ID: 976608670

View in Genome Browser
Species Human (GRCh38)
Location 4:87007001-87007023
Sequence AACGCGGGCCACAGTTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 40}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976608670_976608677 2 Left 976608670 4:87007001-87007023 CCTTTCTAACTGTGGCCCGCGTT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 976608677 4:87007026-87007048 GCTGTTGCTGGGCAGGCGTTGGG 0: 1
1: 0
2: 2
3: 19
4: 276
976608670_976608679 11 Left 976608670 4:87007001-87007023 CCTTTCTAACTGTGGCCCGCGTT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 976608679 4:87007035-87007057 GGGCAGGCGTTGGGCGCCGGCGG 0: 1
1: 0
2: 1
3: 20
4: 320
976608670_976608680 24 Left 976608670 4:87007001-87007023 CCTTTCTAACTGTGGCCCGCGTT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 976608680 4:87007048-87007070 GCGCCGGCGGTCTTCGAGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 24
976608670_976608678 8 Left 976608670 4:87007001-87007023 CCTTTCTAACTGTGGCCCGCGTT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 976608678 4:87007032-87007054 GCTGGGCAGGCGTTGGGCGCCGG 0: 1
1: 0
2: 0
3: 28
4: 316
976608670_976608672 -9 Left 976608670 4:87007001-87007023 CCTTTCTAACTGTGGCCCGCGTT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 976608672 4:87007015-87007037 GCCCGCGTTGTGCTGTTGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 43
976608670_976608684 27 Left 976608670 4:87007001-87007023 CCTTTCTAACTGTGGCCCGCGTT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 976608684 4:87007051-87007073 CCGGCGGTCTTCGAGCGTGGGGG 0: 1
1: 0
2: 0
3: 1
4: 25
976608670_976608675 -5 Left 976608670 4:87007001-87007023 CCTTTCTAACTGTGGCCCGCGTT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 976608675 4:87007019-87007041 GCGTTGTGCTGTTGCTGGGCAGG 0: 1
1: 0
2: 1
3: 21
4: 1310
976608670_976608681 25 Left 976608670 4:87007001-87007023 CCTTTCTAACTGTGGCCCGCGTT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 976608681 4:87007049-87007071 CGCCGGCGGTCTTCGAGCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 11
976608670_976608676 1 Left 976608670 4:87007001-87007023 CCTTTCTAACTGTGGCCCGCGTT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 976608676 4:87007025-87007047 TGCTGTTGCTGGGCAGGCGTTGG 0: 1
1: 0
2: 4
3: 17
4: 235
976608670_976608682 26 Left 976608670 4:87007001-87007023 CCTTTCTAACTGTGGCCCGCGTT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 976608682 4:87007050-87007072 GCCGGCGGTCTTCGAGCGTGGGG 0: 1
1: 0
2: 0
3: 2
4: 28
976608670_976608671 -10 Left 976608670 4:87007001-87007023 CCTTTCTAACTGTGGCCCGCGTT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 976608671 4:87007014-87007036 GGCCCGCGTTGTGCTGTTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976608670 Original CRISPR AACGCGGGCCACAGTTAGAA AGG (reversed) Intronic
916050328 1:161031576-161031598 AAAGAGGGACACAGTGAGAAAGG + Intronic
916627248 1:166571678-166571700 AAGGCAAGCCTCAGTTAGAAAGG + Intergenic
