662962 5:144261331-144261353 CTAGATTTACTGAAAGTAGGGGG + Intronic
998870208 5:146544238-146544260 CTTGAGATTTTGAAGGTAGAAGG + Intergenic
1000960529 5:167596189-167596211 CTTCAGATAATGACAGTAAACGG - Intronic
1001908634 5:175495255-175495277 ATTCAGAGACAGAAAGTAGAGGG + Intronic
1004082242 6:12406252-12406274 CTTCAGTTACTGAGAGTAGTTGG + Intergenic
1004405406 6:15328445-15328467 CTTGAAATGCTGAAAATCGAAGG + Intronic
1011164895 6:84435576-84435598 GTTAAGAGACTGAAAGCAGATGG + Intergenic
1011312428 6:85994883-85994905 CTAAAGATACTGCAAGTTGATGG - Intergenic
1011698758 6:89936142-89936164 CTTGAGGAACTGACAGTTGAGGG + Intronic
1012056765 6:94422435-94422457 TCTGAGAGACTGAAAGTAAAGGG - Intergenic
1012182131 6:96167396-96167418 CTTGTGATGCTGCAAGTGGAGGG - Intronic
1013418634 6:109946777-109946799 CTGGAAATACTGAAAGGTGAAGG + Intergenic
1014057846 6:117037235-117037257 CTTGAGGGACTGAGAGCAGATGG - Intergenic
1015294640 6:131576714-131576736 CTTGAGAAACTTAAAGAACAAGG + Exonic
1015927555 6:138325387-138325409 TGTGAGAAACTGAAGGTAGAAGG - Intronic
1016081071 6:139856917-139856939 TTTAAAATATTGAAAGTAGATGG + Intergenic
1019327144 7:444074-444096 ATTTAGATACTGAAAGGGGAGGG - Intergenic
1019397926 7:833110-833132 CTTGGAAAACTGAAAGCAGAAGG - Intronic
1020530213 7:9323438-9323460 CTTGAGGAACTGAGAGGAGATGG + Intergenic
1020686874 7:11307222-11307244 CTTGAGAAATTAAAAGGAGAAGG + Intergenic
1021203817 7:17755019-17755041 CTTGATAAACTGAAATTAGTAGG - Intergenic
1021491338 7:21222389-21222411 CTTCAGAGAATGAAAGTGGAAGG - Intergenic
1022122715 7:27324988-27325010 TTAGAGATACTGAAAGTAAAAGG - Intergenic
1023074881 7:36472771-36472793 CTTGAGAGACAGCAGGTAGATGG + Intergenic
1023660270 7:42463852-42463874 GTTGAGATATAGAAAGAAGATGG + Intergenic
1024108829 7:46123705-46123727 GTTGAAATGCTGAAAGTAGAAGG - Intergenic
1025969606 7:66309955-66309977 CCTGAGATACAGAAAGAATAGGG + Intronic
1026070663 7:67116579-67116601 CTTGAGACACTGAGATAAGAGGG + Intronic
1026706235 7:72695698-72695720 CTTGAGACACTGAGATAAGAGGG - Intronic
1028242399 7:88437267-88437289 CTTGAGAAAGTGAAAGAGGATGG - Intergenic
1029578232 7:101418379-101418401 CCTAAGAGACAGAAAGTAGATGG - Intronic
1031918072 7:127581807-127581829 CTAGAGATACTGAAAGTCCTGGG - Exonic
1033643466 7:143284262-143284284 CTTGAGAAACTCACAGTGGAAGG + Intronic
1033717796 7:144020836-144020858 CTTCAGACACTGACAGTCGAAGG + Intergenic
1033972957 7:147066108-147066130 CTTGATGTACAGAAACTAGAAGG + Intronic
1034031441 7:147770341-147770363 CTTGTTACACAGAAAGTAGAGGG - Intronic
1036068718 8:5415651-5415673 TTAGACATGCTGAAAGTAGAAGG - Intergenic
1037354997 8:18008913-18008935 CTTGACATAATAAATGTAGAGGG + Intronic
1039680725 8:39732652-39732674 CTTGATATCCAGAATGTAGAAGG + Intergenic
1045239457 8:100386437-100386459 CATCAGATACAGAAAGTGGAAGG - Intronic
1046553246 8:115743607-115743629 CTCTAGATAATGAAAGTAGGTGG + Intronic
1046612237 8:116438732-116438754 CTGGAGACACTGAAAGTTTATGG - Intergenic
1048658400 8:136569666-136569688 CTTCACATCCTGAAAGTATATGG - Intergenic
1050068341 9:1785029-1785051 CTTGAGCCGCTGAAAGGAGATGG - Intergenic
1050132156 9:2424075-2424097 CATGAAAGACTAAAAGTAGATGG + Intergenic
1051818186 9:21134041-21134063 GTTGAGATCCTGAAAGTGGAAGG - Intergenic
1052029850 9:23616106-23616128 CTTGAGATACATTGAGTAGAGGG - Intergenic
1052985981 9:34488348-34488370 TCTGAGTTACTGAAAGAAGAAGG + Intronic
1053876766 9:42553472-42553494 CTTGAGAAACTGGGAGAAGATGG - Intergenic
1053895908 9:42741233-42741255 CTTGAGAAACTGGGAGAAGATGG + Intergenic
1055142392 9:72890584-72890606 CTAGAGATAATGAAACTATATGG - Intergenic
1056757685 9:89392139-89392161 ATTGAGAATCTGATAGTAGATGG - Intronic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057507359 9:95646533-95646555 CTTGAGTTACTGAAAGTTGAAGG + Intergenic
1059845264 9:118268535-118268557 CTTGACATACTGGAGGAAGAAGG + Intergenic
1062073269 9:134570666-134570688 CTTGAGATCCTTAAAGAAGCAGG + Intergenic
1188066947 X:25673857-25673879 CTTGAGAAAATGAAAATAGGTGG + Intergenic
1188844668 X:35058476-35058498 CCTGAGATATTTAAGGTAGATGG - Intergenic
1188891489 X:35616506-35616528 CTTGACAAACTGAAAATCGAAGG + Intergenic
1190011607 X:46789973-46789995 CTCGAGATGCTGAGGGTAGAAGG + Intergenic
1192833002 X:74769724-74769746 CTGGAGTTACTGAAAGATGAGGG + Intronic
1195420377 X:104668798-104668820 CTTCAGAGTCTGAAATTAGAAGG + Intronic
1198527668 X:137518520-137518542 CTGGGGAGACTGAAAGTAGTAGG + Intergenic
1202035629 Y:20632052-20632074 CTTGAGATAATAAAAGCAAATGG - Intergenic
1202384215 Y:24309066-24309088 CTTTAGATACTGACAGCAAAGGG - Intergenic
1202486568 Y:25361058-25361080 CTTTAGATACTGACAGCAAAGGG + Intergenic