920888434 1:209957199-209957221 AATGGGGGCTAAAGTTAGAAAGG - Intronic
921639749 1:217538643-217538665 AACCCAAGCCACAGTCAGAATGG - Intronic
921824386 1:219655788-219655810 AATGTGGGCCACAGTGAGAAGGG - Intergenic
1073299013 10:102459425-102459447 CATGCTGGCCACAGATAGAAAGG + Intergenic
1074098871 10:110337422-110337444 AAGGTGGGCCACATTTTGAAAGG + Intergenic
1075709544 10:124523267-124523289 CACCCAGGCCACAGCTAGAAGGG - Intronic
1076923831 10:133471369-133471391 TACCAGGGCCACAGTTGGAAAGG - Intergenic
1078976274 11:16481604-16481626 ATTGAGGGCCACACTTAGAAGGG + Intronic
1082982652 11:59137435-59137457 ACCTCGGGCCACAGCTAGGATGG + Intergenic
1089352829 11:117831126-117831148 AACATGGGCCACAGGTGGAAGGG - Intronic
1101719410 12:107338209-107338231 AAAGGGGGCCACAGTAAGACAGG + Intronic
1103058011 12:117836698-117836720 GACACGGGCCACAGTTGGCAAGG - Intronic
1104526381 12:129526924-129526946 AAGGCTGGCCACAGCTGGAATGG - Intronic
1108579308 13:51815138-51815160 AACGTGGGACACAGTGAGGATGG + Intergenic
1116781297 14:49240680-49240702 AACGCAGGCACCAGTTACAAGGG + Intergenic
1122741238 14:103872568-103872590 ACCGCGGGCCACAGGTCGCATGG - Intergenic
1127214736 15:56812486-56812508 ATCACAGGCCACAATTAGAAAGG - Intronic
1128560649 15:68665029-68665051 ATCTTGGGCCATAGTTAGAAAGG + Intronic
1132874536 16:2130488-2130510 AACGCGGGCTCCAGTGATAACGG + Intronic
1134553480 16:15149321-15149343 AACGCGGGCTCCAGTGATAACGG + Intergenic
1139482828 16:67240170-67240192 AAAGTGGGCTACAGTTACAATGG + Intronic
925171935 2:1755272-1755294 GACGGGGACCACAGTTAGCATGG + Intergenic
931728278 2:65130869-65130891 AGAGCGGGGCACAGTAAGAATGG - Intergenic
936785404 2:116088395-116088417 AATGCAGGCCACAGGCAGAAAGG + Intergenic
937224963 2:120363464-120363486 CACGTGGGCCACATCTAGAATGG + Intergenic
946031799 2:216711213-216711235 AACACGGGCCAGAGAAAGAAAGG - Intergenic
1175996136 20:62813089-62813111 AAGGCTGGACACAGTGAGAACGG + Exonic
1183986146 22:41571766-41571788 AACCCTGGCCACAGTGAGGAGGG - Intronic
953741428 3:45542249-45542271 AACACGGTCCACAGTTGGAAAGG - Intronic
954662042 3:52231491-52231513 CACGCGGGCCACAGTGAAAAAGG - Exonic
954816931 3:53289871-53289893 AGAGCGGGCCACAGTTTCAACGG + Intronic
972959758 4:44438872-44438894 AAAGCAGTCCACAGTTAGAATGG - Intronic
974131601 4:57762986-57763008 AACCAGTGCCACAGTGAGAAGGG + Intergenic
976608670 4:87007001-87007023 AACGCGGGCCACAGTTAGAAAGG - Intronic
1000836177 5:166156890-166156912 CATGCTGGCCAAAGTTAGAATGG + Intergenic
1001101190 5:168815854-168815876 AAGGTGGGCACCAGTTAGAAAGG + Intronic
1009720688 6:67465485-67465507 AACGCAGGCCATAGTGAGTATGG + Intergenic
1025223802 7:57139283-57139305 AACGCAGTCCACAGGTAGCATGG + Intronic
1026499859 7:70935223-70935245 AACGAGAGCCAGAGTTTGAAGGG + Intergenic
1029957231 7:104652687-104652709 AACGAGGGCCACTCTAAGAAGGG + Intronic
1051069377 9:13145310-13145332 AAGGGGGGCCCCATTTAGAATGG - Intronic
1051815050 9:21095374-21095396 ACCGCCAGCCACAGTTGGAATGG + Intergenic
1059253046 9:112904478-112904500 AACTGAGGCCACAGCTAGAAAGG - Intergenic